Lipid-Encapsulated mRNAs Encoding Complex Fusion Proteins Potentiate Antitumor Immune Responses.

Lipid nanoparticle (LNP)-encapsulated mRNA has been used for in vivo production of several secreted protein classes, such as IgG, and has enabled the development of personalized vaccines in oncology. Establishing the feasibility of delivering complex multispecific modalities that require higher-order structures important for their function could help expand the use of mRNA/LNP biologic formulations. Here, we evaluated whether in vivo administration of mRNA/LNP formulations of SIRPα-Fc-CD40L and TIGIT-Fc-LIGHT could achieve oligomerization and extend exposure, on-target activity, and antitumor responses comparable with that of the corresponding recombinant fusion proteins. Intravenous infusion of the formulated LNP-encapsulated mRNAs led to rapid and sustained production of functional hexameric proteins in vivo, which increased the overall exposure relative to the recombinant protein controls by ∼28 to 140 fold over 96 hours. High concentrations of the mRNA-encoded proteins were also observed in secondary lymphoid organs and within implanted tumors, with protein concentrations in tumors up to 134-fold greater than with the recombinant protein controls 24 hours after treatment. In addition, SIRPα-Fc-CD40L and TIGIT-Fc-LIGHT mRNAs induced a greater increase in antigen-specific CD8+ T cells in the tumors. These mRNA/LNP formulations were well tolerated and led to a rapid increase in serum and intratumoral IL2, delayed tumor growth, extended survival, and outperformed the activities of benchmark mAb controls. Furthermore, the mRNA/LNPs demonstrated improved efficacy in combination with anti-PD-L1 relative to the recombinant fusion proteins. These data support the delivery of complex oligomeric biologics as mRNA/LNP formulations, where high therapeutic expression and exposure could translate into improved patient outcomes. SIGNIFICANCE: Lipid nanoparticle-encapsulated mRNA can efficiently encode complex fusion proteins encompassing immune checkpoint blockers and costimulators that functionally oligomerize in vivo with extended pharmacokinetics and durable exposure to induce potent antitumor immunity.

Reshaping the tumor microenvironment with oncolytic viruses, positive regulation of the immune synapse, and blockade of the immunosuppressive oncometabolic circuitry.

BACKGROUND: Oncolytic viruses are considered part of immunotherapy and have shown promise in preclinical experiments and clinical trials. Results from these studies have suggested that tumor microenvironment remodeling is required to achieve an effective response in solid tumors. Here, we assess the extent to which targeting specific mechanisms underlying the immunosuppressive tumor microenvironment optimizes viroimmunotherapy. METHODS: We used RNA-seq analyses to analyze the transcriptome, and validated the results using Q-PCR, flow cytometry, and immunofluorescence. Viral activity was analyzed by replication assays and viral titration. Kyn and Trp metabolite levels were quantified using liquid chromatography-mass spectrometry. Aryl hydrocarbon receptor (AhR) activation was analyzed by examination of promoter activity. Therapeutic efficacy was assessed by tumor histopathology and survival in syngeneic murine models of gliomas, including Indoleamine 2,3-dioxygenase (IDO)-/- mice. Flow cytometry was used for immunophenotyping and quantification of cell populations. Immune activation was examined in co-cultures of immune and cancer cells. T-cell depletion was used to identify the role played by specific cell populations. Rechallenge experiments were performed to identify the development of anti-tumor memory. RESULTS: Bulk RNA-seq analyses showed the activation of the immunosuppressive IDO-kynurenine-AhR circuitry in response to Delta-24-RGDOX infection of tumors. To overcome the effect of this pivotal pathway, we combined Delta-24-RGDOX with clinically relevant IDO inhibitors. The combination therapy increased the frequency of CD8+ T cells and decreased the rate of myeloid-derived suppressor cell and immunosupressive Treg tumor populations in animal models of solid tumors. Functional studies demonstrated that IDO-blockade-dependent activation of immune cells against tumor antigens could be reversed by the oncometabolite kynurenine. The concurrent targeting of the effectors and suppressors of the tumor immune landscape significantly prolonged the survival in animal models of orthotopic gliomas. CONCLUSIONS: Our data identified for the first time the in vivo role of IDO-dependent immunosuppressive pathways in the resistance of solid tumors to oncolytic adenoviruses. Specifically, the IDO-Kyn-AhR activity was responsible for the resurface of local immunosuppression and resistance to therapy, which was ablated through IDO inhibition. Our data indicate that combined molecular and immune therapy may improve outcomes in human gliomas and other cancers treated with virotherapy.

GITRL-armed Delta-24-RGD oncolytic adenovirus prolongs survival and induces anti-glioma immune memory.

BACKGROUND: Viroimmunotherapy is evolving as a strong alternative for the standard treatment of malignant gliomas. Promising results from a recent clinical trial testing the anticancer effect of Delta-24-RGD in patients with glioblastoma suggested the induction of antitumoral immunity after viral administration. To further enhance the anti-glioma immune effect, we have armed Delta-24-RGD with the costimulatory ligand GITRL (Delta-24-GREAT [Glucocorticoid Receptor Enhanced Activity of T cells]). METHODS: We tested the infectivity and replication of Delta-24-GREAT, and the expression of ectopic GITRL in human and murine glioma cell lines. In vivo experiments involved the intracranial implantation of glioma cells into an immunocompetent model to study the anticancer effect, and rechallenging experiments to study long-term protection. Phenotypic and functional characterization of lymphocyte populations were performed by FACS and ELISA for Th1 cytokines expression, respectively. RESULTS: Our results showed that Delta-24-GREAT infects and induces the expression of GITRL. Delta-24-GREAT prolonged the survival of glioma-bearing immunocompetent mice and resulted in both anti-viral and anti-glioma immune responses, including increased frequency of central memory CD8+ T cells. Rechallenging the surviving mice with a second implantation of glioma cells did not lead to tumor growth; however, the surviving mice developed lethal tumors when B16/F10 melanoma cells were implanted intracranially, strongly indicating that the immune response was specific for glioma antigens. CONCLUSIONS: GITRL-armed Delta-24-RGD treatment results in an antigen-restricted antitumor memory, an enhanced anti-glioma effect, and the generation of central immune memory. Our results strongly indicate that this strategy represents a vertical advance in virotherapy designed to treat patients with malignant brain tumors.

TIE2 Associates with Caveolae and Regulates Caveolin-1 To Promote Their Nuclear Translocation.

DNA repair pathways are aberrant in cancer, enabling tumor cells to survive standard therapies-chemotherapy and radiotherapy. Our group previously reported that, upon irradiation, the membrane-bound tyrosine kinase receptor TIE2 translocates into the nucleus and phosphorylates histone H4 at Tyr51, recruiting ABL1 to the DNA repair complexes that participate in the nonhomologous end-joining pathway. However, no specific molecular mechanisms of TIE2 endocytosis have been reported. Here, we show that irradiation or ligand-induced TIE2 trafficking is dependent on caveolin-1, the main component of caveolae. Subcellular fractionation and confocal microscopy demonstrated TIE2/caveolin-1 complexes in the nucleus, and using inhibitor or small interfering RNAs (siRNAs) against caveolin-1 or Tie2 inhibited their trafficking. TIE2 was found in caveolae and directly phosphorylated caveolin-1 at Tyr14 in vitro and in vivo This modification regulated the generation of TIE2/caveolin-1 complexes and was essential for TIE2/caveolin-1 nuclear translocation. Our data further demonstrate that the combination of TIE2 and caveolin-1 inhibitors resulted in significant radiosensitization of malignant glioma cells, which will guide the development of combinatorial treatment with radiotherapy for patients with glioblastoma.

Oncolytic Adenovirus and Tumor-Targeting Immune Modulatory Therapy Improve Autologous Cancer Vaccination.

Oncolytic viruses selectively lyse tumor cells, disrupt immunosuppression within the tumor, and reactivate antitumor immunity, but they have yet to live up to their therapeutic potential. Immune checkpoint modulation has been efficacious in a variety of cancer with an immunogenic microenvironment, but is associated with toxicity due to nonspecific T-cell activation. Therefore, combining these two strategies would likely result in both effective and specific cancer therapy. To test the hypothesis, we first constructed oncolytic adenovirus Delta-24-RGDOX expressing the immune costimulator OX40 ligand (OX40L). Like its predecessor Delta-24-RGD, Delta-24-RGDOX induced immunogenic cell death and recruit lymphocytes to the tumor site. Compared with Delta-24-RGD, Delta-24-RGDOX exhibited superior tumor-specific activation of lymphocytes and proliferation of CD8+ T cells specific to tumor-associated antigens, resulting in cancer-specific immunity. Delta-24-RGDOX mediated more potent antiglioma activity in immunocompetent C57BL/6 but not immunodeficient athymic mice, leading to specific immune memory against the tumor. To further overcome the immune suppression mediated by programmed death-ligand 1 (PD-L1) expression on cancer cells accompanied with virotherapy, intratumoral injection of Delta-24-RGDOX and an anti-PD-L1 antibody showed synergistic inhibition of gliomas and significantly increased survival in mice. Our data demonstrate that combining an oncolytic virus with tumor-targeting immune checkpoint modulators elicits potent in situ autologous cancer vaccination, resulting in an efficacious, tumor-specific, and long-lasting therapeutic effect. Cancer Res; 77(14); 3894-907. ©2017 AACR.

Skeletal muscle salt inducible kinase 1 promotes insulin resistance in obesity.

OBJECTIVE: Insulin resistance causes type 2 diabetes mellitus and hyperglycemia due to excessive hepatic glucose production and inadequate peripheral glucose uptake. Our objectives were to test the hypothesis that the proposed CREB/CRTC2 inhibitor salt inducible kinase 1 (SIK1) contributes to whole body glucose homeostasis in vivo by regulating hepatic transcription of gluconeogenic genes and also to identify novel SIK1 actions on glucose metabolism. METHODS: We created conditional (floxed) SIK1-knockout mice and studied glucose metabolism in animals with global, liver, adipose or skeletal muscle Sik1 deletion. We examined cAMP-dependent regulation of SIK1 and the consequences of SIK1 depletion on primary mouse hepatocytes. We probed metabolic phenotypes in tissue-specific SIK1 knockout mice fed high fat diet through hyperinsulinemic-euglycemic clamps and biochemical analysis of insulin signaling. RESULTS: SIK1 knockout mice are viable and largely normoglycemic on chow diet. On high fat diet, global SIK1 knockout animals are strikingly protected from glucose intolerance, with both increased plasma insulin and enhanced peripheral insulin sensitivity. Surprisingly, liver SIK1 is not required for regulation of CRTC2 and gluconeogenesis, despite contributions of SIK1 to hepatocyte CRTC2 and gluconeogenesis regulation ex vivo. Sik1 mRNA accumulates in skeletal muscle of obese high fat diet-fed mice, and knockout of SIK1 in skeletal muscle, but not liver or adipose tissue, improves insulin sensitivity and muscle glucose uptake on high fat diet. CONCLUSIONS: SIK1 is dispensable for glycemic control on chow diet. SIK1 promotes insulin resistance on high fat diet by a cell-autonomous mechanism in skeletal muscle. Our study establishes SIK1 as a promising therapeutic target to improve skeletal muscle insulin sensitivity in obese individuals without deleterious effects on hepatic glucose production.

Oncolytic adenovirus research evolution: from cell-cycle checkpoints to immune checkpoints.

Oncolytic adenoviruses are modified to exploit the aberrant expression of proteins in cancer cells to obtain cancer-selective replication. Moreover, the natural tropism of oncolytic adenoviruses can be redirected to tumor cells. Clinical trials revealed that oncolytic viruses showed poor replication in the tumor that is due in part to the immune response against the virus. More recent data demonstrated that tumor infection might subvert the tumor immune system and lead to an anti-tumor immune response. In the next few years, combination of adenoviruses with immune checkpoint antibodies and other immune modulators will be tested in clinical trials.

CTCF binding to the first intron of the major immediate early (MIE) gene of human cytomegalovirus (HCMV) negatively regulates MIE gene expression and HCMV replication.

UNLABELLED: Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE: Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin-organizing factor, CTCF, has been found to facilitate human CMV gene expression, which affects viral replication. We also identified a CTCF-binding motif in the first intron (also called intron A) that directly binds to CTCF and is required for CTCF to repress MIE gene expression. Finally, we show that the CTCF-binding motif is conserved in CMV because a similar DNA sequence was found in murine CMV (MCMV) that is required for CTCF to bind to MCMV MIE gene to repress MCMV MIE gene expression.

Nuclear domain 10 of the viral aspect.

Nuclear domain 10 (ND10) are spherical bodies distributed throughout the nucleoplasm and measuring around 0.2-1.0 µm. First observed under an electron microscope, they were originally described as dense bodies found in the nucleus. They are known by a number of other names, including Promyelocytic Leukemia bodies (PML bodies), Kremer bodies, and PML oncogenic domains. ND10 are frequently associated with Cajal bodies and cleavage bodies. It has been suggested that they play a role in regulating gene transcription. ND10 were originally characterized using human autoantisera, which recognizes Speckled Protein of 100 kDa, from patients with primary biliary cirrhosis. At the immunohistochemical level, ND10 appear as nuclear punctate structures, with 10 indicating the approximate number of dots per nucleus observed. ND10 do not colocalize with kinetochores, centromeres, sites of mRNA processing, or chromosomes. Resistance of ND10 antigens to nuclease digestion and salt extraction suggest that ND10 are associated with the nuclear matrix. They are often identified by immunofluorescent assay using specific antibodies against PML, Death domain-associated protein, nuclear dot protein (NDP55), and so on. The role of ND10 has long been the subject of investigation, with the specific connection of ND10 and viral infection having been a particular focus for almost 20 years. This review summarizes the relationship of ND10 and viral infection. Some future study directions are also discussed.

Nuclear domain 10-associated proteins recognize and segregate intranuclear DNA/protein complexes to negate gene expression.

BACKGROUND: DNA viruses, such as herpes simplex virus type 1 (HSV-1), Simian virus 40 (SV40), and Cytomegaloviruses (CMV), start their replicative processes and transcription at specific nuclear domains known as ND10 (nuclear domain 10, also called PML bodies). It has been previously determined that for HSV-1 and SV40, a short DNA sequence and its binding protein are required and sufficient for cell localization of viral DNA replication and gene transcription. RESULTS: Our recent observations provide evidence that a foreign (not endogenous) DNA/protein complex in the nucleus recruits ND10 proteins. First, the complexes formed from the bacterial lac operator DNA and its binding protein (lac repressor), or from HPV11 (human papillomavirus 11) origin DNA and its binding protein (E2), co-localized with different ND10 proteins. Second, the HSV-1 amplicon without inserted lac operator DNA repeats distributed in the nucleus randomly, whereas the amplicon with lac operator DNA repeats associated with ND10, suggesting that DNA-binding proteins are required to localize at ND10. The cellular intrinsic DNA/protein complex (as detected for U2 DNA) showed no association with ND10. Furthermore, our examination of PML-/-, Daxx-/-, and Sp100-negative cells led to our discovering that DNA/protein complexes recruit ND10 protein independently. Using the GFP-LacI/Operator system, we were able to direct the transfected DNA to ND10 and found that gene expression was significantly repressed when the transfected DNA was directed to ND10. CONCLUSION: Taken together, the results suggest that cells recognize DNA/protein complexes through a mechanism that involves interaction with the ND10-associated proteins.