RESUMO
Atomoxetine is a drug widely used for the treatment of the attention deficit hyperactivity disorder (ADHD) with reduced risk of adverse motor reactions and chemical dependence. However, the pharmacokinetics characteristics as well as the toxicological risk of atomoxetine deserves further investigation to comprehensively analyze the therapeutic and safety aspects of this drug. This study aimed to predict the physicochemical profile and medicinal chemistry characteristics of atomoxetine, alongside its pharmacokinetic properties-namely absorption, distribution, metabolism, and excretion-as well as its toxicology (ADMET) potential through the utilization of web-based in silico tools. This research emphasizes predicted physicochemical, medicinal chemistry, and absorption parameters of atomoxetine that could influence the efficacy and safety of this drug for ADHD treatment. Additionally, atomoxetine also presents noteworthy predicted risks of hepatotoxicity, cardiotoxicity, neurotoxicity, nephrotoxicity, respiratory system toxicity, skin toxicity, and carcinogenicity. These findings underscore the necessity for further assessments of atomoxetine's safety profile, particularly considering different patient populations and durations of drug treatment. The data reported here from in silico predictions suggest that closer monitoring is warranted when atomoxetine is administered to patients with ADHD. Moreover, controlled studies detailing reliable protocols for personalized dosing, considering the multifactorial variability in metabolism efficiency and toxicological potential, would enable a more comprehensive assessment of atomoxetine's safety profile.
RESUMO
Yellow fever outbreaks are prevalent, particularly in endemic regions. Given the lack of an established treatment for this disease, significant attention has been directed toward managing this arbovirus. In response, we developed a multiepitope vaccine designed to elicit an immune response, utilizing advanced immunoinformatic and molecular modeling techniques. To achieve this, we predicted B- and T-cell epitopes using the sequences from all structural (E, prM, and C) and nonstructural proteins of 196 YFV strains. Through comprehensive analysis, we identified 10 cytotoxic T-lymphocyte (CTL) and 5T-helper (Th) epitopes that exhibited overlap with B-lymphocyte epitopes. These epitopes were further evaluated for their affinity to a wide range of human leukocyte antigen system alleles and were rigorously tested for antigenicity, immunogenicity, allergenicity, toxicity, and conservation. These epitopes were linked to an adjuvant ( ß -defensin) and to each other using ligands, resulting in a vaccine sequence with appropriate physicochemical properties. The 3D structure of this sequence was created, improved, and quality checked; then it was anchored to the Toll-like receptor. Molecular Dynamics and Quantum Mechanics/Molecular Mechanics simulations were employed to enhance the accuracy of docking calculations, with the QM portion of the simulations carried out utilizing the density functional theory formalism. Moreover, the inoculation model was able to provide an optimal codon sequence that was inserted into the pET-28a( +) vector for in silico cloning and could even stimulate highly relevant humoral and cellular immunological responses. Overall, these results suggest that the designed multi-epitope vaccine can serve as prophylaxis against the yellow fever virus.
Assuntos
Epitopos de Linfócito T , Vacina contra Febre Amarela , Febre Amarela , Vírus da Febre Amarela , Vacina contra Febre Amarela/imunologia , Vírus da Febre Amarela/imunologia , Vírus da Febre Amarela/genética , Humanos , Febre Amarela/prevenção & controle , Febre Amarela/imunologia , Epitopos de Linfócito T/imunologia , Epitopos de Linfócito B/imunologia , Vacinologia/métodos , Modelos Moleculares , Desenvolvimento de Vacinas , Simulação de Dinâmica Molecular , Linfócitos T Citotóxicos/imunologiaRESUMO
In this computational study, we advanced the understanding of the antigenic properties of the NADC-34-like isolate of the Porcine Reproductive and Respiratory Syndrome Virus (PRRSV), named YC-2020, relevant in veterinary pathology. We utilized sequence comparison analyses of the M and N proteins, comparing them with those of NADC34, identifying substantial amino acid homology that allowed us to highlight conserved epitopes and crucial variants. Through the application of Clustal Omega for multiple sequence alignment and platforms like Vaxijen and AllerTOP for predicting antigenic and allergenic potential, our analyses revealed important insights into the conservation and variation of epitopes essential for the development of effective diagnostic tools and vaccines. Our findings, aligned with initial experimental studies, underscore the importance of these epitopes in the development of targeted immunodiagnostic platforms and significantly contribute to the management and control of PRRSV. However, further studies are required to validate the computational predictions of antigenicity for this new viral isolate. This approach underscores the potential of computational models to enable ongoing monitoring and control of PRRSV evolution in swine. While this study provides valuable insights into the antigenic properties of the novel PRRSV isolate YC-2020 through computational analysis, it is important to acknowledge the limitations inherent to in silico predictions, specifically, the absence of laboratory validation.
Assuntos
Antígenos Virais , Síndrome Respiratória e Reprodutiva Suína , Vírus da Síndrome Respiratória e Reprodutiva Suína , Vírus da Síndrome Respiratória e Reprodutiva Suína/imunologia , Vírus da Síndrome Respiratória e Reprodutiva Suína/genética , Animais , Suínos , Síndrome Respiratória e Reprodutiva Suína/imunologia , Síndrome Respiratória e Reprodutiva Suína/virologia , Antígenos Virais/imunologia , Sequência de Aminoácidos , Biologia Computacional , Epitopos/imunologia , Alinhamento de Sequência/veterináriaRESUMO
Quilombolas are ethnic-racial groups, of black ancestry, and had their territories consolidated in Brazil in regions with difficult access and far from large centers. The objective of this study is to know the therapeutic itinerary (IT) adopted by quilombola women in traditional communities located in the North of the state of Minas Gerais. This is a qualitative study with the theoretical model using the Arthur Kleinman health care system. The study scenario was 23 quilombola communities in northern Minas Gerais. Forty quilombola women aged between 25 and 89 years were interviewed. Data analysis was performed following the IT. Units of analysis emerged that were grouped into three categories: quilombola women and the meaning of health and care; the professional care system in quilombola communities; and route of care in situations experienced by women. The therapeutic itinerary of the communities is mainly related to the actions of popular medicine. It was also possible to observe that there are weaknesses in relation to health care due to factors such as difficulty of access to institutionalized services.
Os quilombolas são grupos étnico-raciais de ancestralidade negra e tiveram seus territórios consolidados no Brasil em regiões com acesso difícil e distante dos grandes centros. O objetivo desse estudo é conhecer o itinerário terapêutico (IT) adotado por mulheres quilombolas em comunidades tradicionais localizadas no norte do estado de Minas Gerais. Trata-se de um estudo com abordagem qualitativa com o modelo teórico utilizando o sistema de cuidados à saúde de Arthur Kleinman. O estudo se deu em 23 comunidades quilombolas do norte de Minas Gerais. Foram entrevistadas 40 mulheres quilombolas, com idades entre 25 e 89 anos. A análise dos dados foi realizada seguindo os IT. Emergiram unidades de análise que foram agrupadas em três categorias: as mulheres quilombolas e o significado da saúde e do cuidado; o sistema de cuidado profissional nas comunidades quilombolas; e itinerário de cuidados nas situações vivenciadas pelas mulheres. O itinerário terapêutico das comunidades se mostra relacionado principalmente às ações de medicina popular. Foi possível observar ainda que existem fragilidades em relação à atenção à saúde devido a fatores como dificuldade de acesso aos serviços institucionalizados.
Assuntos
Medicina , Feminino , Humanos , Adulto , Pessoa de Meia-Idade , Idoso , Idoso de 80 Anos ou mais , Brasil , Análise de Dados , Instalações de Saúde , Pesquisa QualitativaRESUMO
SARS-CoV-2 genome underwent mutations since it started circulating within the human population. The aim of this study was to understand the fluctuation of the spike clusters concomitant to the population immunity either due to natural infection and/or vaccination in a state of Brazil that had both high rate of natural infection and vaccination coverage. A total of 1725 SARS-CoV-2 sequences from the state of Rio Grande do Norte, Brazil, were retrieved from GISAID and subjected to cluster analysis. Immunoinformatics were used to predict T- and B-cell epitopes, followed by simulation to estimate either pro- or anti-inflammatory responses and to correlate with circulating variants. From March 2020 to June 2022, the state of Rio Grande do Norte reported 579,931 COVID-19 cases with a 1.4% fatality rate across the three major waves: May-Sept 2020, Feb-Aug 2021, and Jan-Mar 2022. Cluster 0 variants (wild type strain, Zeta) were prevalent in the first wave and Delta (AY.*), which circulated in Brazil in the latter half of 2021, featuring fewer unique epitopes. Cluster 1 (Gamma (P.1 + P.1.*)) dominated the first half of 2021. Late 2021 had two new clusters, Cluster 2 (Omicron, (B.1.1.529 + BA.*)), and Cluster 3 (BA.*) with the most unique epitopes, in addition to Cluster 4 (Delta sub lineages) which emerged in the second half of 2021 with fewer unique epitopes. Cluster 1 epitopes showed a high pro-inflammatory propensity, while others exhibited a balanced cytokine induction. The clustering method effectively identified Spike groups that may contribute to immune evasion and clinical presentation, and explain in part the clinical outcome.
Assuntos
COVID-19 , Humanos , Brasil/epidemiologia , COVID-19/epidemiologia , SARS-CoV-2/genética , Glicoproteína da Espícula de Coronavírus/genética , Epitopos de Linfócito B , GlicoproteínasRESUMO
Resumo Os quilombolas são grupos étnico-raciais de ancestralidade negra e tiveram seus territórios consolidados no Brasil em regiões com acesso difícil e distante dos grandes centros. O objetivo desse estudo é conhecer o itinerário terapêutico (IT) adotado por mulheres quilombolas em comunidades tradicionais localizadas no norte do estado de Minas Gerais. Trata-se de um estudo com abordagem qualitativa com o modelo teórico utilizando o sistema de cuidados à saúde de Arthur Kleinman. O estudo se deu em 23 comunidades quilombolas do norte de Minas Gerais. Foram entrevistadas 40 mulheres quilombolas, com idades entre 25 e 89 anos. A análise dos dados foi realizada seguindo os IT. Emergiram unidades de análise que foram agrupadas em três categorias: as mulheres quilombolas e o significado da saúde e do cuidado; o sistema de cuidado profissional nas comunidades quilombolas; e itinerário de cuidados nas situações vivenciadas pelas mulheres. O itinerário terapêutico das comunidades se mostra relacionado principalmente às ações de medicina popular. Foi possível observar ainda que existem fragilidades em relação à atenção à saúde devido a fatores como dificuldade de acesso aos serviços institucionalizados.
Abstract Quilombolas are ethnic-racial groups, of black ancestry, and had their territories consolidated in Brazil in regions with difficult access and far from large centers. The objective of this study is to know the therapeutic itinerary (IT) adopted by quilombola women in traditional communities located in the North of the state of Minas Gerais. This is a qualitative study with the theoretical model using the Arthur Kleinman health care system. The study scenario was 23 quilombola communities in northern Minas Gerais. Forty quilombola women aged between 25 and 89 years were interviewed. Data analysis was performed following the IT. Units of analysis emerged that were grouped into three categories: quilombola women and the meaning of health and care; the professional care system in quilombola communities; and route of care in situations experienced by women. The therapeutic itinerary of the communities is mainly related to the actions of popular medicine. It was also possible to observe that there are weaknesses in relation to health care due to factors such as difficulty of access to institutionalized services.
RESUMO
Resumo O objetivo deste artigo é avaliar a prevalência e fatores associados aos Transtornos Mentais Comuns (TMC) em quilombolas residentes em comunidades rurais localizadas no norte de Minas Gerais, Brasil. Trata-se de estudo transversal realizado em 2019 a partir de entrevistas estruturadas e aplicação do Self Reporting Questionnaire (SRQ-20). Foi conduzida regressão logística binária. A prevalência de TMC foi de 38,7%. Houve maior chance de TMC entre quilombolas do sexo feminino (OR: 2,69; IC95% 2,00-3,62), com 1 a 8 anos de estudo (OR: 1,70; IC95% 1,15-2,51), renda familiar entre 1 a 1,5 salário mínimo (OR: 2,51; IC95% 1,60-3,94); que sofreram discriminação em serviços de saúde (OR: 2,44; IC95% 1,44-4,13); com autorrelato de doença pulmonar (OR: 2,10; IC95% 1,25-3,54), doença cardíaca (OR: 1,58; IC95% 1,01-2,50) e insuficiência renal crônica (OR: 1,97; IC95% 1,08-3,94), e com autopercepção de saúde negativa (OR: 3,07; IC95% 2,31-4,07). A alta prevalência de TMC observada neste estudo demonstra a necessidade de políticas de atenção à saúde mental voltadas para as populações vulnerabilizadas, como as comunidades quilombolas, a fim de mitigar o sofrimento mental e favorecer uma atenção profissional contextualizada com as singularidades das condições de vida e saúde desse grupo populacional.
Abstract The scope of this article is to assess the prevalence and factors associated with Common Mental Disorders (CMD) in "quilombolas" (Afro-Brazilian residents of quilombo settlements) in rural communities located in the North of Minas Gerais, Brazil. It is a cross-sectional study of 2019 based on structured interviews and application of a Self-Reporting Questionnaire (SRQ-20). Binary logistic regression was conducted. The prevalence of CMD was 38.7%. There was a higher preponderance of CMD among female quilombolas (OR: 2.69; 95%CI 2.00-3.62), with 1 to 8 years of schooling (OR: 1.70; 95%CI 1.15-2,51), family income of 1 to 1,5 minimum wages (OR: 2.51; 95%CI 1.60-3.94); who suffered discrimination in health services (OR: 2.44; 95%CI 1.44-4.13); with self-reported lung disease (OR: 2.10; 95%CI 1.25-3.54), heart disease (OR: 1.58; 95%CI 1.01-2.50) chronic renal failure (OR: 1.97; 95%CI 1.08-3.94), and negative self-perception of health (OR: 3.07; 95%CI 2.31-4.07). The high prevalence of CMD revealed in this study demonstrates the need for mental health care policies aimed at vulnerable populations, such as quilombola communities, in order to mitigate mental suffering and promote professional contextualized care for the idiosyncrasies of health and living conditions of this population group.
RESUMO
The scope of this article is to assess the prevalence and factors associated with Common Mental Disorders (CMD) in "quilombolas" (Afro-Brazilian residents of quilombo settlements) in rural communities located in the North of Minas Gerais, Brazil. It is a cross-sectional study of 2019 based on structured interviews and application of a Self-Reporting Questionnaire (SRQ-20). Binary logistic regression was conducted. The prevalence of CMD was 38.7%. There was a higher preponderance of CMD among female quilombolas (OR: 2.69; 95%CI 2.00-3.62), with 1 to 8 years of schooling (OR: 1.70; 95%CI 1.15-2,51), family income of 1 to 1,5 minimum wages (OR: 2.51; 95%CI 1.60-3.94); who suffered discrimination in health services (OR: 2.44; 95%CI 1.44-4.13); with self-reported lung disease (OR: 2.10; 95%CI 1.25-3.54), heart disease (OR: 1.58; 95%CI 1.01-2.50) chronic renal failure (OR: 1.97; 95%CI 1.08-3.94), and negative self-perception of health (OR: 3.07; 95%CI 2.31-4.07). The high prevalence of CMD revealed in this study demonstrates the need for mental health care policies aimed at vulnerable populations, such as quilombola communities, in order to mitigate mental suffering and promote professional contextualized care for the idiosyncrasies of health and living conditions of this population group.
O objetivo deste artigo é avaliar a prevalência e fatores associados aos Transtornos Mentais Comuns (TMC) em quilombolas residentes em comunidades rurais localizadas no norte de Minas Gerais, Brasil. Trata-se de estudo transversal realizado em 2019 a partir de entrevistas estruturadas e aplicação do Self Reporting Questionnaire (SRQ-20). Foi conduzida regressão logística binária. A prevalência de TMC foi de 38,7%. Houve maior chance de TMC entre quilombolas do sexo feminino (OR: 2,69; IC95% 2,00-3,62), com 1 a 8 anos de estudo (OR: 1,70; IC95% 1,15-2,51), renda familiar entre 1 a 1,5 salário mínimo (OR: 2,51; IC95% 1,60-3,94); que sofreram discriminação em serviços de saúde (OR: 2,44; IC95% 1,44-4,13); com autorrelato de doença pulmonar (OR: 2,10; IC95% 1,25-3,54), doença cardíaca (OR: 1,58; IC95% 1,01-2,50) e insuficiência renal crônica (OR: 1,97; IC95% 1,08-3,94), e com autopercepção de saúde negativa (OR: 3,07; IC95% 2,31-4,07). A alta prevalência de TMC observada neste estudo demonstra a necessidade de políticas de atenção à saúde mental voltadas para as populações vulnerabilizadas, como as comunidades quilombolas, a fim de mitigar o sofrimento mental e favorecer uma atenção profissional contextualizada com as singularidades das condições de vida e saúde desse grupo populacional.
Assuntos
Transtornos Mentais , População Rural , Humanos , Feminino , Brasil/epidemiologia , Estudos Transversais , Transtornos Mentais/epidemiologia , Transtornos Mentais/psicologia , Renda , PrevalênciaRESUMO
Quilombola men perform productive activities that require great physical strength in environments conducive to several risks, accidents, and health problems. This study aimed to map the work processes of quilombola men in three locations in Norte de Minas region in the State of Minas Gerais, Brazil, using the methodological framework of Cartography proposed by Gilles Deleuze & Félix Guattari. Data were produced by the observation of work processes, individual interviews, and records of the effects in a mapping diary. Discourse analysis Allowed for the elaboration of a descriptor flowchart and the definition of three thematic categories. In the mapped locations, the intersection of gender, ethnicity, and class collaborates directly for the performance of activities in charcoal furnaces, quarries, and banana plantations. These environments are highly unhealthy due to the presence of heat and smoke, methods that demand great physical effort and produce silica dust, excessive sun exposure, and the use of pesticides. The integration between the workers' health surveillance (VISAT) and the Brazilian Public Labor Prosecutor Office allows for the articulation of an intersectoral network of popular education, technical assistance, and professional training and qualification. These measures will directly affect the health-disease process, the quality of life of workers, and the environmental preservation of the mapped locations.
Os homens quilombolas exercem atividades produtivas que exigem grande força física, em ambientes propiciadores de diversos riscos, acidentes e agravos à saúde. O objetivo deste estudo foi cartografar os processos de trabalho de homens quilombolas em três territórios da região Norte de Minas, no Estado de Minas Gerais, Brasil. Para sua construção, utilizamos o referencial metodológico da Cartografia proposto pelos filósofos Gilles Deleuze & Félix Guattari. Os dados foram produzidos por meio da observação dos processos de trabalho, entrevistas individuais e registros das afetações em um diário cartográfico. A Análise de Discurso possibilitou a elaboração de um fluxograma descritor e a definição de três categorias temáticas. Nos territórios rastreados, a intersecção de gênero, raça e classe colabora diretamente para a execução de atividades na carvoaria, pedreira e bananal. Esses ambientes são altamente insalubres, com presença de calor e fumaça, métodos que geram grande esforço físico e poeira de sílica, exposição excessiva ao sol e uso de agrotóxicos. A integração entre a vigilância em saúde do trabalhador (VISAT) e o Ministério Público do Trabalho permite a articulação de uma rede intersetorial de educação popular, assistência técnica, qualificação e capacitação profissional. Essas medidas terão impacto direto no processo saúde-doença, na qualidade de vida dos trabalhadores e na preservação ambiental dos territórios cartografados.
Los hombres quilombolas realizan actividades productivas que requieren una gran fuerza física, en entornos que conllevan diversos riesgos, accidentes y peligros para la salud. El objetivo de este estudio fue cartografiar los procesos de trabajo de los hombres quilombolas en tres territorios de la región Norte de Minas en el estado de Minas Gerais, Brasil. Para su construcción, hemos utilizado el marco metodológico de la Cartografía propuesto por los filósofos Gilles Deleuze & Félix Guattari. Los datos se produjeron mediante la observación de los procesos de trabajo, las entrevistas individuales y el registro de los efectos en un diario cartográfico. El Análisis del Discurso permitió elaborar un organigrama descriptivo y definir tres categorías temáticas. En los territorios rastreados, la intersección de género, raza y clase colabora directamente con la realización de actividades de producción de carbón vegetal, canteras y plantaciones de plátanos. Estos entornos son altamente insalubres, con presencia de calor y humo, métodos que generan gran esfuerzo físico y polvo de sílice, exposición excesiva al sol y uso de agroquímicos. La integración entre la vigilancia de la salud de los trabajadores (VISAT) y la Fiscalía del Trabajo permite la articulación de una red intersectorial de educación popular, asistencia técnica, calificación profesional y formación. Estas medidas tendrán un impacto directo en el proceso salud-enfermedad, en la calidad de vida de los trabajadores y en la preservación medioambiental de los territorios cartografiados.
Assuntos
Saúde Ocupacional , Qualidade de Vida , Masculino , Humanos , Brasil , Comportamentos Relacionados com a Saúde , EtnicidadeRESUMO
Resumo Objetivo investigar a autopercepção das condições bucais e fatores associados em idosos quilombolas rurais do norte de Minas Gerais, Brasil. Método Trata-se de um estudo analítico e transversal de base populacional, no qual utilizou-se uma amostragem por conglomerados com probabilidade proporcional ao tamanho (n=406). A coleta de dados envolveu a realização de entrevistas e exames clínicos odontológicos. A autopercepção das condições bucais foi avaliada por meio do GOHAI (Índice de Determinação da Saúde Bucal Geriátrica). Resultados A maioria dos idosos autopercebeu a saúde bucal como ótima (46,3%) ou regular (30,2%). Os pesquisados revelaram ainda precária saúde bucal e acesso restrito aos serviços odontológicos. Verificaram-se, na análise múltipla, associações significantes (p˂0,05) entre GOHAI regular e variáveis relativas ao local da última consulta e uso de prótese, bem como entre GOHAI ruim e variáveis atinentes ao estado conjugal, religião, motivo da última consulta, índice CPO-D e uso de prótese. Conclusão Parcela expressiva dos idosos quilombolas manifestou uma autoavaliação mais positiva da saúde bucal, divergente do quadro odontológico constatado profissionalmente. Constatou-se ainda que o relato de percepção ruim das condições bucais esteve fortemente associado a uma saúde bucal mais precária entre os investigados.
Abstract Objective to investigate self-perception of oral conditions and associated factors in rural quilombola older people in northern Minas Gerais, Brazil. Method This is an analytical and cross-sectional population-based study, in which cluster sampling with probability proportional to size (n=406) was used. Data collection involved conducting interviews and clinical dental examinations. Self-perception of oral conditions was assessed using the GOHAI (Geriatric Oral Health Determination Index). Results Most older people self-perceived oral health as excellent (46.3%) or regular (30.2%). Those surveyed also revealed precarious oral health and restricted access to dental services. In the multiple analysis, significant associations (p˂0.05) were found between regular GOHAI and variables related to the location of the last consultation and use of prosthesis, as well as between poor GOHAI and variables related to marital status, religion, reason for last consultation, CPO-D index and use of prosthesis. Conclusion A significant portion of the quilombola older people showed a more positive self-assessment of oral health, which differs from the professionally verified dental condition. It was also found that the report of poor perception of oral conditions was strongly associated with poorer oral health among those investigated.
Assuntos
Humanos , Masculino , Feminino , Pessoa de Meia-Idade , Idoso , Idoso de 80 Anos ou mais , Autoimagem , Serviços de Saúde Bucal , Odontologia Geriátrica , Brasil , Saúde Bucal/etnologia , Assistência Odontológica para Idosos , Diagnóstico Bucal , Autoavaliação Diagnóstica , Acessibilidade aos Serviços de Saúde/organização & administraçãoRESUMO
Genome-wide association studies (GWASs) are a research approach used to identify genetic variants associated with common diseases, like COVID-19. The lead genetic variants (n = 41) reported by the eleven largest COVID-19 GWASs are mapped to 22 different chromosomal regions. The loci 3q21.31 (LZTFL1 and chemokine receptor genes) and 9q34.2 (ABO), associated with disease severity and susceptibility to infection, respectively, were the most replicated findings across studies. Genes involved with mucociliary clearance (CEP97, FOXP4), viral-entry (ACE2, SLC6A20) and mucosal immunity (MIR6891) are associated with the risk of SARS-CoV-2 infection while genes of antiviral immune response (IFNAR2, OAS1), leukocyte trafficking (CCR9, CXCR6) and lung injury (DPP9, NOTCH4) are associated with severe disease. The biological processes underlying the risk of infection occur prominently, but not exclusively, in the upper airways whereas the severe COVID-19-associated processes in alveolar-capillary interface. The COVID-19 GWASs has unraveled key genetic mechanisms of SARS-CoV-2 pathogenesis, although the genetic basis of other COVID-19 related phenotypes (long COVID and neurological impairment) remains to be elucidated.
Assuntos
COVID-19 , Humanos , COVID-19/genética , SARS-CoV-2/genética , Estudo de Associação Genômica Ampla , Síndrome de COVID-19 Pós-Aguda , Antivirais , Proteínas de Membrana TransportadorasRESUMO
O cigarro eletrônico surgiu como uma tentativa para minimizar a dependência ao uso de tabaco, entretanto, engloba controvérsias e dúvidas acerca das reais implicações para o organismo humano. Diante disso, o presente estudo tem como objetivo realizar uma revisão da literatura a fim de relacionar o uso de cigarro eletrônico com suas consequências para os humanos. Os estudos analisados relatam experimentos in vitro e in vivo em camundongos, demonstrando menor concentração de poluentes e nocividades no cigarro eletrônico comparado ao convencional, porém, seu potencial efeito maléfico está relacionado à composição do e-líquido, à maneira do uso e à variedade de aromas presentes nos produtos. Além disso, foram verificadas lesões celulares, hiperreatividade das vias aéreas, liberação de citocinas IL-8, IL-10 e TNF, redução da ação antimicrobiana de queratinócitos e potencial apoptose nas células alveolares. Foi observado também um aumento em até cinco vezes da concentração de carboxihemoglobina em comparação ao cigarro comum e um aumento na auto renovação de células de adenocarcinoma pulmonar de células não pequenas, devido à expressão de SOX2. Observa-se também que em casos de DPOC, o cigarro eletrônico não apresenta agravamentos na fisiologia respiratória, contrapondo outras ocorrências como asma, pneumonia, câncer de pulmão e doenças infecciosas que podem ser ocasionadas ou exacerbadas pelo seu uso. Contudo, pelo curto prazo de observação de seus efeitos, não é possível determinar com precisão a segurança dos cigarros eletrônicos, dessa forma, faz-se necessário que mais pesquisas longitudinais sejam desenvolvidas, auxiliando, assim, na construção de evidências sobre a segurança dos cigarros eletrônicos e na regulamentação futura do produto.
Electronic cigarettes emerged as an attempt to minimize tobacco dependence. However, its use is surrounded by controversies and doubts about the real implications for the human organism. Therefore, this study aims at performing a review of the most recent literature to corelate the use of e-cigarettes with their consequences for the human body. The analyzed studies relate in vitro and in vivo experiments on mice, demonstrating lower concentration of pollutants and harmfulness in the electronic cigarette than in conventional cigarettes. However, its potential harmful effect is related to the composition of the e-liquid, in its use and in the variety of aromas in the products. In addition, cellular lesions, airway hyperreactivity, release of IL-8, IL-10 and TNF cytokines could be observed, as well as reduced keratinocyte antimicrobial action and potential apoptosis in alveolar cells. An increase of up to five-fold the concentration of carboxyhemoglobin in comparison to ordinary cigarettes and an increase in self-renewal of non-small pulmonary adenocarcinoma cells due to the expression of SOX2 have also been related. It could also be observed that in COPD cases, e-cigarettes do not present worsening in respiratory physiology, which contrasts with other occurrences such as asthma, pneumonia, lung cancer, and infectious diseases that can be caused or exacerbated by its use. However, due to the short term of observation of the effects, the safety of e-cigarettes could not be accurately determined, thus, the need for further longitudinal research is necessary, which could be used to help build evidence about the safety of e-cigarettes and also to create future regulation of the product.
Assuntos
Animais , Camundongos , Ratos , Sistemas Eletrônicos de Liberação de Nicotina/instrumentação , Pneumopatias , Pneumonia/complicações , Asma/complicações , Tabagismo/complicações , Fumar , Doença , Lesão Pulmonar , Uso de Tabaco , Vaping , Fumantes , Vapor do Cigarro Eletrônico/efeitos adversos , Neoplasias PulmonaresRESUMO
OBJECTIVE: To analyze the prevalence of abdominal obesity and associated factors in quilombola communities in Northern Minas Gerais, Brazil. METHODS: This was a cross-sectional study conducted in 2019 through structured interviews and waist circumference measurement; Poisson regression was used, separated by gender, to calculate prevalence ratios (PR) of abdominal obesity adjusted by independent variables and 95% confidence interval (95%CI). RESULTS: 56.6% (95% CI 50.9;62.0) of the observed quilombolas presented abdominal obesity; in the adjusted analysis, among men, there was an association of the outcome with age ≥60 years old (60-69 years old: PR=2.52 - CI95% 1.33; 4.75), not being a smoker (PR=1.73 - 95%CI 1.17;2.55) and reported arterial hypertension (PR=1.42 - 95%CI 1.11;1.80), while in women, it was associated with age ≥50 years old (50-59 years old: PR=1.25 - 95% CI 1.01;1.54), smoking cessation (PR=1.26 - 95% CI 1.00; 1.58), consumption of chicken with skin (PR=1.09 - 95% CI 1.00;1.19) and hypertension (PR=1.22 - 95% CI 1.11;1.36). CONCLUSION: There was high prevalence of abdominal obesity among quilombolas. It was higher in the elderly, smokers, former smokers and those with hypertension.
Assuntos
Obesidade Abdominal , Idoso , Índice de Massa Corporal , Brasil/epidemiologia , Estudos Transversais , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Obesidade/epidemiologia , Obesidade Abdominal/epidemiologiaRESUMO
COVID-19 was first reported in Wuhan, China, in December 2019. It is widely accepted that the world will not return to its prepandemic normality until safe and effective vaccines are available and a global vaccination program has been successfully implemented. Antisense RNAs are single-stranded RNAs that occur naturally or are synthetic and enable hybridizing and protein-blocking translation. Therefore, the main objective of this study was to identify target markers in the RNA of the severe acute respiratory syndrome coronavirus, or SARS-CoV-2, with a length between 21 and 28 bases that could enable the development of vaccines and therapies based on antisense RNA. We used a search algorithm in C language to compare 3159 complete nucleotide sequences from SARS-CoV-2 downloaded from the repository of the National Center for Biotechnology Information. The objective was to verify whether any common sequences were present in all 3159 strains of SARS-CoV-2. In the first of three datasets (SARS-CoV-2), the algorithm found two sequences each of 21 nucleotides (Sequence 1: CTACTGAAGCCTTTGAAAAAA; Sequence 2: TGTGGTTATACCTACTAAAAA). In the second dataset (SARS-CoV) and third dataset (MERS-CoV), no sequences of size N between 21 and 28 were found. Sequence 1 and Sequence 2 were input into BLAST® â« blastn and recognized by the platform. The gene identified by the sequences found by the algorithm was the ORF1ab region of SARS-CoV-2. Considerable progress in antisense RNA research has been made in recent years, and great achievements in the application of antisense RNA have been observed. However, many mechanisms of antisense RNA are not yet understood. Thus, more time and money must be invested into the development of therapies for gene regulation mediated by antisense RNA to treat COVID-19 as no effective therapy for this disease has yet been found.
Assuntos
COVID-19/genética , RNA Antissenso/genética , SARS-CoV-2/genética , Algoritmos , COVID-19/virologia , Simulação por Computador , Regulação Viral da Expressão Gênica , HumanosRESUMO
Objective: to analyze the prevalence of abdominal obesity and associated factors in quilombola communities in Northern Minas Gerais, Brazil. Methods: cross-sectional study conducted in 2019 based on structured interviews and measurement of waist circumference; Poisson regression, separated by sex, was used to calculate prevalence ratios (PR) of abdominal obesity adjusted by independent variables and a 95% confidence interval (CI95%). Results: 56.6% (CI95% 50.9;62.0) had abdominal obesity. In the adjusted analysis, among men there was an association of the outcome with age ≥60 years (60-69 years: PR=2.52 CI95% 1.33;4.75), non-smokers (PR=1.73 CI95% 1.17;2.55), and hypertension (PR=1.42 CI95% 1.11;1.80); in women, the outcome was associated with age ≥50 years (50-59 years: PR=1.25 CI95% 1.01;1.54), ex-smokers (PR=1.26 CI95% 1.00;1.58), consumption of chicken with skin (PR=1.09 CI95% 1.00;1.19), and hypertension (PR=1.22 CI95% 1.11;1.36). Conclusion: the prevalence of abdominal obesity was high among quilombolas, and it was higher in the elderly, hypertensive, smokers and ex-smokers.
Objetivo: analisar a prevalência de obesidade abdominal e fatores associados em comunidades quilombolas do Norte de Minas Gerais, Brasil. Métodos: estudo transversal realizado em 2019, sobre entrevistas estruturadas e mensuração do perímetro da cintura; empregou-se regressão de Poisson, separada por sexo, para calcular razões de prevalências (RP) da obesidade abdominal ajustada pelas variáveis independentes e intervalo de confiança de 95% (IC95%). Resultados: 56,6% (IC95% 50,9;62,0) dos quilombolas observados apresentaram obesidade abdominal; na análise ajustada, entre homens, verificou-se associação do desfecho com idade de ≥60 anos (60-69 anos: RP=2,52 IC95% 1,33;4,75), não ser tabagista (RP=1,73 IC95% 1,17;2,55) e referir hipertensão arterial (RP=1,42 IC95% 1,11;1,80), enquanto nas mulheres, associou-se com idade ≥50 anos (50-59 anos: RP=1,25 IC95% 1,01;1,54), ex-tabagismo (RP=1,26 IC95% 1,00;1,58), consumo de frango com pele (RP=1,09 IC95% 1,00;1,19) e hipertensão (RP=1,22 IC95% 1,11;1,36). Conclusão: encontrou-se prevalência de obesidade abdominal alta entre os quilombolas, maior nos idosos, hipertensos, fumantes e ex-fumantes.
RESUMO
Abstract: Introduction: Patient-centered care has been associated with positive results in medical practice. Objective: The aim of this study was to evaluate the attitudes of students and teachers from a Brazilian medical school regarding the physician-patient relationship and verify associated factors. Methods: This was an analytical cross-sectional study carried out in a public university, using the PPOS "Patient-Practitioner Orientation Scale" as well as a sociodemographic questionnaire. The subjects were regularly enrolled students attending the second semester of 2015 and their teachers. Mann-Whitney and Kruskal-Wallis tests were used to examine the effect of sociodemographic variables and the interaction with the scores found for students and teachers. Results: A total of 212 students were surveyed, corresponding to 57.1% of the enrolled students in the medical course. The value of the total PPOS score found for the students was 4.35 (± 0.5 SD), and the mean total score of PPOS among female students (4.43) was significantly higher than that in males (4.23) (p < 0.001), indicating more patient-centered attitudes in that group. Regarding medical teachers, 77 (56%) participated. The total score of PPOS was 4.52 (± 0.5 SD), with a more patient-centered attitude among teachers in comparison to students (4.35) (p = 0.001). However, there is a clear need for progress in both groups. Conclusion: The analysis of the students' and teachers' attitudes about the physician-patient relationship disclosed an unknown scenario, with more patient-centered attitudes verified among teachers despite the need for improvements by both. Further research is needed to evaluate not only the attitude but the behavior of these subjects.
Resumo: Introdução: O cuidado centrado no paciente tem sido associado a resultados positivos. Objetivo: o objetivo deste estudo foi avaliar atitudes de estudantes e professores de uma faculdade de medicina brasileira quanto à relação médico-paciente e verificar fatores associados. Métodos: Trata-se de um estudo transversal analítico realizado em uma universidade pública, utilizando a PPOS - "Patient-Practitioner Orientation Scale" e um questionário sociodemográfico. Os sujeitos eram estudantes do curso de medicina e professores da instituição em questão no segundo semestre de 2015. Os testes de Mann-Whitney e Kruskal-Wallis foram utilizados para examinar o efeito das variáveis sociodemográficas e a interação com os escores encontrados para estudantes e professores. Resultados: Foram pesquisados 212 estudantes, correspondendo a 57,1% dos acadêmicos matriculados no curso de medicina. O valor do escore total da PPOS encontrado para os estudantes foi de 4,35 (± 0,5 DP), e o escore total médio da PPOS entre estudantes do sexo feminino (4,43) foi significativamente maior do que o masculino (4,23) (p <0,001), indicando mais atitudes centradas no paciente naquele grupo. No que se refere aos professores de medicina, 77 (56%) participaram. O escore total do PPOS foi de 4,52 (± 0,5 DP), com atitude mais focada no paciente entre os professores do que entre estudantes (4,35) (p = 0,001), mas há uma clara necessidade de progresso para ambos os grupos. Conclusão: A análise das atitudes de estudantes e professores sobre a relação médico-paciente permitiu desvendar um cenário desconhecido com atitudes mais centradas no paciente observadas entre os professores, apesar da necessidade de melhorias em ambos os grupos. Mais pesquisas são necessárias para avaliar não apenas a atitude, mas o comportamento desses sujeitos.
RESUMO
Objetivo: Analisar a prevalência de obesidade abdominal e fatores associados em comunidades quilombolas do norte de Minas Gerais, Brasil. Métodos: Estudo transversal realizado em 2019, a partir de entrevistas estruturadas e mensuração do perímetro da cintura; empregou-se regressão de Poisson, separada por sexo, para calcular razões de prevalência (RP) da obesidade abdominal ajustadas pelas variáveis independentes e intervalo de confiança de 95% (IC95%). Resultados: 56,6% (IC95% 50,9;62,0) dos quilombolas observados apresentaram obesidade abdominal; na análise ajustada, entre homens, verificou-se associação do desfecho com idade de ≥;60 anos (60-69 anos: RP=2,52 - IC95% 1,33;4,75), não ser tabagista (RP=1,73 - IC95% 1,17;2,55) e referir hipertensão arterial (RP=1,42 - IC95% 1,11;1,80), enquanto, nas mulheres, associou-se com idade ≥50 anos (50-59 anos: RP=1,25 - IC95% 1,01;1,54), ex-tabagismo (RP=1,26 - IC95% 1,00;1,58), consumo de frango com pele (RP=1,09 - IC95% 1,00;1,19) e hipertensão (RP=1,22 - IC95% 1,11;1,36). Conclusão: Encontrou-se prevalência de obesidade abdominal alta entre os quilombolas, maior nos idosos, hipertensos, fumantes e ex-fumantes.
Objetivo: Analizar la prevalencia de obesidad abdominal y factores asociados en comunidades quilombolas del norte de Minas Gerais, Brasil. Métodos: Estudio transversal realizado en 2019 a partir de entrevistas y medición de la circunferencia de la cintura; se utilizó la regresión de Poisson para calcular las razones de prevalencia (RP) de la obesidad abdominal ajustadas por variables independientes y un intervalo de confianza del 95% (IC95%). Resultados: 56,6% (IC95% 50,9;62,0) tenía obesidad abdominal; entre los hombres hubo una asociación del resultado con la edad ≥60 años (60-69 años: RP=2,52 - IC95% 1,33;4,75), no fumadores (RP=1,73 - IC95% 1,17;2,55) e hipertensión (RP=1,42; IC95% 1,11;1,80); en las mujeres, se asoció con la edad ≥50 años (50-59 años: RP=1,25 - IC95% 1,01;1,54), exfumadoras (RP=1,26 - IC95% 1,00;1,58), consumo de pollo con piel (RP=1,09 - IC95% 1,00;1,19) e hipertensión (RP=1,22 - IC95% 1,11;1,36). Conclusión: La prevalencia de obesidad abdominal fue alta entre quilombolas, y fue mayor en ancianos, hipertensos, fumadores y exfumadores.
Objective: To analyze the prevalence of abdominal obesity and associated factors in quilombola communities in Northern Minas Gerais, Brazil. Methods: This was a cross-sectional study conducted in 2019 through structured interviews and waist circumference measurement; Poisson regression was used, separated by gender, to calculate prevalence ratios (PR) of abdominal obesity adjusted by independent variables and 95% confidence interval (95%CI). Results: 56.6% (95% CI 50.9;62.0) of the observed quilombolas presented abdominal obesity; in the adjusted analysis, among men, there was an association of the outcome with age ≥60 years old (60-69 years old: PR=2.52 - CI95% 1.33; 4.75), not being a smoker (PR=1.73 - 95%CI 1.17;2.55) and reported arterial hypertension (PR=1.42 - 95%CI 1.11;1.80), while in women, it was associated with age ≥50 years old (50-59 years old: PR=1.25 - 95% CI 1.01;1.54), smoking cessation (PR=1.26 - 95% CI 1.00; 1.58), consumption of chicken with skin (PR=1.09 - 95% CI 1.00;1.19) and hypertension (PR=1.22 - 95% CI 1.11;1.36). Conclusion: There was high prevalence of abdominal obesity among quilombolas. It was higher in the elderly, smokers, former smokers and those with hypertension.
Assuntos
Humanos , Masculino , Feminino , Pessoa de Meia-Idade , Idoso , Índice de Massa Corporal , Obesidade Abdominal , Obesidade/epidemiologia , Brasil/epidemiologia , Estudos Transversais , População Negra , QuilombolasRESUMO
O estudo mapeou as condições de trabalho de homens quilombolas residentes no norte do estado de Minas Gerais, Brasil. Utilizou-se o método cartográfico proposto por Gilles Deleuze e Félix Guattari. Os dados foram produzidos em 23 comunidades, por meio de entrevistas individuais, observação de campo e registro das afetações em um diário. A análise de discurso possibilitou a construção de três categorias temáticas e a elaboração de um fluxograma descritor das linhas de força do trabalho. A intersecção de raça/etnia, gênero, região, classe e escolaridade colabora para a precariedade e informalidade ocupacional. No trabalho, as linhas flexíveis permitem vivências de prazer e as linhas duras, o desenvolvimento de adoecimento mental. Nesse sentido, as políticas públicas focadas nos quilombolas necessitam de articulação e fortalecimento pelo Estado, além do esforço para a participação de todos os atores envolvidos, principalmente os homens quilombolas. (AU)
This study mapped the working conditions of Quilombola men living in the north of the State of Minas Gerais, Brazil using the cartographic method proposed by Gilles Deleuze and Félix Guattari. The data were produced in 23 communities using individual interviews, field observations and documentation of affectations in a diary. Discourse analysis enabled the construction of three thematic categories and a flow diagram depicting the lines of work force. The intersection between race/ethnicity, gender, region, class, and level of education contributes to employment precariousness and informality. With regard to work, the flexible lines allow experiences of pleasure and the hard lines lead to the development of mental illness. Policies directed at Quilombolas therefore need to be articulated and strengthened by the government and efforts are needed to promote the participation of all actors involved, especially Quilombola men. (AU)
El estudio mapeó las condiciones de trabajo de hombres quilombolas residentes en el norte del Estado de Minas Gerais, Brasil. Se utilizó el método cartográfico propuesto por Gilles Deleuze y Félix Guattari. Los datos se obtuvieron en 23 comunidades, por medio de entrevistas individuales, observación de campo y registro de las afectaciones en un diario. El Análisis de Discurso posibilitó la construcción de tres categorías temáticas y la elaboración de un diagrama de flujo descriptor de las líneas de fuerza del trabajo. La intersección de raza/etnia, género, región, clase y escolaridad colabora para la precariedad e informalidad ocupacional. En el trabajo, las líneas flexibles permiten vivencias de placer y las líneas duras el desarrollo de la enfermedad mental. En ese sentido, las políticas públicas enfocadas en los quilombolas necesitan articulación y fortalecimiento por parte del estado, además del esfuerzo para la participación de todos los actores envueltos, principalmente los hombres quilombolas. (AU)
Assuntos
Humanos , Masculino , Saúde Mental , Quilombolas , Política Pública , Trabalho , Brasil , Fatores SociológicosRESUMO
COVID-19 is a viral disease caused by SARS-CoV-2 that compromises the host immune response in severe cases, promoting a hyperinflammation that results in acute lung injury and multiple organs failure. In this context, patients presenting with immune-related diseases, such as Crohn's disease, affected by COVID-19, may have an uncertain prognosis. We report on a case of a young female patient with a severe Crohn's disease that presented with COVID-19 pneumonia and a favorable outcome even maintaining the use of adalimumab, TNF - alpha inhibitor and prednisone. This case raises the hypothesis that aside from prednisone, TNF-α inhibitors such as adalimumab could be used to stop the progression to COVID-19 complications by blocking the TNF-alpha-driven inflammatory process that occurs in severe COVID-19.