Novel strains of a pandemic plant virus, tomato spotted wilt orthotospovirus, increase vector fitness and modulate virus transmission in a resistant host.

Tomato spotted wilt orthotospovirus (TSWV) is one of the most successful pandemic agricultural pathogens transmitted by several species of thrips in a persistent propagative manner. Current management strategies for TSWV heavily rely on growing single-gene resistant cultivars of tomato ("Sw-5b" gene) and pepper ("Tsw" gene) deployed worldwide. However, the emergence of resistance-breaking strains (RB) in recent years has compounded the threat of TSWV to agricultural production worldwide. Despite this, an extensive study on the thrips transmission biology of RB strains is currently lacking. It is also unclear whether mutualistic TSWV-thrips interactions vary across different novel strains with disparate geographical origins. To address both critical questions, we studied whether and how four novel RB strains of TSWV (two sympatric and two allopatric), along with a non-RB strain, impact western flower thrips (WFT) fitness and whether this leads to differences in TSWV incidence, symptom severity (virulence), and virus accumulation in two differentially resistant tomato cultivars. Our findings show that all RB strains increased WFT fitness by prolonging the adult period and increasing fecundity compared to non-RB and non-viruliferous controls, regardless of the geographical origin of strains or the TSWV titers in individual thrips, which were substantially low in allopatric strains. TSWV accumulation in thrips varied at different developmental stages and was unrelated to the infected tissues from which thrips acquired the virus. However, it was significantly positively correlated to that in WFT-inoculated susceptible plants, but not the resistant ones. The TSW incidences were high in tomato plants infected with all RB strains, ranging from 80% to 90% and 100% in resistant and susceptible plants, respectively. However, TSW incidence in the non-RB-infected susceptible tomato plants was 80%. Our findings provide new insights into how novel strains of TSWV, by selectively offering substantial fitness benefits to vectors, modulate transmission and gain a potential epidemiological advantage over non-RB strains. This study presents the first direct evidence of how vector-imposed selection pressure, besides the one imposed by resistant cultivars, may contribute to the worldwide emergence of RB strains.

Seed Transmission of Wheat Streak Mosaic Virus and Triticum Mosaic Virus in Differentially Resistant Wheat Cultivars.

Wheat streak mosaic virus (WSMV) and Triticum mosaic virus (TriMV) are important viral pathogens of wheat in the Great Plains. These viruses individually or in mixed infections with High Plains wheat mosaic virus cause a devastating wheat streak mosaic (WSM) disease. Although seed transmission of WSMV has been studied, no information is currently available on that of TriMV. Furthermore, no study has explored the implications of mixed infections of WSMV and TriMV on seed transmission of one or both viruses. To study both aspects, seeds from differentially resistant field-grown wheat plants (cv. TAM 304 (susceptible), Joe (WSMV resistant, Wsm2 gene), and Breakthrough (BT) (WSMV and TriMV resistant, Wsm1 gene)) showing characteristic WSM symptoms were collected and analyzed to quantify both viruses using qRT-PCR. The percentage of seeds tested positive for WSMV or TriMV individually and in mixed infection varied with cultivar and virus combinations; 13% of TAM 304 seeds tested positive for WSMV, followed by 8% of BT and 4% of Joe seeds. Similarly, TriMV was detected in 12% of BT seeds, followed by 11% of TAM 304 and 8% of Joe seeds. Lastly, mixed infection was detected in 7% of TAM 304 seeds, followed by 4% in BT, and 2% in Joe. Dissection of field-collected seeds into three parts, embryo, endosperm, and seed coat, revealed both WSMV and TriMV accumulated only in the seed coat. Consistent with seeds, percent infection of WSMV or TriMV in the plants that emerged from infected seeds in each treatment varied with cultivar and virus combinations (WSMV: BT 3%; Joe 2%; TAM 304 9%; TriMV: BT 7%; Joe 8%; and TAM 304 10%). Plants infected with mixed viruses showed more pronounced WSM symptoms compared to individual infections. However, both viruses were present only in a few plants (BT: 2%, Joe: 1%, and TAM 304: 4%). Taken together, this study showed that TriMV was transmitted vertically at a higher frequency than WSMV in resistant cultivars, and the seed transmission of TriMV with WSMV increased the virulence of both pathogens (measured via WSM symptom severity) in the emerged plants. Furthermore, Wsm1 and Wsm2 genes considerably reduced WSMV transmission via infected seeds. However, no such effects were observed on TriMV, especially in progeny plants. These results reiterated the importance of planting clean seeds and highlighted the immediate need to identify/develop new sources of TriMV resistance to effectively manage the recurring WSM epidemic.

First report of Sw-5 resistance-breaking strain of tomato spotted wilt orthotospovirus infecting tomato in Texas.

Tomato spotted wilt orthotospovirus (TSWV) is one of the most devastating plant viruses causing crop disease epidemics of global economic significance. A single dominant resistant gene 'Sw-5' offering a broad-spectrum resistance to multiple orthotospoviruses was introduced in tomato cultivars. However, multiple resistance-breaking strains of TSWV were reported worldwide (Ciuffo 2005; Zaccardelli et al. 2008; Batuman et al. 2017; di Rienzo et al. 2018). Symptoms suggestive of orthotospoviral infection including stunting, bronzing, and inward rolling of leaves, and concentric necrotic spots on leaves, petioles, and fruits were observed in two TSWV-resistant tomato cultivars ('BL163' and 'HT 2') planted in a tomato variety trial in Bushland, TX in 2022. Leaf tissues from 45 resistant tomato plants (symptomatic or asymptomatic) from both resistant cultivars were tested using a TaqMan probe-based qPCR assay targeting a 200bp region in nucleoprotein (N) of the TSWV (Gautam et al. 2022). While 25 of those samples tested positive for TSWV, only ten expressed characteristic disease symptoms described above. The possibility of mixed infection in those samples with other endemic viruses in the region viz., alfalfa mosaic virus, groundnut ringspot orthotospovirus, tobacco mosaic virus, tomato chlorotic spot orthotospovirus, tomato mosaic virus, tomato necrotic streak virus, tomato ringspot virus, and tomato torrado virus was discounted through RT-PCR analysis (Kumar et al. 2011; Verbeek et al. 2012; Bratsch et al. 2018). To test the RB phenotype of the observed putative TSWV-RB strains, three-week-old tomato plants from eight commercially available TSWV resistant cultivars and one non-resistant cultivar (n=10 each) were mechanically inoculated with leaf tissues collected from a single symptomatic plant from one of the field-grown resistant cultivars. The experiment was replicated twice. Hypersensitive response was observed on all inoculated leaves of resistant plants one week post inoculation. Furthermore, all eight resistant cultivars started expressing local and systemic TSW symptoms 12 to 16 days post inoculation (dpi), while non-resistant cultivar started expressing symptoms at 9 dpi. TSW incidence across all resistant cultivars was 30-70%, while in susceptible cultivar it was 90%. Symptoms exhibited by all resistant cultivars resembled those of symptoms observed in field collected plants. The expression of Sw-5 gene in all eight resistant cultivars and the lack thereof in a susceptible cultivar was confirmed using Sw-5b specific primers and using Actin as a housekeeping gene in qRT-PCR (Islam et al. 2022). The RB strains in Sw-5 resistant tomato in California (Batuman et al. 2017) had the C118Y mutation in the TSWV NSm protein, consistent with the original reporting of C118Y or T120N RB mutations in 11 TSWV isolates from Spain (NCBI accession # HM015517 & HM015518) (Lopez et al. 2011). The nucleotide and amino acid sequence analysis of NSm gene from Bushland RB isolates from four resistant cultivars (NCBI accessions # OP810513-14 [field], OQ247901-05 [mechanically inoculated]) shared 98.9 and 99.4% homology with the Californian NSm sequences of TSWV RB tomato isolate (KX898453 and ASO67371), respectively. While the Nsm C118Y or T120N RB mutations were absent in all Bushland TSWV RB isolates, they had six additional unique point mutations across the NSm (I163V, P227Q, V290I, N293S, V294I, K296Q), which could potentially be responsible for resistance breaking. Despite the lack of C118Y or T120N RB mutations, Bushland isolates were capable of disrupting Sw-5-mediated TSWV resistance in all eight commercial resistant tomato cultivars. This study suggests a new or a different class of fundamental mechanisms are likely to be responsible for resistance breaking in Sw-5b resistant tomatoes. The new RB strain/s of TSWV therefore pose a substantial threat to tomato production in TX and other tomato-growing regions of the US.

First report of a resistance-breaking strain of tomato spotted wilt orthotospovirus infecting Capsicum annuum with the Tsw resistance gene in Texas.

Since the first report of the 'spotted wilt' disease of tomato published in 1915 in Australia, tomato spotted wilt orthotospovirus (TSWV) has become a pandemic virus with an estimated economic impact of over $1 billion annually (Brittlebank 1919; German et al. 1992). TSWV strains capable of disrupting Tsw-mediated single gene resistance in pepper (i.e., resistance-breaking or RB strains) have been previously reported in multiple countries (Crescenzi et al., 2013; Deligoz et al. 2014; Margaria et al. 2004; Sharman and Persley 2006; Yoon et al. 2021), but only in California (Macedo et al. 2019) and Louisiana (Black et al. 1996) in the US. In August 2021, severe tospovirus-like disease symptoms (stunting; leaf, stem, and petiole necrosis; and concentric rings on leaves and fruits) were documented in TSWV-resistant cultivars of sweet pepper (Capsicum annuum L.) containing the Tsw gene in Bushland, TX. In the next season in August 2022, leaf samples from 214 TSWV-resistant pepper plants (with or without disease symptoms) from seven cultivars were tested with a TaqMan probe-based qPCR assay targeting coat protein (CP) of the TSWV (TSWV-F: AGAGCATAATGAAGGTTATTAAGCAAAGTGA and TSWV-R: GCCTGACCCTGATCAAGCTATC; TaqMan probe: CAGTGGCTCCAATCCT). Across all cultivars, 85 samples tested positive for TSWV. Of these, 39 showed characteristic TSW symptoms with disease incidence ranging from 10-30% depending on the cultivar. The remaining 46 samples were asymptomatic with no apparent hypersensitive response in leaves. To further confirm the RB status of TSWV strain/s in the field samples, leaves from six TSWV resistant plants from three different pepper cultivars were pooled together and used to mechanically inoculate five non-infected three-week-old pepper plants from nine cultivars: seven TSWV resistant (Tsw), one moderately resistant, and one susceptible, with three replications. Tsw expression in two representative plants from each resistant cultivar was confirmed using SYBR Green based one-step qRT-PCR with primers specified in the South Korea Patent # KR102000469B1 were used with two plants from susceptible cultivar as a negative control. Field plants that tested negative for TSWV in PCR analysis were used as a mock inoculation control and tissues from tomato plants infected with wild-type TSWV strain/s (previously isolated from non-resistant tomato plants) were used as a wild-type control. Three weeks post-inoculation, characteristic orthotospovirus symptoms were observed in plants inoculated with the putative RB isolate, in that TSW incidence ranged between 10-50% in seven resistant cultivars, 70% in a moderately resistant cultivar, and 90% in a susceptible cultivar. On the contrary, no disease incidence was observed in resistant and moderately resistant plants, whereas 50% incidence was observed in susceptible plants in the wild-type control. Hypersensitive response was observed in the local leaves of mechanically inoculated resistant plants that tested negative in PCR approximately 5-7 days post inoculation. All symptomatic and 30-100% asymptomatic TSWV-inoculated plants with RB or wild-type strain/s tested positive for TSWV in probe-based qPCR analysis confirming that none of the tested cultivars was immune to TSWV infection. All mock-inoculated plants tested negative in the qPCR analysis. Both nucleotide and amino acid sequences of complete TSWV silencing suppressor protein (NSs) recovered from six plants originally used in the mechanical inoculation (NCBI accession OP548104) and inoculated resistant plants (NCBI accession OP548113) showed 99% homology with the NSs sequences of New Mexico pepper isolates KU179589 and APG79491, respectively. The NSs point mutation T to A at 104 amino acid position responsible for resistance breaking in pepper in Hungarian TSWV isolates (NCBI accessions KJ649609 & KJ649608 (Almasi et al., 2017) was absent in the NSs sequences from all samples. Besides novel point mutations, genetic reassortment as previously reported in S. Korean TSWV RB pepper isolates (Kwon et al., 2021) and in other orthotospoviruses such as tomato chlorotic spot virus and groundnut ringspot virus (Webster et al., 2011) could be a potential RB mechanism in the Bushland TSWV RB isolates. A comprehensive genomic analysis of these isolates is required to determine the fundamental evolutionary mechanisms that enable the disruption of Tsw-mediated gene resistance. Taken together, these results indicate that at least one, but potentially multiple new strains of TSWV capable of disrupting Tsw-mediated resistance and producing moderate to severe symptoms in an array of commercial resistant pepper cultivars have emerged and pose a significant threat to pepper production in Texas.

Transcriptional Responses of Resistant and Susceptible Wheat Exposed to Wheat Curl Mite.

(1) Background: The wheat curl mite (Aceria tosichella Keifer) is a key pest of wheat (Triticum aestivum L.) worldwide. While a number of wheat cultivars resistant to the mites have been employed to minimize the impact on the yield and quality of grain, little is known regarding the mechanisms underlying host plant resistance. Therefore, the goal of this study was to explore changes in transcriptome of resistant and susceptible wheat in order to quantify the molecular changes that drive host plant resistance. (2) Methods: Two varieties, wheat curl mite-susceptible (Karl 92) and wheat curl mite-resistant (TAM112) wheat, both at 2-week postemergence, were used in this study. Half of the plants were exposed to wheat curl mite herbivory and half remained mite-free and served as controls. Transcriptome changes were quantified using RNA-seq and compared among treatments to identify genes and pathways affected by herbivores. (3) Results: We identified a number of genes and pathways involved in plant defenses against pathogens, herbivores, and abiotic stress that were differentially expressed in the resistant wheat exposed to wheat curl mite herbivory but were unaffected in the susceptible wheat. (4) Conclusions: Our outcomes indicated that resistant wheat counteracts wheat curl mite exposure through effective induction of genes and pathways that enhance its defense responses.

RNA-seq analysis reveals different drought tolerance mechanisms in two broadly adapted wheat cultivars 'TAM 111' and 'TAM 112'.

Wheat cultivars 'TAM 111' and 'TAM 112' have been dominantly grown in the Southern U.S. Great Plains for many years due to their high yield and drought tolerance. To identify the molecular basis and genetic control of drought tolerance in these two landmark cultivars, RNA-seq analysis was conducted to compare gene expression difference in flag leaves under fully irrigated (wet) and water deficient (dry) conditions. A total of 2254 genes showed significantly altered expression patterns under dry and wet conditions in the two cultivars. TAM 111 had 593 and 1532 dry-wet differentially expressed genes (DEGs), and TAM 112 had 777 and 1670 at heading and grain-filling stages, respectively. The two cultivars have 1214 (53.9%) dry-wet DEGs in common, which agreed with their excellent adaption to drought, but 438 and 602 dry-wet DEGs were respectively shown only in TAM 111 and TAM 112 suggested that each has a specific mechanism to cope with drought. Annotations of all 2254 genes showed 1855 have functions related to biosynthesis, stress responses, defense responses, transcription factors and cellular components related to ion or protein transportation and signal transduction. Comparing hierarchical structure of biological processes, molecule functions and cellular components revealed the significant regulation differences between TAM 111 and TAM 112, particularly for genes of phosphorylation and adenyl ribonucleotide binding, and proteins located in nucleus and plasma membrane. TAM 112 showed more active than TAM 111 in response to drought and carried more specific genes with most of them were up-regulated in responses to stresses of water deprivation, heat and oxidative, ABA-induced signal pathway and transcription regulation. In addition, 258 genes encoding predicted uncharacterized proteins and 141 unannotated genes with no similar sequences identified in the databases may represent novel genes related to drought response in TAM 111 or TAM 112. This research thus revealed different drought-tolerance mechanisms in TAM 111 and TAM 112 and identified useful drought tolerance genes for wheat adaption. Data of gene sequence and expression regulation from this study also provided useful information of annotating novel genes associated with drought tolerance in the wheat genome.

Non-Invasive Characterization of Single-, Double- and Triple-Viral Diseases of Wheat With a Hand-Held Raman Spectrometer.

Plant diseases can reduce crop yield by up to 100%. Therefore, timely and confirmatory diagnosis of plant diseases is strongly desired. Typical pathogen assaying methods include polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay (ELISA). These approaches are quite useful but are also time-consuming and destructive to the sample. Raman spectroscopy (RS) is a modern analytical technique that enables non-invasive plant disease detection. In this study, we report on Raman-based detection of wheat diseases caused by wheat streak mosaic virus (WSMV) and barley yellow dwarf virus (BYDV). Our results show that RS can be used to differentiate between healthy wheat and wheat infected by these two viruses. We also show that RS can be used to identify whether wheat is infected by these individual viruses or by a combination of WSMV and BYDV, as well as WSMV, BYDV, and Triticum mosaic virus (TriMV). We found that wheat spectra showed non-linear spectroscopic responses to coinfection by different viruses. These results suggest that RS can be used to probe pathogen-specific changes in plant metabolism. The portable nature of this approach opens the possibility of RS directly in the field for confirmatory diagnostics of viral diseases.

Interactions Between Solanaceous Crops and 'Candidatus Liberibacter solanacearum' Haplotypes in Relation to Infection and Psyllid Survival on the Hosts.

'Candidatus Liberibacter solanacearum' (Lso), transmitted by the potato psyllid (Bactericera cockerelli), is the putative causal agent of potato zebra chip disease. The bacterial pathogen infects a wide range of solanaceous plants (both wild and cultivated species), among which are peppers, potatoes, and tomatoes. Currently there are two commonly detected, genetically distinct haplotypes of Lso (A and B) identified from potatoes in the United States. To determine whether there are interactions between Lso haplotypes and different solanaceous hosts, experiments were conducted in the greenhouse in which pepper, potato, and tomato plants were infested with psyllids carrying Lso A, B, or an A and B mix (AB) or with psyllids free of Lso. Host plants were grown in pots in cages on the greenhouse benches and infested with six psyllids per plant. In addition, eight pepper cultivars were similarly infested for deeper understanding of host-haplotype interactions. Approximately 7 weeks after infestation, adult psyllids in each cage were counted to determine the impact of Lso haplotype-host interactions on psyllid survival and plants were sampled and tested molecularly for Lso. Individual psyllids carrying haplotypes B or AB and those free of Lso copiously reproduced on all three hosts, and leaf tissue from each plant tested positive for the respective Lso except those infested with Lso-negative psyllids. However, psyllids carrying Lso A did not survive on peppers but survived and abundantly reproduced on potatoes and tomatoes. In addition, samples from peppers infested with psyllids carrying Lso A tested negative for Lso. However, peppers infested with individual psyllids carrying Lso AB tested positive for Lso A, indicating that the presence of B may be required for infection by Lso A and psyllid survival on peppers. The different pepper cultivars infested with psyllids carrying Lso A showed similar results to the haplotype-host interaction tests, suggesting that cultivar may not be a factor in Lso A-pepper host interactions. Results from these studies suggest that Lso A may affect host selection by psyllids either for nutrition or laying of eggs. Mechanisms involved in preventing psyllid reproduction on peppers, once identified, will have significant implications for potential psyllid management.

Postharvest Development of 'Candidatus Liberibacter solanacearum' in Late-Season Infected Potato Tubers under Commercial Storage Conditions.

Zebra chip (ZC) disease of potato is associated with the putative pathogen 'Candidatus Liberibacter solanacearum', which is transmitted by the potato psyllid Bactericera cockerelli (Hem., Triozidae). The present study was initiated to investigate 'Ca. L. solanacearum' development during and following typical commercial storage practices. Using bacteriliferous psyllids, Russet Norkotah potato tubers were infested in field cages 14, 10, and 4 days before harvest. Changes in 'Ca. L. solanacearum' detection rate, 'Ca. L. solanacearum' titer, and concentrations of phenolic compounds were documented throughout storage. 'Ca. L. solanacearum' titer continued to increase during storage. Although significant increases in the frequency of 'Ca. L. solanacearum' detection were observed in all infestation treatments, the impact of 'Ca. L. solanacearum' infection on tuber quality remained comparatively low in plants infected 4 days before harvest, because the majority of the tubers remained asymptomatic. Minimizing storage and retail chain movement durations would help to limit 'Ca. L. solanacearum' impact on tuber quality in tubers infected 14 and 10 days before harvest. This study also demonstrated that 'Ca. L. solanacearum' can relocate from a newly infected leaf to a tuber in as little as 4 days. Psyllid management is recommended until at least 4 days before green harvest, when psyllid pressure is high in fields in which tubers are destined for commercial storage.

Variations in Zebra Chip Disease Expression and Tuber Biochemistry in Response to Vector Density.

Zebra chip (ZC) disease, caused by 'Candidatus Liberibacter solanacearum', which is transmitted by the potato psyllid, has negatively affected potato production in the United States for over a decade. The present study was conducted to evaluate the affect of the number of bacteriliferous psyllids on 'Ca. L. solanacearum' titer, levels of amino acids, carbohydrates, phenolics, and, subsequently, symptom severity in potato tubers. 'Red La Soda' and 'Russet Norkotah' potato were planted in the field and later inoculated with 'Ca. L. solanacearum' using 5, 10, and 30 bacteriliferous potato psyllids. In both cultivars, the increase in the number of psyllids resulted in elevated 'Ca. L. solanacearum' titer and symptom severity. In the cases of amino acids and reducing sugars, responses to vector density appeared to be cultivar specific. Overall, phenolic compounds showed a consistent increase following infection, a response that, in most cases, was positively correlated with the number of infective psyllids. Results quantified the impact of the number of infective psyllids on 'Ca. L. solanacearum' titer and biochemical content of infected tubers previously shown to be correlated with the degree of symptom expression. Managing vector numbers is currently the only effective approach for minimizing losses to ZC in grower's fields. However, our findings on physiological responses to vector density suggest that, in combination with chemical control, development of more tolerant or resistant potato genotypes, with emphasis on interrupting pathways that are associated with increased phenolic activity levels, may lead to more sustainable management of ZC in the future.

Physiological Responses of Hard Red Winter Wheat to Infection by Wheat streak mosaic virus.

Wheat streak mosaic virus (WSMV) causes significant yield loss in hard red winter wheat in the U.S. Southern High Plains. Despite the prevalence of this pathogen, little is known about the physiological response of wheat to WSMV infection. A 2-year study was initiated to (i) investigate the effect of WSMV, inoculated at different development stages, on shoot and root growth, water use, water use efficiency (WUE), and photosynthesis and (ii) understand the relationships between yield and photosynthetic parameters during WSMV infection. Two greenhouse experiments were conducted with two wheat cultivars mechanically inoculated with WSMV at different developmental stages, from three-leaf to booting. WSMV inoculated early, at three- to five-leaf stage, resulted in a significant reduction in shoot biomass, root dry weight, and yield compared with wheat infected at the jointing and booting stages. However, even when inoculated as late as jointing, WSMV still reduced grain yield by at least 53%. Reduced tillers, shoot biomass, root dry weight, water use, and WUE contributed to yield loss under WSMV infection. However, infection by WSMV did not affect rooting depth and the number of seminal roots but reduced the number of nodal roots. Leaf photosynthetic parameters (chlorophyll [SPAD], net photosynthetic rate [Pn], stomatal conductance [Gs], intercellular CO2 concentration [Ci], and transpiration rate [Tr]) were reduced when infected by WSMV, and early infection reduced parameters more than late infection. Photosynthetic parameters had a linear relationship with grain yield and shoot biomass. The reduced Pn under WSMV infection was mainly in response to decreased Gs, Ci, and SPAD. The results of this study indicated that leaf chlorophyll and gas exchange parameters can be used to quantify WSMV effects on biomass and grain yield in wheat.

Emergence of 'Candidatus Liberibacter solanacearum'-Infected Seed Potato in Relation to the Time of Infection.

Zebra chip (ZC) is a disease of potato, putatively caused by the vectorborne bacterium 'Candidatus Liberibacter solanacearum'. Although ZC has been a major concern due its significant negative impact on both potato yield and quality, its effect on seed potato sprouting has been the subject of recent evaluations. The present study was conducted to determine whether variation in emergence is affected by the infection duration of 'Ca. L. solanacearum'-infected seed potato prior to harvest. Furthermore, changes in pathogen detectability and titer levels in late-season-infected plants also were evaluated during and after cold storage. The rate of ZC-affected seed potato emergence following cold storage was not affected by the time of infection in the field, and the majority of ZC-infected tubers failed to sprout. Time to "seedling" emergence also was significantly longer in seed potato from plants infected ≥2 weeks before harvest. The small percentage of plants that emerged from ZC-affected seed potato produced stunted, nonvigorous plants that often died after a few weeks. The rate of successful 'Ca. L. solanacearum' detection increased during cold storage, suggesting a continued 'Ca. L. solanacearum'-tuber interaction postharvest. After tubers were removed from cold storage and held at room temperature, 'Ca. L. solanacearum' titer started to increase. Although none of the tubers from plants infected 1 week before harvest exhibited any disease symptoms or tested positive for 'Ca. L. solanacearum' at harvest, up to 38% of these tubers tested positive following placement at room temperature after cold storage. Results of this study suggest that the role of seedborne ZC in disease epidemiology is likely to be insignificant. Furthermore, the findings of this study emphasized the importance of continued control measures until at least a week before harvest, and highlighted the need for improved methods of 'Ca. L. solanacearum' detection at harvest, especially in tubers infected late in the season.

Development of a wireless computer vision instrument to detect biotic stress in wheat.

Knowledge of crop abiotic and biotic stress is important for optimal irrigation management. While spectral reflectance and infrared thermometry provide a means to quantify crop stress remotely, these measurements can be cumbersome. Computer vision offers an inexpensive way to remotely detect crop stress independent of vegetation cover. This paper presents a technique using computer vision to detect disease stress in wheat. Digital images of differentially stressed wheat were segmented into soil and vegetation pixels using expectation maximization (EM). In the first season, the algorithm to segment vegetation from soil and distinguish between healthy and stressed wheat was developed and tested using digital images taken in the field and later processed on a desktop computer. In the second season, a wireless camera with near real-time computer vision capabilities was tested in conjunction with the conventional camera and desktop computer. For wheat irrigated at different levels and inoculated with wheat streak mosaic virus (WSMV), vegetation hue determined by the EM algorithm showed significant effects from irrigation level and infection. Unstressed wheat had a higher hue (118.32) than stressed wheat (111.34). In the second season, the hue and cover measured by the wireless computer vision sensor showed significant effects from infection (p = 0.0014), as did the conventional camera (p < 0.0001). Vegetation hue obtained through a wireless computer vision system in this study is a viable option for determining biotic crop stress in irrigation scheduling. Such a low-cost system could be suitable for use in the field in automated irrigation scheduling applications.

Repertoire of novel sequence signatures for the detection of Candidatus Liberibacter asiaticus by quantitative real-time PCR.

BACKGROUND: Huanglongbing (HLB) or citrus greening is a devastating disease of citrus. The gram-negative bacterium Candidatus Liberibacter asiaticus (Las) belonging to the α-proteobacteria is responsible for HLB in North America as well as in Asia. Currently, there is no cure for this disease. Early detection and quarantine of Las-infected trees are important management strategies used to prevent HLB from invading HLB-free citrus producing regions. Quantitative real-time PCR (qRT-PCR) based molecular diagnostic assays have been routinely used in the detection and diagnosis of Las. The oligonucleotide primer pairs based on conserved genes or regions, which include 16S rDNA and the ß-operon, have been widely employed in the detection of Las by qRT-PCR. The availability of whole genome sequence of Las now allows the design of primers beyond the conserved regions for the detection of Las explicitly. RESULTS: We took a complimentary approach by systematically screening the genes in a genome-wide fashion, to identify the unique signatures that are only present in Las by an exhaustive sequence based similarity search against the nucleotide sequence database. Our search resulted in 34 probable unique signatures. Furthermore, by designing the primer pair specific to the identified signatures, we showed that most of our primer sets are able to detect Las from the infected plant and psyllid materials collected from the USA and China by qRT-PCR. Overall, 18 primer pairs of the 34 are found to be highly specific to Las with no cross reactivity to the closely related species Ca. L. americanus (Lam) and Ca. L. africanus (Laf). CONCLUSIONS: We have designed qRT-PCR primers based on Las specific genes. Among them, 18 are suitable for the detection of Las from Las-infected plant and psyllid samples. The repertoire of primers that we have developed and characterized in this study enhanced the qRT-PCR based molecular diagnosis of HLB.

Winter Wheat Cultivars with Temperature-Sensitive Resistance to Wheat streak mosaic virus Do Not Recover from Early-Season Infections.

Wheat streak mosaic virus (WSMV), Triticum mosaic virus, and Wheat mosaic virus, all vectored by the wheat curl mite Aceria tosichella Keifer, frequently cause devastating losses to winter wheat production throughout the central and western Great Plains. Resistant 'Mace' and 'RonL are commercially available and contain the wsm1 and wsm2 genes, respectively, for resistance to WSMV. However, the resistance in these cultivars is temperature sensitive, ineffective above 27°C, and does not protect against the other common wheat viruses. The majority of winter wheat in the Southern Great Plains is planted in early fall as a dual-purpose crop for both grazing and grain production. Early planting exposes wheat plants to warmer temperatures above the threshold for effective resistance. Studies were conducted to determine whether the resistance found in these cultivars would give infected plants the ability to recover as temperatures cooled to a range conducive to effective genetic resistance. RonL, Mace, 'TAM 111', 'TAM 112', and 'Karl 92' wheat were infested with WSMV viruliferous mites at temperatures above the resistance threshold. After the initial 4-week infection period, plants were subjected to progressively cooler temperatures during the winter months, well below the resistance threshold. Throughout the study, plant samples were taken to quantify virus titer and mite populations. Resistant RonL and Mace, which became severely infected during the initial infection period, were not able to recover even when temperatures dropped below the resistance threshold. However, TAM 112 showed resistance to WSMV but, more importantly, it also showed resistance to the wheat curl mite, because the mite population in this cultivar was significantly lower than on all other cultivars. The results of this study are significant in that they represent the first evidence of quantitative resistance to both WSMV and the wheat curl mite in a single wheat cultivar. Resistance to the wheat curl mite has potential to reduce losses to all mite-vectored virus diseases of wheat and not just WSMV.

Triticum mosaic virus Isolates in the Southern Great Plains.

In 2006, a previously unknown wheat (Triticum aestivum) virus was discovered in Western Kansas and given the name Triticum mosaic virus (TriMV). TriMV has since been found in wheat samples isolated all across the Great Plains. Even though it can infect singularly, TriMV is mostly found with Wheat streak mosaic virus (WSMV) as a co-infection. The potential for TriMV to cause economic loss is significant, but very little is known about the virus. The objective of this study was to survey the TriMV population for genetic variation by nucleotide sequencing of isolates across a geographical region. A secondary objective was to characterize the WSMV isolates that are being co-transmitted with TriMV. Fourteen different TriMV isolations were taken from locations in Texas, Oklahoma, and Kansas, and the coat protein cDNA was sequenced. Thirteen nucleotide differences were found in the TriMV isolates, of which three induce amino acid changes. WSMV isolates had 65 nucleotide changes when compared to WSMV Sydney81. Our results indicate the TriMV virus population has minimal amounts of sequence variation and no singular WSMV genotype is specifically associated with TriMV co-infection. Based on the isolates analyzed, it appears that the field population of TriMV is very homogeneous.

Host effect on the genetic diversification of beet necrotic yellow vein virus single-plant populations.

Theoretical models predict that, under restrictive host conditions, virus populations will exhibit greater genetic variability. This virus response has been experimentally demonstrated in a few cases but its relation with a virus's capability to overcome plant resistance is unknown. To explore the genetic host effects on Beet necrotic yellow vein virus (BNYVV) populations that might be related to resistance durability, a wild-type virus isolate was vector inoculated into partially resistant Rz1, Rz2, and susceptible sugar beet cultivars during a serial planting experiment. Cloning and sequencing a region of the viral RNA-3, involving the pathogenic determinant p25, revealed that virus diversity significantly increased in direct proportion to the strength of host resistance. Thus, whereas virus titers were highest, intermediate, and lowest in susceptible, Rz1, and Rz2 plants, respectively; the average number of nucleotide differences among single-plant populations was 0.8 (±0.1) in susceptible, 1.4 (±0.1) in Rz1, and 2.4 (±0.2) in Rz2 genotypes. A similar relationship between host restriction to BNYVV root accumulation and virus genetic variability was detected in fields of sugar beet where these specific Rz1- and Rz2-mediated resistances have been defeated.

Breakdown of host resistance by independent evolutionary lineages of Beet necrotic yellow vein virus involves a parallel c/u mutation in its p25 gene.

ABSTRACT Breakdown of sugar beet Rz1-mediated resistance against Beet necrotic yellow vein virus (BNYVV) infection was previously found, by reverse genetics, to be caused by a single mutation in its p25 gene. The possibility of alternative breaking mutations, however, has not been discarded. To explore the natural diversity of BNYVV in the field and its effects on overcoming Rz1, wild-type (WT) and resistance-breaking (RB) p25 genes from diverse production regions of North America were characterized. The relative titer of WT p25 was inversely correlated with disease expression in Rz1 plants from Minnesota and California. In Minnesota, the predominant WT p25 encoded the A(67)C(68) amino acid signature whereas, in California, it encoded A(67)L(68). In both locations, these WT signatures were associated with asymptomatic BNYVV infections of Rz1 cultivars. Further analyses of symptomatic resistant plants revealed that, in Minnesota, WT A(67)C(68) was replaced by V(67)C(68) whereas, in California, WT A(67)L(68) was replaced by V(67)L(68). Therefore, V(67) was apparently critical in overcoming Rz1 in both pathosystems. The greater genetic distances between isolates from different geographic regions rather than between WT and RB from the same location indicate that the underlying C to U transition originated independently in both BNYVV lineages.

Changes in the intraisolate genetic structure of Beet necrotic yellow vein virus populations associated with plant resistance breakdown.

The causal agent of rhizomania disease, Beet necrotic yellow vein virus (BNYVV), typically produces asymptomatic root-limited infections in sugar beets (Beta vulgaris) carrying the Rz1-allele. Unfortunately, this dominant resistance has been recently overcome. Multiple cDNA clones of the viral pathogenic determinant p25, derived from populations infecting susceptible or resistant plants, were sequenced to identify host effects on the viral population structure. Populations isolated from compatible plant-virus interactions (susceptible plant-wild type virus and resistant plant-resistant breaking variants) were large and relatively homogeneous, whereas those from the incompatible interaction (resistant plant-avirulent type virus) were small and highly heterogeneous. All populations from susceptible plants had the same dominant haplotype, whereas those from resistant cultivars had a different haplotype surrounded by a spectrum of mutants. Selection and diversification analyses suggest an evolutionary trajectory of BNYVV with positive selection for changes required to overcome resistance, followed by elimination of hitchhiking mutations through purifying selection.

Beet necrotic yellow vein virus accumulates inside resting spores and zoosporangia of its vector Polymyxa betae BNYVV infects P. betae.

BACKGROUND: Plasmodiophorids and chytrids are zoosporic parasites of algae and land plant and are distributed worldwide. There are 35 species belonging to the order Plasmodiophorales and three species, Polymyxa betae, P. graminis, and Spongospora subterranea, are plant viral vectors. Plasmodiophorid transmitted viruses are positive strand RNA viruses belonging to five genera. Beet necrotic yellow vein virus (BNYVV) and its vector, P. betae, are the causal agents for rhizomania. RESULTS: Evidence of BNYVV replication and movement proteins associating with P. betae resting spores was initially obtained using immunofluorescence labeling and well characterized antisera to each of the BNYVV proteins. Root cross sections were further examined using immunogold labeling and electron microscopy. BNYVV proteins translated from each of the four genomic and subgenomic RNAs accumulate inside P. betae resting spores and zoospores. Statistical analysis was used to determine if immunolabelling detected viral proteins in specific subcellular domains and at a level greater than in control samples. CONCLUSION: Virus-like particles were detected in zoosporangia. Association of BNYVV replication and movement proteins with sporangial and sporogenic stages of P. betae suggest that BNYVV resides inside its vector during more than one life cycle stage. These data suggest that P. betae might be a host as well as a vector for BNYVV.