Massive Muscular Infection by a Sarcocystis Species in a South American Rattlesnake (Crotalus durissus terrificus).

Massive numbers of sarcocysts of a previously undescribed species of Sarcocystis were observed in the skeletal muscles throughout the body of an adult, female South American rattlesnake (Crotalus durissus terrificus). Examination of tissue sections by light microscopy demonstrated that sarcocysts were present in 20 to 40% of muscle fibers from 5 sampled locations. Sarcocysts were not present in cardiac muscle, smooth muscle, or other organs. Sarcocysts were 0.05-0.15 mm wide, had variable length depending on the viewed orientation and size of the muscle fiber, and had a sarcocyst wall less than 1-µm thick. Sarcocysts were subdivided by septa and had central degeneration in older sarcocysts. Host induced secondary encapsulation or an inflammatory response was not present. By transmission electron microscopy (TEM), the sarcocyst wall was Type I, with a parasitophorous membrane of approximately 100 nanometers in width arranged in an undulating pattern and intermittently folded inward in a branching pattern. The sarcocysts contained metrocytes in different stages of development and mature bradyzoites. The nucleic acid sequence from a section of the 18S small subunit rRNA gene was most closely related to S. mucosa that uses marsupials as intermediate hosts and has an unknown definitive host. This is apparently the third report of muscular Sarcocystis infection in snakes and is the first to describe the ultrastructure of the sarcocysts and use sequencing methods to aid in identification.

An intervention to decrease patient identification band errors in a children's hospital.

CONTEXT: Patient misidentification continues to be a quality and safety issue. There is a paucity of US data describing interventions to reduce identification band error rates. SETTING: Monroe Carell Jr Children's Hospital at Vanderbilt. KEY MEASURES: Percentage of patients with defective identification bands. STRATEGIES FOR CHANGE: Web-based surveys were sent, asking hospital personnel to anonymously identify perceived barriers to reaching zero defects with identification bands. Corrective action plans were created and implemented with ideas from leadership, front-line staff and the online survey. Data from unannounced audits of patient identification bands were plotted on statistical process control charts and shared monthly with staff. All hospital personnel were expected to "stop the line" if there were any patient identification questions. EFFECTS OF CHANGE: The first audit showed a defect rate of 20.4%. The original mean defect rate was 6.5%. After interventions and education, the new mean defect rate was 2.6%. LESSONS LEARNT: (a) The initial rate of patient identification band errors in the hospital was higher than expected. (b) The action resulting in most significant improvement was staff awareness of the problem, with clear expectations to immediately stop the line if a patient identification error was present. (c) Staff surveys are an excellent source of suggestions for combating patient identification issues. (d) Continued audit and data collection is necessary for sustainable staff focus and continued improvement. (e) Statistical process control charts are both an effective method to track results and an easily understood tool for sharing data with staff.

Burkholderia glumae and B. gladioli Cause Bacterial Panicle Blight in Rice in the Southern United States.

Bacterial panicle blight (BPB) is among the three most limiting rice diseases in Louisiana and the southern United States. The identity and characterization of pathogens associated with this disease was unclear. This research details studies carried out on the pathogens causing BPB on rice in Louisiana and other rice producing southern states. Bacterial strains were isolated from BPB-infected sheath, panicle, or grain samples collected from rice fields in Louisiana, Arkansas, Texas, and Mississippi. In greenhouse inoculation tests, 292 of 364 strains were pathogenic on rice seedlings or panicles. Identification of strains in the pathogen complex by growth on S-PG medium, carbon source utilization profile (Biolog), cellular fatty acid analysis, and polymerase chain reaction (PCR) methods revealed that 76 and 5% of the strains were Burkholderia glumae and B. gladioli, respectively. The other strains have not been conclusively identified. Although strains of both species produced similar symptoms on rice, B. glumae strains were generally more aggressive and caused more severe symptoms on rice than B. gladioli. Virulent strains of both species produced toxoflavin in culture. The two species had similar growth responses to temperature, and optima ranged from 38 to 40°C for B. glumae and 35 to 37°C for B. gladioli. PCR was the most sensitive and accurate method tested for identifying the bacterial pathogens to the species level. The 16S rDNA gene and 16S-23S rDNA internal transcribed spacer (ITS) region sequences of the B. glumae and B. gladioli strains from rice showed more than 99% sequence homology with published sequences. A real-time PCR system was developed to detect and quantify this pathogen from infected seed lots. Our results clearly indicate that B. glumae and B. gladioli were the major pathogens causing BPB in the southern United States.

Association of Burkholderia glumae and B. gladioli with Panicle Blight Symptoms on Rice in Panama.

Panicle blight of rice, caused by Burkholderia glumae, has been a serious problem on rice in Japan since 1955. It has been reported from other rice-producing countries around the world and recently was reported on rice in the southern United States (2). A rice producer in Panama contacted us to verify the occurrence of bacterial panicle blight in rice fields where heavy losses were associated with a disease of unknown etiology, but with typical bacterial panicle blight symptoms (2). The observed grain discoloration, sterility, and abortion were thought to be due to the spinki mite, Steneotarsonemus spinki Smiley. After obtaining a USDA-APHIS import permit (73325), rice panicle samples from seven fields in Panama were sent to our laboratory in 2006. Bacteria were isolated from grains showing typical panicle blight symptoms on the semiselective S-Pg medium. Nonfluorescing colonies producing toxoflavin on King's B medium were selected for further identification. Initial PCR analyses, made with DNA isolated directly from grain crushed in sterile water, with B. glumae specific primers (BGF 5'ACACGG AACACCTGGGTA3' and BGR 5'TCGCTCTCCCGAAGAGAT3') gave a positive reaction for B. glumae in all seven samples. Biolog tests (Biolog Inc, Hayward, CA), fatty acid analysis, and PCR using species-specific primers for B. glumae and B. gladioli (BLF 5'CGAGCT AATACCGCGAAA3' and BLR 5'AGACTCGA GTCAACTGA3') identified 19 B. glumae and 6 B. gladioli strains among 35 bacterial strains isolated. Only the Biolog and fatty acid analyses identified B. gladioli strains. PCR analysis did not identify B. gladioli strains. To confirm B. gladioli, PCR amplification of the 16S rDNA gene from eight representative strains (four each for B. glumae and B. gladioli) using universal primers (16SF 5'AGAGTTTGATCCTGGCTCAG3' and 16SR5'GGCTACCTTGTTACGACTT3') and further sequencing of the PCR product was performed. A BLAST analysis of 16S rDNA sequences in the Genbank data base showed 99% sequence similarity for these two species with other published sequences. Our APHIS import permit did not allow us to perform pathogenicity tests with the strains isolated from Panama, but the B. glumae and B. gladioli strains obtained corresponded closely with pathogenic control cultures isolated from rice grown in the United States or with strains obtained from the ATCC. Other B. glumae strains recently isolated from rice in Panama, and identified by PCR, were tested for pathogenicity in tests conducted at CIAT in Colombia and were found to be pathogenic and highly virulent. These strains caused disease on seedlings when inoculated and typical bacterial panicle blight symptoms on panicles when spray inoculated. This disease has caused severe losses in Panama's rice crop for at least 3 years. Similar symptoms reported in Cuba, Haiti, and the Dominican Republic were attributed to damage from the spinki mite in association with Sarocladium oryzae (Sawada) W. Gams & D. Hawksw. (1). Zeigler and Alvarez (3) reported the occurrence of B. glumae in Columbia in 1987, but not in other Latin American countries. Pseudomonas fuscovaginae was reported in association with rice grain discoloration in Panama (4), but to our knowledge, this is the first report of these two Burkholderia species being associated with panicle blight symptoms on rice in Panama. References: (1) T. B. Bernal et al. Fitosanidad 6:15, 2002. (2). A. K. M. Shahjahan et al. Rice J. 103:26, 2000. (3). R. S. Zeigler and E. Alvarez. Plant Dis. 73:368, 1989. (4). R. S. Zeigler et al. Plant Dis. 71:896, 1987.

The epidemiology of subacute sclerosing panencephalitis in England and Wales 1990-2002.

AIM: To assess the impact of measles/mumps/rubella (MMR) vaccine on the epidemiology of subacute sclerosing panencephalitis (SSPE) in England and Wales. METHODS: Cases of SSPE resident in England and Wales with onset between 1990 and 2002 were reviewed. RESULTS: A total of 47 cases were identified, 31 male and 16 female. There was an average annual decline of 14% in SSPE onset over the period, consistent with the decline in notified measles over the last 20 years. A history of measles was present in 35 (median age 1.3 years), the most recent recorded date being 1994; the interval from measles to onset of SSPE ranged from 2.7 to 23.4 years. Four children with a history of receipt of a measles containing vaccine were reported not to have had measles; two of these cases had a brain biopsy, and nucleotide sequence data confirmed wild measles infection. Brain biopsy specimens from a further three cases with a history of measles, of whom two had also had a history of vaccination, showed wild-type strain. CONCLUSION: The prevention of endemic circulation of measles virus in England and Wales through the high coverage achieved with MMR vaccine, together with the measles/rubella vaccination campaign of 1994, has resulted in the near elimination of SSPE. However, the recent decline in MMR vaccine coverage, with the associated increase in localised measles outbreaks and cases in young infants, is of concern. It underlines the importance of maintaining high vaccine coverage in order to protect indirectly those most vulnerable to SSPE, namely infants too young to be vaccinated.

Characterization of antimicrobial peptides against a US strain of the rice pathogen Rhizoctonia solani.

AIM: To identify antimicrobial peptides with high lytic activity against Rhizoctonia solani strain LR172, causal agent of rice sheath blight and aerial blight of soyabeans in the US. METHODS AND RESULTS: Among 12 natural and synthetic antimicrobial peptides tested in vitro, the wheat-seed peptide, purothionin, showed the strongest inhibitory activity that was similar to the antifungal antibiotics, nystatin and nikkomycin Z. Cecropin B, a natural peptide from cecropia moth, and synthetic peptide D4E1 produced the highest inhibitory activity against R. solani among linear peptides. Membrane permeabilization levels strongly correlated with antifungal activity of the peptides. Noticeable changes in membrane integrity were observed at concentrations of >/=0.5 micromol l(-1) for purothionin, 2 micromol l(-1) for cecropin B, D4E1, D2A21, melittin, and phor21, and 8 micromol l(-1) for magainin II and phor14. An increase of nuclear membrane permeabilization was observed in fungal cells treated with cecropin B, but not with purothionin. Diffusion of nuclear content was observed by fluorescent microscopy 10 min after adding a lethal concentration of cecropin B. Evaluation by electron microscopy confirmed severe cytoplasmic degradation and plasma membrane vesiculation. Purothionin and cecropin B were the most stable against proteolytic degradation when added to liquid cultures of R. solani. CONCLUSIONS: Purothionin, cecropin B, D4E1 and phor21 were shown to exhibit high in vitro lytic activity against R. solani strain LR172 for rice and soyabean. These peptides are greater than 16 amino acids long and rapidly increase fungal membrane permeabilization. Resistance to proteolysis is important for sufficient antifungal activity of antimicrobial peptides. SIGNIFICANCE AND IMPACT OF THE STUDY: Selected antimicrobial peptides offer an attractive alternative to traditional chemicals that could be utilized in molecular breeding to develop crops resistant to rice sheath blight and aerial blight of soyabean.

Occurrence of Epstein-Barr virus illness in children diagnosed with group A streptococcal pharyngitis.

Epstein-Barr virus mononucleosis and group A streptococcal pharyngitis are acute infectious processes similar in both their clinical manifestations. Coinfections may occur and be a direct result of a synergistic effect on inflamed pharyngeal and tonsillar tissue. It was our observation that a population of children diagnosed with group A streptococcal pharyngitis and not responding to appropriate antimicrobial therapy had Epstein-Barr virus illness.

Suppression of natural killer cells after acute intoxication with alcohols and cholinotropic preparations and their reactivation with T-activin.

Acute poisoning with alcohols and cholinotropic preparations carboxyphosphamide and atropine (0.8 LD(50)) was modeled on male outbred mice weighing 18-24 g. The decrease in activity of natural killer cells was most pronounced after injection of atropine, but insignificant after treatment with ethanol. The inhibitory effect of ethylene glycol, methanol, and methanol on functional activity of natural killer cells in vitro directly depended on their concentration. The effects of alcohols in equimolar concentrations of 10, 100, and 500 mM were similar. Therefore, immunotoxicity of alcohols was associated with the action of their metabolites. The ability of products formed after biotransformation of ethylene glycol, methanol, and ethanol in equimolar concentrations to cause damage to natural killer cells decreased in the following order: glyoxylic acid>formic acid>acetaldehyde>glycolaldehyde>glycolic acid. T-Activin injected subcutaneously in doses of 2.5 and 5.0 microg/kg for 3 days normalized activity of natural killer cells suppressed after acute poisoning with alcohols and cholinotropic preparations.

Parental causes of death in primary intracerebral haemorrhage.

There are many reports of familial aggregation in stroke. Previously, examining parental causes of death, we found no evidence for familial risk in stroke once socioeconomic and socioenvironmental factors were controlled for. However, the number of patients with primary intracerebral haemorrhage (PICH) was small in this sample and we could not exclude a moderate effect of familial factors in this important subgroup. We therefore matched all cases with PICH on the Lothian Stroke Register with 2 controls per case of the same sex, born in the same year, district, and whose fathers had the same occupation. Presence on parental death certificates of cerebrovascular disease, other vascular disease, bronchial carcinoma, hypertension, diabetes mellitus and other causes of death was recorded. No significant difference in risk was found for cases with parental cerebrovascular disease (OR 0.75, 95% CI 0.40-1.40). Other forms of vascular disease in parents were not associated with significant risk either (OR 0.93, 95% CI 0.51-1.68). We conclude that familial factors do not contribute substantially to risk in most cases of PICH.

Birth weight and cognitive function at age 11 years: the Scottish Mental Survey 1932.

AIMS: To examine the relation between birth weight and cognitive function at age 11 years, and to examine whether this relation is independent of social class. METHODS: Retrospective cohort study based on birth records from 1921 and cognitive function measured while at school at age 11 in 1932. Subjects were 985 live singletons born in the Edinburgh Royal Maternity and Simpson Memorial Hospital in 1921. Moray House Test scores from the Scottish Mental Survey 1932 were traced on 449 of these children. RESULTS: Mean score on Moray House Test increased from 30.6 at a birth weight of <2500 g to 44.7 at 4001-4500 g, after correcting for gestational age, maternal age, parity, social class, and legitimacy of birth. Multiple regression showed that 15.6% of the variance in Moray House Test score is contributed by a combination of social class (6.6%), birth weight (3.8%), child's exact age (2.4%), maternal parity (2.0%), and illegitimacy (1.5%). Structural equation modelling confirmed the independent contribution from each of these variables in predicting cognitive ability. A model in which birth weight acted as a mediator of social class had poor fit statistics. CONCLUSION: In this 1921 birth cohort, social class and birth weight have independent effects on cognitive function at age 11. Future research will relate these childhood data to health and cognition in old age.

Signaling mediated by the closely related mammalian Rho family GTPases TC10 and Cdc42 suggests distinct functional pathways.

The mammalian Rho family GTPases TC10 and Cdc42 share many properties. Activated forms of both proteins stimulate transcription mediated by nuclear factor kappaB, serum response factor, and the cyclin D1 promoter; activate c-Jun NH2-terminal kinase; cooperate with activated Raf to transform NIH-3T3 cells; and, by a mechanism independent of all of these effects, induce filopodia formation. In contrast, previously reported differences between TC10 and Cdc42 are not striking. We now present studies of TC10 and Cdc42 in cell culture that reveal clear functional differences: (a) wild-type TC10 localizes predominantly to the plasma membrane and less extensively to a perinuclear membranous compartment, whereas wild-type Cdc42 localizes predominantly to this compartment and less extensively to the plasma membrane; (b) expression of Rho guanine nucleotide dissociation inhibitor alpha results in a redistribution of wild-type Cdc42 to the cytosol but has no effect on the plasma membrane localization of wild-type TC10; (c) TC10 fails to rescue a Saccharomyces cerevisiae cdc42 mutation, unlike mammalian Cdc42; (d) dominant negative Cdc42, but not dominant negative TC10, inhibits neurite outgrowth in PC12 cells stimulated by nerve growth factor; and (e) activation of nuclear factor kappaB-dependent transcription by Cdc42, but not by TC10, is inhibited by sodium salicylate. These findings point to distinct pathways in which TC10 and Cdc42 may act and distinct modes of regulation of these proteins.

Parental causes of death in stroke.

There are many reports of familial aggregation in stroke. However, whether familial aggregation is largely due to genetic or environmental factors is not established. Consecutive subjects with stroke were matched with 2 controls per case of the same sex, born in the same year, district, and whose fathers had the same occupation. Presence on parental death certificates of cerebrovascular disease, other vascular disease, bronchial carcinoma, hypertension, diabetes mellitus and other causes of death was recorded. No significant difference in risk was found for cases having mother (odds ratio, OR 1.08, 95% confidence interval, CI, 0.74-1.57), father (OR 0.91, 95% CI 0.58-1.45) or either parent (OR 1.04, 95% CI 0.74-1.46) with cerebrovascular disease. Familial aggregation may reflect socioeconomic and other environmental factors.

Differential localization of Rho GTPases in live cells: regulation by hypervariable regions and RhoGDI binding.

Determinants of membrane targeting of Rho proteins were investigated in live cells with green fluorescent fusion proteins expressed with or without Rho-guanine nucleotide dissociation inhibitor (GDI)alpha. The hypervariable region determined to which membrane compartment each protein was targeted. Targeting was regulated by binding to RhoGDI alpha in the case of RhoA, Rac1, Rac2, and Cdc42hs but not RhoB or TC10. Although RhoB localized to the plasma membrane (PM), Golgi, and motile peri-Golgi vesicles, TC10 localized to PMs and endosomes. Inhibition of palmitoylation mislocalized H-Ras, RhoB, and TC10 to the endoplasmic reticulum. Although overexpressed Cdc42hs and Rac2 were observed predominantly on endomembrane, Rac1 was predominantly at the PM. RhoA was cytosolic even when expressed at levels in vast excess of RhoGDI alpha. Oncogenic Dbl stimulated translocation of green fluorescent protein (GFP)-Rac1, GFP-Cdc42hs, and GFP-RhoA to lamellipodia. RhoGDI binding to GFP-Cdc42hs was not affected by substituting farnesylation for geranylgeranylation. A palmitoylation site inserted into RhoA blocked RhoGDI alpha binding. Mutations that render RhoA, Cdc42hs, or Rac1, either constitutively active or dominant negative abrogated binding to RhoGDI alpha and redirected expression to both PMs and internal membranes. Thus, despite the common essential feature of the CAAX (prenylation, AAX tripeptide proteolysis, and carboxyl methylation) motif, the subcellular localizations of Rho GTPases, like their functions, are diverse and dynamic.

Effect of Silicon and Host Resistance on Sheath Blight Development in Rice.

Rice cultivars high in partial resistance (Jasmine, LSBR-5), moderately susceptible (Drew and Kaybonnet), and susceptible (Lemont and Labelle) to sheath blight were grown in a silicon-deficient Histosol with and without calcium silicate slag. The treatment with silicon increased the concentration of this element in plant tissue by 80%over all experiments. Fertilization with silicon significantly reduced the severity of sheath blight, and the total area under the vertical lesion extension progress curve on moderately susceptible and susceptible cultivars compared to those cultivars high in partial resistance without silicon. The percentage of infected tillers was significantly reduced by 82, 42, 28, 41, 26, and 17%respectively for Jasmine, LSBR-5, Drew, Kaybonnet, Lemont, and Labelle, when silicon was applied, over all experiments. Dry matter accumulation was significantly greater with added silicon. In the absence of disease, silicon enhanced dry matter accumulation by 15%over the control, whereas silicon more than doubled the mean dry matter accumulation in infected plants. The application of silicon to complement host resistance to sheath blight appears to be an effective strategy for disease management in rice, especially when the soil is low or limiting in plant-available silicon.

Altruistic organizational citizenship behavior: context, disposition, and age.

The authors proposed employee age as moderating the structural stability of altruistic organizational citizenship behavior (OCB) with regard to the influence of context-relevant attitudes and dispositional variables. Analyses of peer ratings of altruistic OCB in a sample of 96 U.S. nurses showed that the contextual variables of job satisfaction, organizational commitment, and trust in management were germane for the younger participants. The dispositional variable of moral judgment was a unique predictor of altruistic OCB among the older participants.

Outbreak of False Smut of Rice in Louisiana.

False smut, caused by Ustilaginoidea virens (Cooke) Takah., has been occurring in Louisiana rice since at least 1906 (4). A color plate (no. 69) of the disease was published in the Compendium of Rice Diseases published by the American Phytopathological Society (3). The slide for this plate was taken by M. C. Rush in 1976 of rice grown at the Rice Research Station at Crowley, LA. Since that time, the disease has been sporadic and light in Louisiana. In 1997, however, incidence was high. False smut was present on many germ plasms at the Rice Research Station in Crowley and was observed on commercial cultivars in several growers' fields in southwestern Louisiana. Incidence ranged from 1 to 15% of tillers infected with at least two to three spore balls per infected panicle. The disease occurred on both long- and medium-grain cultivars. False smut of rice occurs in the field at the hard dough to mature stages of the crop. A few spikelets in a panicle transform into globose, yellowish green, velvety spore balls that are 2 to 5 cm in diameter and covered by a thin orange membrane. The membrane bursts open and releases powdery dark green spores. The chlamydospores formed in the spore balls are spherical to elliptical, warty, olivaceous, and 3 to 5 × 4 to 6 µm in dimension. Some of the spore balls develop one or more sclerotia, which are the overwintering structure, in the center. False smut has been considered a minor disease of rice that occurs sporadically in Louisiana. The recent discovery of ustilotoxin, a phytotoxin and mycotoxin, produced by this pathogen on diseased tissues suggests that the fungus may be of concern as a contaminant on rice products consumed by livestock and humans (1,2). This increases the need to monitor the incidence of this disease. References: (1) Koiso et al. Ustiloxin: A phytotoxin and a mycotoxin from false smut balls on rice panicles. Tetrahedron Lett. 33:4157, 1992. (2) Koiso et al. Ustiloxins, antimitotic cyclic peptides from false smut balls on rice panicles caused by Ustilaginoidea virens. J. Antibiot. 47:765, 1994. (3) F. N. Lee and P. S. Gunnel. 1992. Compendium of Rice Diseases. The American Phytopathological Society, St. Paul, MN. p. 28. (4) W. A. Orton. 1907. Plant diseases of 1906. Yearbook U.S. Department of Agriculture. U.S. Government Printing Office, Washington, DC, pp. 499-508.

Cellular functions of TC10, a Rho family GTPase: regulation of morphology, signal transduction and cell growth.

The small Ras-related GTPase, TC10, has been classified on the basis of sequence homology to be a member of the Rho family. This family, which includes the Rho, Rac and CDC42 subfamilies, has been shown to regulate a variety of apparently diverse cellular processes such as actin cytoskeletal organization, mitogen-activated protein kinase (MAPK) cascades, cell cycle progression and transformation. In order to begin a study of TC10 biological function, we expressed wild type and various mutant forms of this protein in mammalian cells and investigated both the intracellular localization of the expressed proteins and their abilities to stimulate known Rho family-associated processes. Wild type TC10 was located predominantly in the cell membrane (apparently in the same regions as actin filaments), GTPase defective (75L) and GTP-binding defective (31N) mutants were located predominantly in cytoplasmic perinuclear regions, and a deletion mutant lacking the carboxyl terminal residues required for post-translational prenylation was located predominantly in the nucleus. The GTPase defective (constitutively active) TC10 mutant: (1) stimulated the formation of long filopodia; (2) activated c-Jun amino terminal kinase (JNK); (3) activated serum response factor (SRF)-dependent transcription; (4) activated NF-kappaB-dependent transcription; and (5) synergized with an activated Raf-kinase (Raf-CAAX) to transform NIH3T3 cells. In addition, wild type TC10 function is required for full H-Ras transforming potential. We demonstrate that an intact effector domain and carboxyl terminal prenylation signal are required for proper TC10 function and that TC10 signals to at least two separable downstream target pathways. In addition, TC10 interacted with the actin-binding and filament-forming protein, profilin, in both a two-hybrid cDNA library screen, and an in vitro binding assay. Taken together, these data support a classification of TC10 as a member of the Rho family, and in particular, suggest that TC10 functions to regulate cellular signaling to the actin cytoskeleton and processes associated with cell growth.

Isolated mammalian and Schizosaccharomyces pombe ran-binding domains rescue S. pombe sbp1 (RanBP1) genomic mutants.

Mammalian Ran-binding protein-1 (RanBP1) and its fission yeast homologue, sbp1p, are cytosolic proteins that interact with the GTP-charged form of Ran GTPase through a conserved Ran-binding domain (RBD). In vitro, this interaction can accelerate the Ran GTPase-activating protein-mediated hydrolysis of GTP on Ran and the turnover of nuclear import and export complexes. To analyze RanBP1 function in vivo, we expressed exogenous RanBP1, sbp1p, and the RBD of each in mammalian cells, in wild-type fission yeast, and in yeast whose endogenous sbp1 gene was disrupted. Mammalian cells and wild-type yeast expressing moderate levels of each protein were viable and displayed normal nuclear protein import. sbp1(-) yeast were inviable but could be rescued by all four exogenous proteins. Two RBDs of the mammalian nucleoporin RanBP2 also rescued sbp1(-) yeast. In mammalian cells, wild-type yeast, and rescued mutant yeast, exogenous full-length RanBP1 and sbp1p localized predominantly to the cytosol, whereas exogenous RBDs localized predominantly to the cell nucleus. These results suggest that only the RBD of sbp1p is required for its function in fission yeast, and that this function may not require confinement of the RBD to the cytosol. The results also indicate that the polar amino-terminal portion of sbp1p mediates cytosolic localization of the protein in both yeast and mammalian cells.