ERK1/2 mediates PDGF-BB stimulated vascular smooth muscle cell proliferation and migration on laminin-5.

During restenosis following arterial injury, vascular smooth muscle cells (VSMCs) form a neointimal layer in arteries by changing from a differentiated, contractile phenotype to a dedifferentiated, migratory, and proliferative phenotype. Several growth factors, cytokines, and extracellular matrix components released following injury have been implicated in these phenotypic changes. We have recently detected the expression of laminin-5, an ECM protein found predominantly in epithelial tissues, in the arterial vasculature. Here we report that ln-5 expression by VSMC is upregulated by platelet-derived growth factor (PDGF-BB), epidermal growth factor, basic fibroblast growth factor, and transforming growth factor-beta1. Adhesion to ln-5 specifically enhances PDGF-BB-stimulated VSMC proliferation and migration. PD98059, a specific inhibitor of the ERK1/2 members of the Mitogen Activated Protein kinase family, increases both VSMC adhesion to ln-5 and blocks PDGF-BB-stimulated VSMC migration on ln-5. These results suggest that adhesion to ln-5 mediates a PDGF-BB-stimulated VSMC response to vascular injury via an ERK1/2 signaling pathway.

PDGF-BB enhances expression of, and reduces adhesion to, laminin-5 in vascular smooth muscle cells.

The laminin family of extracellular matrix (ECM) proteins plays crucial roles in regulating cellular growth, migration, and differentiation. We report here that laminin-5 is expressed in the tunica media of the rat aorta and pulmonary arteries. Using indirect immunofluorescence microscopy, Western blots, and RT-PCR analysis, we found that primary cultures of rat arterial smooth muscle cells express laminin-5 and deposit it into their insoluble ECM. These cells also attach strongly to laminin-5 via beta1 integrin receptors in 30 min adhesion assays. Laminin-5 expression in these cells is upregulated by growth factors in vitro and platelet-derived growth factor (PDGF-BB) stimulation reduces adhesion to laminin-5. As laminin-5 promotes enhanced migration of other cell types, the production of and adhesion to laminin-5 by vascular smooth muscle cells may play a role in the pathological growth and migration of these cells associated with restenosis following vascular injury.

Screening assay for promigratory/antimigratory compounds.

Large-scale screening strategies aimed at finding anticancer drugs traditionally focus on identifying cytotoxic compounds that attack actively dividing cells. Because progression to malignancy involves acquisition of an aggressively invasive phenotype in addition to hyperproliferation, simple and effective screening strategies for finding compounds that target the invasive aspects of cancer progression may prove valuable for identifying alternative and preventative cancer therapies. Here, we describe a fluorescence-based automated assay for identifying antimigratory compounds, with the ability to discern cytotoxic from noncytotoxic modes of action. With this assay, we analyzed the effects of two drugs on tumorigenic (MDA-MB-435) and nontumorigenic (MCF-10A) human breast cell lines. We chose to compare carboxyamidotriazole (CAI), an experimental compound shown to inhibit migration of various cell types, with tamoxifen, a common preventative and therapeutic anticancer compound. Our assay demonstrated that both these compounds inhibit migration at sublethal concentrations. Furthermore, CAI was more effective than tamoxifen at inhibiting chemotactic and haptotactic migration of both cell lines at all concentrations tested.

Antibody-induced activation of beta1 integrin receptors stimulates cAMP-dependent migration of breast cells on laminin-5.

The beta1 integrin-stimulating antibody TS2/16 induces cAMP-dependent migration of MCF-10A breast cells on the extracellular matrix protein laminin-5. TS2/16 stimulates a rise in intracellular cAMP within 20 min after plating. Pertussis toxin, which inhibits both antibody-induced migration and cAMP accumulation, targets the Galphai3 subunit of heterotrimeric G proteins in these cells, suggesting that Galphai3 may link integrin activation and migration via a cAMP signaling pathway.

Heat shock protein 27 plays two distinct roles in controlling human breast cancer cell migration on laminin-5.

It has recently been reported that phosphorylation of the small heat shock protein 27 (hsp27) enhances p38 MAP kinase dependent migration of bovine and human vascular endothelial cells. We have examined the role of hsp27 in controlling the constitutive migration of human breast cancer cells on the extracellular matrix molecule laminin-5. In a haptotaxis assay, anisomycin- or heat shock-induced phosphorylation of hsp27 enhances migration of MDA-MB-231 breast cancer cells constitutively overexpressing hsp27. Under these conditions, hsp27 redistributes to the nucleus. Unphosphorylated hsp27, which remains in the cytosol, induces resistance to a subset of drugs that inhibit haptotactic migration of these cells. We conclude that hsp27 plays two distinct roles in controlling migration of breast cancer cells: phosphorylated hsp27 enhances migration, while unphosphorylated hsp27 can sustain migration in the presence of inhibitory drugs.

Molecular cloning of a human MafF homologue, which specifically binds to the oxytocin receptor gene in term myometrium.

The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins from human myometrium at parturition. To elucidate the molecular mechanisms involved in OTR gene upregulation at term, the US-2 element was used in a yeast one-hybrid system to screen a cDNA library derived from term human myometrium. Positive clones were further screened by electrophoretic mobility shift assay for their ability to bind the human OTR gene promoter, containing the US-2 motif. A 2.3-kb full-length cDNA encoding a human homologue of chicken MafF (hMafF) was isolated. hMafF represents an 18-kDa protein and contains an extended leucine zipper structure, but lacks a transactivation domain. Furthermore, Northern hybridization showed strong hMafF mRNA expression in the kidney and in term myometrium only, but not in nonpregnant myometrium. The hMafF protein is also preferentially expressed in term myometrium, as shown by specific binding to the OTR promoter. The highly specific binding of hMafF to the US-2 motif in the human OTR gene, together with its pattern of expression, supports a role for hMafF in OTR gene upregulation at term.

Accumulation of cyclooxygenase-2 gene transcripts in uterine tissues of pregnant and parturient cows: stimulation by oxytocin.

Cyclooxygenase 1 and 2 (COX-1 and COX-2) mRNA were measured by ribonuclease protection assays in total RNA extracted from intercaruncular and caruncular endometrium, myometrium, cotyledons, and cervical mucosa of pregnant cows. Tissues were obtained at gestational ages of 150 days and 275 days and at term not in labor, at term in labor, and 6-12 h postpartum. Additionally, the effect of oxytocin (OT) on COX-2 expression was determined in intercaruncular endometrium of six third-trimester cows (between 230 and 270 days of pregnancy), three of which were injected with OT (200 IU) and three with saline 2 h before tissues were harvested. Prostaglandin F2alpha (PGF2alpha) metabolite was measured in plasma samples taken at 15-min intervals before and after the injections. Results showed that COX-2 mRNA was expressed in every type of tissue examined, although in different concentrations and beginning at different stages. Other than in seminal vesicular and prostate glands used as positive controls, low concentrations of COX-1 mRNA were detected only in myometrium and caruncles. Cotyledons had the highest concentration of COX-2 transcripts at all stages studied. Caruncles had about half the concentration of COX-2 transcripts that was seen in cotyledons, and on Day 150 even less. COX-2 mRNA expression in both tissues increased with advancing gestation, but there was no difference between samples from term-no-labor and term-in-labor cows. COX-2 mRNA concentrations in endometrium and myometrium were low; they varied randomly during pregnancy with no significant increase until postpartum, when COX-2 transcripts in endometrium had increased severalfold whereas those in myometrium were similar to values before parturition. Cervical mucosa expressed COX-2 mRNA weakly until term but had increased markedly at parturition. Injection of 200 IU of OT induced a substantial increase in endometrial COX-2 mRNA concentration within 2 h; this was associated with linearly increasing plasma concentrations of 13, 14-hydroxy-15-keto-prostaglandin F2alpha, which were still rising at termination of the experiment. The results suggest that endogenous OT is a major factor in induction of COX-2 expression and PGF2alpha release at term and during parturition in cows.

The role of SF-1/Ad4BP in the control of the bovine gene for the steroidogenic acute regulatory (StAR) protein.

The bovine gene for the steroidogenic acute regulatory protein (StAR) was cloned and sequenced, including 2 kb of the upstream control region of the gene. The gene comprises seven exons arranged similarly to those of the human and mouse gene sequences. The sequence analysis identified three cis elements corresponding to the binding motif for the transcription factor SF-1/Ad4BP, at - 100, - 240 and - 1190 from the transcription start site. Electrophoretic mobility shift analysis (EMSA) using nuclear proteins from bovine corpus luteum and bovine adrenal as well as in vitro transcribed/translated SF-1/Ad4BP consistently showed that only the site at -1190 bound the transcription factor significantly. Very weak binding was detectable also at the - 240 site, but none at the -100 site. Heterologous transfection of StAR promoter deletion-reporter constructs into Hela cells cotransfected with an expression vector for bovine SF-1/Ad4BP, showed that this transcription factor can specifically act on the bovine StAR gene promoter, but preferentially in regions corresponding to the two proximal SF-1/Ad4BP elements at - 100 and - 240, though with only low relative effect. Furthermore, additional cotransfection of a construct expressing a constitutive protein kinase A catalytic subunit to mimic the effects of cAMP stimulation, led to a small SF-1/Ad4BP-dependent increase in reporter activity mediated only by the same proximal sites. Since the bovine StAR gene promoter does not appear to have a functional cAMP responsive element (CRE), either this effect is mediated in this system directly by SF-1/Ad4BP, or by other factors interacting with this transcription factor, but which do not involve CRE-mediated gene activation. Taken together, the results show that there is a discrepancy between the results of the EMSA experiments and those using transfection of promoter-reporter constructs, which needs to be resolved before a clear understanding of SF-1/Ad4BP-mediated regulation of the StAR gene is attained.

Marsupial relaxin: complementary deoxyribonucleic acid sequence and gene expression in the female and male tammar wallaby, Macropus eugenii.

The nucleotide and derived amino acid sequences of tammar preprorelaxin were established by combined reverse transcriptase polymerase chain reaction and 3'- and 5'-rapid amplification of cDNA ends methods, using RNA from the corpus luteum of late pregnancy as template. Relaxin gene expression was then investigated in tissues at various stages of the 26-day pregnancy and in adult males. The full-length tammar relaxin preprohormone is 579 base pairs. The derived amino acid sequence contains a probable signal peptide of 26 amino acids, a B-domain of 31 amino acids, a C-domain of 111 amino acids, and an A-domain of 24 amino acids, with sequence homologies of 49%, 38%, 47%, and 47%, respectively, to dogfish, pig, and both human relaxins, for the combined A- and B-domains of the functional peptides. The conserved amino acid residues in the B-domain confirm a region shown to be essential for binding of the peptide to its receptor. A relaxin gene is expressed in several other tissues of pregnant tammars including the placenta, follicle, and hypothalamus. Northern analysis showed a 1-kilobase relaxin transcript in the corpus luteum and placenta. Using RNase protection assays, relaxin gene expression in the corpus luteum was greater in early and mid pregnancy, reduced at term, and absent postpartum. These data demonstrate relaxin biosynthesis in both the corpus luteum and placenta in this marsupial and suggest that a relaxin physiology has been conserved during mammalian evolution.

Oxytocin and male reproductive function.

In the male mammal, the small peptide hormone oxytocin is produced in similar quantities within the hypothalamo-pituitary magnocellular system as in the female, yet for the male little is known about the physiology associated with this hormone. The present review summarizes what is known about the function of oxytocin in the male mammal and tries to take account of both central and systemic effects, and those linked with a local production of oxytocin within the male reproductive organs. In several species a pulse of systemic oxytocin, presumably of hypothalamic origin, appears to be associated with ejaculation. The systemic hormone could act peripherally stimulating smooth muscle cells of the male reproductive tract, but could also reflect central effects in the brain modulating sexual behaviour. In addition to systemic oxytocin, the peptide is also made locally within the testis, and possibly also the epididymis and prostate. In the former tissue it appears to have an autocrine/paracrine role modulating steroid metabolism, but may in addition be involved in contractility of the seminiferous tubules. However, the latter function may involve the mediacy of Sertoli cells which under some circumstances can also exhibit the components of a local oxytocin system. In the prostate of the rat and the dog oxytocin is linked again to steroid metabolism and may also act as a growth regulator. Finally, oxytocin in seminal fluid is discussed and its possible role in respect to the fate of the semen following ejaculation.

Structure and expression of the bovine oxytocin receptor gene.

The gene for the bovine oxytocin receptor has been sequenced using a combination of clones derived from a bovine endometrial cDNA library from estrus and a bovine genomic DNA library, with confirmation of structure using reverse transcription PCR programmed by term myometrial RNA. The receptor belongs to the seven transmembrane domain family and predicts a protein of 391 amino acids. A comparison of the genomic sequence with the cDNA structure, as well as reverse transcription polymerase chain reaction (RT-PCR) analysis, shows there are two introns, one in the 5'noncoding region that appears to be differentially spliced in the bovine uterus and a conserved intron within the open reading frame between the regions encoding the transmembrane domains VI and VII. Northern blot analysis indicated three major transcripts in myometrium and endometrium in vivo at approximately 6.5 kb, 3.5 kb, and 2.0 kb. In situ hybridization analysis of uterine tissue at term showed highest mRNA concentrations in the endometrial epithelium, particularly in the deep glands, a pattern confirmed also at the immunohistochemical level by monoclonal antibodies raised against a human amino-terminal peptide. Further confirmation of the identity of the receptor was obtained by transient transfection of a reconstituted receptor construct into COS-7 cells. The expressed receptor was shown to have identical pharmacological properties in respect to various oxytocin analogs to the natural bovine endometrial receptor.

Molecular cloning and in vivo expression of the bovine steroidogenic acute regulatory protein.

Differential screening was used to select clones from a bovine luteal cDNA library, which were specifically expressed in late luteal stages. One of these clones encoded the bovine homologue of the Steroidogenic Acute Regulatory protein (StAR). The bovine StAR gene is transcribed as 3kb and 1.8kb transcripts, which differ in their sites of 3' polyadenylation. Both transcripts are highly expressed in corpora lutea of mid to late cycle and through pregnancy, but only at low levels in the early cycle. Northern analysis showed expression only in the corpus luteum and in the adrenal gland, but not in any other tissue examined. Within the protein coding region of the bovine StAR gene, there is a marked 124 base homology to the 5' non-coding region of another luteal transcript, TIMP-1, suggesting a possible common regulatory function for this sequence.

Oxytocin and oxytocin receptor gene expression in the reproductive tract of the pregnant cow: rescue of luteal oxytocin production at term.

The peptide hormone oxytocin is produced both in the hypothalamus and in certain peripheral organs. The extent of extra-hypothalamic hormone synthesis in the pregnant cow has not previously been examined. In this study we have analyzed different tissues from the pregnant bovine reproductive tract and corpus luteum for the presence of mRNA encoding the oxytocin peptide as well as the oxytocin receptor. In uterine tissues oxytocin mRNA could only be detected sporadically with the help of a reverse transcription-polymerase chain reaction method, implying only very low levels of expression. The caruncles showed a consistently low level of oxytocin gene expression, which appeared up-regulated at term. However, in the corpus luteum there was a significant level of oxytocin gene expression at term, particularly following the onset of labor. The transcript levels were sufficiently high to be measurable by both RNase protection assay and by Northern hybridization; these levels imply a rescue of the oxytocin gene expression seen in the corpora lutea of cyclic and early pregnant cows. At the peptide level this expression was confirmed by immunohistochemistry. A sensitive RNase protection assay was developed to detect transcripts encoding the oxytocin receptor. Transcripts were detected in most uterine tissues, including the caruncles, with highest levels in the endometrium and myometrium at term. No transcripts could be detected in the corpus luteum at any stage of pregnancy, nor in the amnion. The results suggest the possibility of local, paracrine effects of oxytocin within the uterus of the pregnant cow. The rescue of luteal oxytocin at term could act to supplement the circulating hormone of pituitary origin.

Structure and organization of the bovine oxytocin receptor gene.

A DNA probe specific for the V and VI transmembrane domains of the bovine oxytocin receptor was initially prepared by reverse transcription PCR, and its structure and specificity confirmed by DNA sequencing. This probe was then used to screen a bovine genomic DNA library in bacteriophage lambda, and three positive clones were purified, subjected to restriction analysis and relevant fragments sequenced. Parallel to this, a cDNA library prepared using bovine endometrial RNA at the time of ovulation was screened by PCR employing the same primers as above. The longest cDNA clone was also fully sequenced. This clone still lacked, however, a substantial stretch of 5'sequence. The full transcript structure, and hence also the exon-intron organization, was then obtained by RT-PCR using primer oligonucleotides deduced from the cloned genomic sequence. All nucleotide sequence information was derived from a combination of two independent genomic clones, a cDNA clone and several independent RT-PCR reactions programmed by myometrial RNA, all in both strand orientations. The structural organization of the bovine oxytocin gene essentially conforms to that described for the human gene. Unlike the human gene, however, the 5'non-coding region of the primary transcript is interrupted by only a single intron, with a further intron in the coding region separating the sequences encoding the transmembrane domains VI and VII. The difference between this structure and that for the human gene suggests the existence of a differential splicing of 5' non-coding sequences.

Major human epididymis-specific gene product, HE3, is the first representative of a novel gene family.

Differential screening of a human epididymal cDNA library led to the isolation and characterization of a major epididymis-specific cDNA clone family, referred to as HE3. More detailed sequence and PCR analysis identified two different but homologous gene transcripts, HE3 alpha and HE3 beta. The former represents an mRNA of ca. 1 kb, encoding a putative small secretory polypeptide of 14903 MW. The HE3 beta transcript was only found as incomplete 3' fragments. Analysis of human genomic DNA by Southern blotting suggested the presence in the human genome of at least three independent HE3-related genes. Isolation of genomic clones for the HE3 alpha gene showed this to contain a single intron of 1.4 kb in the 5' noncoding region. Although genomic clones corresponding to HE3 beta could not be found, a third highly homologous gene, HE3 gamma, was identified as a potential pseudogene. Neither nucleotide nor encoded amino acid sequences of the HE3 gene family are related to any other known sequence in the central databases, and thus represents a novel human gene family, with at least three nonallelic members. Northern hybridization analysis showed that HE3 gene products are specifically expressed in the human epididymis, and not in any other tissue examined. Furthermore, except for the pig, no other nonprimate species has been identified to express homologous sequences in the epididymis. RNase protection assays showed that both the HE3 alpha and HE3 beta, but not the HE3 gamma genes, are expressed in the human epididymis.

Olmec settlement data from la venta, tabasco, Mexico.

Research at La Venta, a major Olmec center on a low salt dome 12 kilometers from the Gulf Coast has revealed evidence of initial occupation (about 1750 to 1400 B.C.) along levees of the silted-in Río Barí, north of the site core in a transitional estuarine-riverine environment. Between 1400 and 1150 B.C. settlement expanded to nearby La Venta itself, which between 1150 and 800 B.C. developed into a major temple-town complex. Local development peaked at La Venta and along the river levees between 800 and 500 B.C. In this span La Venta headed a local three-tiered site hierarchy as social distinctions expanded to the peripheral Río Barí sites. New excavations show that growth in population size and density at La Venta preceded the development of sociopolitical complexity. These data contradict the traditional organizational reconstruction of Olmec society, the "vacant ceremonial center" model, and provide qualified support for a model that presents riverine resource concentration as a significant factor in the evolution of Olmec civilization.

[Synthesis of oligosaccharide determinants with amide spacers of T-type antigens]. / Synthese von Oligosaccharid-Determinanten mit Amidspacer vom Typ des T-Antigens.

The hapten of the T-antigen was synthesized with a peptide-like amide-spacer as 2-(4-methoxycarbonylbutanecarboxamido)ethyl 2-acetamido-2-deoxy-3-O-beta-D-galactopyranosyl-alpha-D-galactopyranoside and coupled with serum albumin to give a synthetic antigen. Other O-beta-D-galactopyranosyl haptens, 2-(4-methoxycarbonylbutanecarboxamido)ethyl 2-acetamido-2-deoxy-4-O-beta-D-galactopyranosyl-alpha-D-galactopyranoside, O-beta-D-galactopyranosyl-(1 leads to 3)-O-[beta-D-galactopyranosyl-(1 leads to 4)]-2-acetamido-2-deoxy-alpha-D-galactopyranoside, and 2-acetamido-2-deoxy-3-O-beta-D-galactopyranosyl-alpha-D-glucopyranoside, the last compound being the determinant of the Lewis Lec antigen, were also synthesized.