Ecological effects on the oro- and nasopharyngeal microflora in children after treatment of acute otitis media with cefuroxime axetil or amoxycillin-clavulanate as suspensions.

OBJECTIVE: To evaluate if the extent of normal microflora disturbances differed between treatment with amoxycillin-clavulanate administered in an active form and cefuroxime axetil administered as an inactive prodrug. METHODS: Twenty-eight children, 0.5-5 years old, diagnosed with acute otitis media (AOM), were treated with either amoxycillin-clavulanate (13.3 mg/kg 3 times daily) or cefuroxime axetil (15 mg/kg twice daily) for 7 days. Saliva samples and nasopharyngeal swabs were collected before, directly after and 2 weeks after treatment. The saliva samples were quantitatively and qualitatively analyzed and the nasopharyngeal swabs were qualitatively analyzed. All isolated strains were tested for beta-lactamase production. RESULTS: Both treatment regimens gave rise to similar alterations of the normal oropharyngeal microflora. In both groups, the amount of Streptococcus salivarius was significantly reduced (P < 0.05). The most common causative pathogens of acute otitis were S. pneumoniae, Haemophilus influenzae and Moraxella catarrhalis. On the day of enrollment, approximately half of the patients, in both groups, were infected with more than one pathogen. The rate of infection or colonization with more than one potential pathogen was low on day 7 but recurred 2 weeks after treatment to similar levels as on day 0. The total number of patients with reinfection, recolonization or recurrence of pathogens on day 21 was 11/12 in the amoxycillin-clavulanate group and 4/7 in the cefuroxime axetil group. The most common beta-lactamase producer was M. catarrhalis. CONCLUSION: The local high concentration of antibiotics in the oropharynx immediately after intake of antibiotic suspensions seem to have little or no impact on the extent of disturbance of the microflora in this region. Children of this age group seem prone to either reinfection, recolonization or persistence of pathogens within 2 weeks after treatment. Furthermore, co-infection with more than one pathogen seems common in children with AOM and infection with beta-lactamase producing microorganisms occurs frequently.

[Patient based care registries as a tool to follow up services]. / Individbaserade vårdregister en hjälp vid verksamhetsuppföljning.

The Federation of Swedish County Councils and six medical specialties are working together in a project aiming to support and stimulate the development of patient based case registers as a tool to follow up, evaluate, develop and manage medical units. The project is based on participation on the part of the medical professions in a process-oriented way. Each case register shall be based on the individual patient, and will integrate inpatient and outpatient care, all medical professions and important procedures. In hematology the project also seeks to merge case costing data with the patient based case registers in order to facilitate more comprehensive cost analysis and comparison. This episodic perspective is useful for providers per se as well as in discussions between purchasers and providers as a method for understanding and analyzing medical services. The six specialties are hematology, obstetrics and gynecology, ophthalmology, otorhinolaryngology, dermatology and sexually transmitted diseases, and lastly psychiatry.

Impact of IgG replacement therapy and antibiotic treatment on the colonization of non-encapsulated Haemophilus influenzae in the nasopharynx in patients with hypogammaglobulinaemia.

Non-typable Haemophilus influenzae (NTHI) and Streptococcus pneumoniae are regarded as the main pathogens in patients with humoral immunodeficiency. These patients have been given IgG replacement therapy since the 1950s. However, a number of individuals still suffer from recurrent episodes of respiratory tract infections. Nasopharyngeal cultures were obtained on a regular basis over a 3-6-month period from 11 patients with common variable immunodeficiency disease in 1989 and 1998. The proportion of cultures positive for NTHI decreased from 56% in 1989-90 to 16% in 1998-99 (p < 0.003). After 9 y of IgG therapy, 7 of the 11 patients were free from NTHI in the nasopharynx. Specific NTHI strains were analysed by pulsed-field gel electrophoresis and compared, with regard to genetic relatedness, on an intra-individual basis. In 1 patient the same NTHI strain was found in both 1989 and 1999. The apparent absence of NTHI from the nasopharynx in most of the patients was assumed to be due to subcutaneous IgG treatment, as well as adequate antibiotic treatment.

Children with recurrent episodes of acute otitis media: the effect of local administration of immunoglobulin G on acute otitis media, colonization and turnover of non-encapsulated Haemophilus influenzae in the nasopharynx.

In most children with recurrent episodes of acute otitis media (AOM), tube treatment is successful, but there are those who nevertheless suffer from middle ear infections. The aim of the present study was to ascertain whether local administration of immunoglobulin could reduce the number of episodes of otorrhoea in otitis-prone infants <2 years old who were treated with tubes, or whether it could affect the nasopharyngeal colonization and turnover of bacterial pathogens in the nasopharynx. IgG or placebo were also administered intranasally daily for 6 months to 50 infants, randomized in a double-blind study. An arbitrarily primed polymerase chain reaction (AP-PCR) was used to characterize the different isolates of NTHI (non-encapsulated, non-typable Haemophilus influenzae). Three infants in the IgG group and six infants in the control group suffered from > or =3 episodes of acute otitis media. No effect on the nasopharyngeal colonization or the turnover of non-encapsulated H. influenzae in the nasopharynx could be detected in either group.

The nasopharynx and the middle ear. Inflammatory reactions in middle ear disease.

The host-parasite interactions in the nasopharynx with bacterial colonization and antigen uptake in the lymphoid tissue, the adenoid, has an impact on the maturation of local and systemic immunity. The adenoid is a part of mucosa associated lymphoid tissue and is responsible for both effector and inductor functions in the nasopharynx. Increasing evidence supports the role of serum antibody in protecting the middle ear cavity from disease. There is evidence for a minor immunologic defect in a number of children with recurrent episodes of AOM.

What is wrong in chronic adenoiditis/tonsillitis immunological factor.

The local immune response in adenoid and tonsil tissue can be visualized and the complexity of the cytokine network and effector molecule expression has not been illustrated in several different tonsillar entities. Many factors still remain to be learned in order to help us to understand the interactions between microorganisms and host in peripheral lymphatic tissue.

Are there microbiological markers to predict recurrent acute otitis media?

The nasopharynx is a natural reservoir for several bacterial species, including Streptococcus pneumoniae and Haemophilus influenzae. Carriership is a potential mechanism for pathogenicity, since bacteria might invade the Eustachian tube and cause middle ear disease. Whether the pattern of nasopharyngeal colonization is different in infection prone vs healthy children is still a matter of controversy. In several studies it has been shown that H. influenzae is carried significantly more often in otitis-prone children compared with healthy control children. Colonization with H. influenzae in young children may be regarded as a candidate for a microbiological marker for recurrent episodes of acute otitis media.

Immunological aspects of otitis media: present views on possibilities of immunoprophylaxis of acute otitis media in infants and children.

The article reviews, based on current knowledge of immunological events affecting the middle ear, the possibilities and prospects for the prevention of otitis media (OM) by immunologic measures. While pneumococcal capsular polysaccharide vaccines proved not to be effective against infant acute otitis media (AOM), pneumococcal conjugate vaccines provide good immunogenicity even in infants, and call for trials with better prospects of clinical efficacy. The other future approaches currently under development are vaccines against nontypable Haemophilus influenzae and Branhamella catarrhalis, anti-viral immunoprophylaxis, combinations of the above alternatives, or passive immunization. Also, the use of new routes or ways of immunization are under study. Furthermore, the ways to modify the present treatment practices of AOM to favour good immunologic responses in infants and children must be studied.

In situ analysis of the immune microenvironment of the adenoid in children with and without secretory otitis media.

Using monoclonal antibodies and immunohistochemistry, we compared adenoid tissue from 35 children with or without secretory otitis media. Numerous cells infiltrating the reticular crypt epithelium expressed HLA-DR, as did < 10% of the epithelial cells. Of the antigen-presenting cells, CD1a+ dendritic cells showed intraindividual and interindividual variations; CD68+ macrophages and CD22+ B cells were uniformly distributed. The relative frequencies of CD4+ and CD8+ cells were 6.6 +/- 2.0 versus 2.3 +/- 1.2 (p < .001) in the reticular crypt epithelium and 18 +/- 4.5 versus 1.5 +/- 0.9 (p < .001) in the germinal centers. The IL-2 receptor was expressed on < 0.1% of CD3+ T cells. Over 90% of intraepithelial CD3+ T cells were of the CD45RO+ memory phenotype. The proliferation marker Ki67 was almost exclusively found in the germinal centers. That the analyzed parameters showed a similar pattern in both clinical groups suggests that the presence of secretory otitis media may not correlate to specific alterations in the immune microenvironment of the adenoid.

Cytokines in nasopharyngeal secretions; evidence for defective IL-1 beta production in children with recurrent episodes of acute otitis media.

The host-parasite relationship in the nasopharynx of young children with bacterial colonization and antigen uptake in the mucosa and lymphatic tissue provides an opportunity to investigate infectious/inflammatory processes and responses. IL-1 beta, IL-6 and tumour necrosis factor-alpha (TNF-alpha) were analysed in nasopharyngeal secretions and serum from children with or without recurrent episodes of acute otitis media, from healthy adults and adults with or without recurrent episodes of acute otitis media, from healthy adults and adults with hypogammaglobulinaemia or selective deficiency of IgG3. Nasopharyngeal secretions generally contained substantial amounts of IL-1 beta, IL-6 and TNF-alpha. In contrast, IL-1 beta, IL-6 and TNF-alpha were not detectable in sera on the same occasion. Children were found to have higher levels of IL-1 beta, IL-6 and TNF-alpha than healthy adults and than adults with immunodeficiency. High levels of IL-1 beta were associated with low or undetectable levels of IL-6 and TNF-alpha, whereas the opposite pattern was seen in association with low levels of IL-1 beta. This was especially true for children with recurrent episodes of acute otitis media (RAOM). In children with nasopharyngeal colonization with Haemophilus influenzae, significantly higher levels of IL-1 beta, IL-6 and TNF-alpha (P = 0.0001, respectively) were found compared with non-colonized children. Notably, the RAOM children exhibited significantly lower levels of IL-1 beta, IL-6, and TNF-alpha in nasopharyngeal secretions (P = 0.0001, 0.01 and 0.0001, respectively) than healthy children. These results demonstrate local production of inflammatory cytokines in nasopharynx, related to bacterial colonization, and suggest that children with RAOM are poor nasopharyngeal cytokine producers.

Haemophilus influenzae resides and multiplies intracellularly in human adenoid tissue as demonstrated by in situ hybridization and bacterial viability assay.

The DNA oligomer 5'-d(TGCGGCCTCTCAGTCCCGCACTTTCATCTTCC)-3' specifically recognizes Haemophilus influenzae 16S rRNA. We report here the use of this oligonucleotide, with a fluorescein label tagged on its 5' end, as a probe for the in situ detection of nonencapsulated nontypeable H. influenzae in sections of adenoid tissue from 10 children who were clinically infection free but were having their adenoids removed because of nasal obstruction. In some cases, the reticular crypt epithelium was focally infiltrated by H. influenzae. The reservoir for these bacterial colonizations, in all likelihood long standing, seemed to be macrophage-like cells found in the subepithelial layers in all 10 cases. These mononuclear cells contained up to 200 intracellular H. influenzae cells. In the transmission electron macroscope, macrophage-like cells with intracellular bacteria with coccoid morphology, at least some of which were dividing, were seen. Adenoid cell suspensions, enriched for macrophages by use of paramagnetic beads coated with monoclonal antibodies against the CD14 marker, yielded up to 1,100 CFU of nontypeable H. influenzae per 10(5) cells after killing of extracellular bacteria with gentamicin followed by mechanical lysis of the cells.

Quantitative bacterial culture from adenoid lymphatic tissue with special reference to Haemophilus [corrected].

Homogenized adenoid tissue from 55 children (28-153 months) undergoing adenoidectomy because of nasopharyngeal obstruction was investigated by means of quantitative aerobic bacterial culture. The children were divided into two groups, the hypertrophy alone group--AH (n = 29)--and the hypertrophy with longstanding secretory otitis media group--SOM (n = 26). A nasopharyngeal culture was obtained preoperatively from 38 of the cases. Non-typeable H. influenzae (NTHI) was found in twice as many cases in the AH group as in the SOM group, 21/29 (72%) compared to 11/26 (42%) (p < 0.05) and in a significantly higher mean concentrations, 5.7 x 10(5) CFU/g compared to 1.9 x 10(5) CFU/g (p = 0.02). For the other aerobic potentially pathogenic bacteria no such difference was found. The bulk of the NTHI-positive cases and the cases with the highest concentrations were found in the children below the age of 6 years. In the nasopharyngeal cultures NTHI alone or together with S. pneumoniae and/or B. catarrhalis was found in 29% of the cases in both the AH group and SOM group. NTHI was found in only 50% of the nasopharyngeal cultures corresponding to a positive quantitative culture (10/20). These findings suggest that NTHI is harboured within the adenoid and could thereby chronically stimulate the local immune defense. However, the present study indicates that there is no aerobic bacterial overload in the adenoid tissue in children with SOM compared to children without middle-ear disease.

Anti pneumococcal antibody activity in nasopharyngeal secretions in healthy adults and children.

The local antibody activity to Streptococcus pneumoniae serotype 6B was measured in nasopharyngeal secretions from 20 healthy adults and 43 children, 1-3 years of age, 14 of whom were healthy and 29 were at risk for developing recurrent episodes of acute otitis media (RAOM) according to the criteria described below. In children, anti pneumococcal IgA and IgG antibody activity was of the same magnitude in both groups. Adults showed significantly higher specific IgA activity. Antibody activity of the IgG isotype was also higher in adults, possibly reflecting the higher serum antibody levels. The children at risk of developing RAOM had significantly higher levels of secretory component (SC) in their nasopharyngeal secretions. Our data suggest that local immunity in the nasopharynx is not fully developed in young children, which might contribute to bacterial survival and colonization in the region.

Nasal administration of IgA to individuals with hypogammaglobulinemia.

Many immunodeficient patients constantly carry non-typable Hemophilus influenzae (NTHI) in the nasopharynx, despite seemingly adequate antibiotic therapy. We have studied the effect of nasal administration of IgA on nasopharyngeal colonization in 5 patients with hypogammaglobulinemia, with a productive cough, especially in the mornings, who were constant carriers of NTHI in the nasopharynx, and had IgA, 1 ml 6 times/day, given nasally for 14 days. Nasopharyngeal cultures were obtained on days 0, 7, 14 and 28. Two of the patients became culture-negative during the treatment, and the cough was alleviated in all patients.

Middle ear disease in cleft palate children at three years of age.

Fourty-four cleft palate children consecutively referred to a plastic surgery unit were treated with palate repair at one year of age by one surgeon. The children were not routinely treated with ventilating tubes for middle ear disease. At 3 years of age they were investigated for aural pathology. Also specific antipneumococcal antibody activity was measured and was found to be compatible with the activity found in healthy age-matched control children. In the cleft palate children with no immaturity of the immune system only a slight increase in frequency of acute otitis media was evident. One third of the children had however suffered from long-standing secretory otitis media which can be regarded to be more common than what has been found in the normal population in several epidemiologic studies. At 3-4 years of age 82% of the children had a normal hearing indicating an improvement of the condition.

Treatment failure in otitis-prone children with prophylactic tympanostomy tubes is correlated with nasopharyngeal Haemophilus influenzae colonization.

Tympanostomy tubes are used to prevent recurrent otitis media among otitis-prone children. However, not all children benefit from this treatment. In the present study 28 children (19 boys, 9 girls) were given bilateral tympanostomy tubes at age 9-22 months (mean 14 months). They were observed 6 months before and after tube insertion. The treatment was considered successful for 20 children. Among these, 16 completely lacked or had one episode of middle ear discharge and 4 had otorrhea on two occasions. A total of 8 children suffered from three or more episodes of otorrhea and were considered as treatment failures. In the failure group, the nasopharyngeal average carrier rate of H. influenzae 6 months before and after tube insertion was 64% vs. 29% in the group responding well to the treatment (p less than 0.001). Nonencapsulated forms of H. influenzae were in a great majority. In the failure group 7 out of 8 presented middle ear discharge as soon as within 2 weeks after tube insertion whereas this occurred in only 3 out of 20 in the responding group. IgG, IgG1 and IgG2 antibody response to pneumococcal polysaccharide (6A, 19F) were equally distributed in the two groups. The present data suggest that one reason for an unsatisfactory response to treatment with prophylactic tympanostomy tubes is nasopharyngeal colonization and subsequent middle ear infections caused by H. influenzae.

Antibody production in rats after long-term exposure to formaldehyde.

Sprague-Dawley rats were vaccinated with pneumococcal polysaccharide antigens and tetanus toxoid to evaluate the immunologic effects of long-term formaldehyde exposure. The antibody response to vaccination was measured 3 to 4 weeks later by enzyme-linked immunosorbent assay. An IgG response to pneumococcal polysaccharides and to tetanus toxoid was found in both the formaldehyde-exposed group and a control group of rats not exposed to formaldehyde. The IgM response to tetanus toxoid was significant in both groups but neither group showed a significant IgM response to pneumococcal polysaccharides. There were thus no signs of impaired B-cell function in rats exposed to a high concentration (12.6 ppm) of formaldehyde for nearly 2 years.