Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 6 de 6
Filtrar
Mais filtros










Intervalo de ano de publicação
1.
Artigo em Inglês | MEDLINE | ID: mdl-34639803

RESUMO

INTRODUCTION: While European health policies do frequently take into consideration the ideas and experiences of their users, the voices of minority and marginalized communities are not often heard. European healthcare services must address this issue as the number of healthcare users with an MM background increases. AIM: To explore the perspectives of key stakeholders and healthcare users with an MM background on transcultural care in four European countries. DESIGN: Qualitative phenomenological study. METHODS: Semi-structured, individual interviews were conducted with stakeholders and MM users. Interviews were translated and transcribed verbatim and were carried out from February to May 2021. Descriptive statistics was used to describe the characteristics of the sample; qualitative data were analyzed thematically following Braun and Clarke's phases, resulting in 6 themes and 18 subthemes. RESULTS: For stakeholders and MM users with long-established residence in their respective countries, cultural differences involve different family and community norms, religious beliefs, lifestyles, and habits. These components are perceived as in tension with healthcare norms and values, and they mediate in two key and related aspects of the relationship between MM users and healthcare providers: accessibility and communication. CONCLUSIONS: Communication and access to healthcare are key to MM health service users, and they are the most frequent sources of misunderstanding and conflict between them and healthcare professionals. IMPACT: It is important to extend the investigation of cultural issues in healthcare to stakeholders and MM users. There is no doubt that healthcare professionals should be trained in cultural competence; however, cultural competence training is not the only area for improvement. There should be a change in paradigm in healthcare services across Europe: from individual to organizational integration of culture and diversity.


Assuntos
Competência Cultural , Pessoal de Saúde , Serviços de Saúde , Humanos , Percepção , Pesquisa Qualitativa
2.
Cancers (Basel) ; 3(3): 3279-330, 2011 Aug 12.
Artigo em Inglês | MEDLINE | ID: mdl-24212956

RESUMO

Cancer therapy has been characterized throughout history by ups and downs, not only due to the ineffectiveness of treatments and side effects, but also by hope and the reality of complete remission and cure in many cases. Within the therapeutic arsenal, alongside surgery in the case of solid tumors, are the antitumor drugs and radiation that have been the treatment of choice in some instances. In recent years, immunotherapy has become an important therapeutic alternative, and is now the first choice in many cases. Nanotechnology has recently arrived on the scene, offering nanostructures as new therapeutic alternatives for controlled drug delivery, for combining imaging and treatment, applying hyperthermia, and providing directed target therapy, among others. These therapies can be applied either alone or in combination with other components (antibodies, peptides, folic acid, etc.). In addition, gene therapy is also offering promising new methods for treatment. Here, we present a review of the evolution of cancer treatments, starting with chemotherapy, surgery, radiation and immunotherapy, and moving on to the most promising cutting-edge therapies (gene therapy and nanomedicine). We offer an historical point of view that covers the arrival of these therapies to clinical practice and the market, and the promises and challenges they present.

3.
Am J Clin Oncol ; 31(4): 335-9, 2008 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-18845991

RESUMO

OBJECTIVES: The utility of many molecules as tumor markers in melanoma has been investigated with different results. The aims of this study was to compare the value of tyrosinase mRNA by reverse transcription polymerase chain reaction (RT-PCR) in peripheral blood and of serum S-100 protein in patients with melanoma at different stages of disease. METHODS: We have studied 90 peripheral blood samples corresponding to 90 patients that had been diagnosed with melanoma. The clinical staging at the time of blood sampling was performed according to the American Join Committee on Cancer guidelines. S-100 protein in serum was measured by enzyme-linked immunosorbent assay (normal range: 0-0.150 microg) and the presence of tyrosinase mRNA was assessed by RT-PCR. RESULTS: Median progression-free survival was 281 days for tyrosinase positive patients and it has not been reached for tyrosinase negative patients (P = 0.03). Median progression free survival was 213 days for patients with elevated serum S-100 and it has not been reached for patients with normal level of serum S-100 (P < 0.001). Median overall survival (OS) was 396 days for tyrosinase positive patients and it has not been reached for negative patients (P = 0.0096). Median OS was 282 days for patients with elevated serum S-100 and it has not been reached for patients with normal level of serum S-100 (P < 0.001). In a multivariate analysis, both markers have significant prognostic value for time to progression and for survival (chi(2) test). CONCLUSIONS: RT-PCR for tyrosinase mRNA and S-100 are significant prognostic factors for progression-free survival and OS in melanoma. S-100 has higher sensitivity and specificity than tyrosinase.


Assuntos
Biomarcadores Tumorais/metabolismo , Melanoma/metabolismo , Monofenol Mono-Oxigenase/metabolismo , Proteínas S100/metabolismo , Neoplasias Cutâneas/metabolismo , Adolescente , Adulto , Idoso , Idoso de 80 Anos ou mais , Criança , Pré-Escolar , Ensaio de Imunoadsorção Enzimática , Feminino , Humanos , Masculino , Melanoma/sangue , Melanoma/genética , Pessoa de Meia-Idade , Monofenol Mono-Oxigenase/genética , Estadiamento de Neoplasias , Valor Preditivo dos Testes , Prognóstico , Estudos Prospectivos , RNA Mensageiro/genética , RNA Mensageiro/metabolismo , RNA Neoplásico/genética , RNA Neoplásico/metabolismo , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Sensibilidade e Especificidade , Neoplasias Cutâneas/sangue , Neoplasias Cutâneas/genética , Taxa de Sobrevida
4.
Melanoma Res ; 17(2): 83-9, 2007 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-17496783

RESUMO

A need for factors predictive of prognosis is present in patients who are diagnosed with malignant melanoma. The detection of circulating melanoma cells by reverse transcriptase-polymerase chain reaction for tyrosinase mRNA is a possible negative prognostic factor. The aim of this study was to assess the prognostic value of reverse transcriptase-PCR for tyrosinase mRNA in peripheral blood samples. From January 2000 to February 2003, duplicate blood samples were drawn from 114 melanoma patients following surgery and informed consent, and were tested with reverse transcriptase-PCR, for tyrosinase mRNA. Outer primers for the first PCR were R1 (sense): TTGGCAGATTGTCTGTAGCC and R2 (antisense): AGGCATTGTGCATGCTGCT. For the second round of PCR, nested primers were R3 (sense): GTCTTTATGCAATGGAACGC and R4 (antisense): GCTATCCCAGTAAGTGGACT. Threshold for detection of the technique was determined by adding serially diluted MelJuSo cells to healthy volunteer blood samples. Overall, 91 (79.1%) patients tested negative for tyrosinase mRNA and 24 (20.9%) tested positive. The number of patients who tested positive by stage was 3/38 (7.9%) for stage I, 3/22 (13.6%) for stage II, 5/30 (16.7%) for stage III and 13/24 (54.2%) for stage IV (P< 0.0001). 11/90 (12.2%) patients with no evidence of disease (stage I, II and III) tested positive and 13/24 (54.2%) patients with clinically confirmed distant metastases (stage IV) tested positive (P<0.00001). With median follow-up of 372 days or to death (range: 0-1303 days), median progression-free survival has not been reached for tyrosinase-negative patients and was 265 days for tyrosinase-positive patients (P<0.00001, log-rank test=21.07). Median overall survival was 344 days for tyrosinase-positive patients and has not been reached for tyrosinase-negative patients (P=0.0001, log-rank test=21.38). Stage, Breslow thickness and result of RT-PCR were significant prognostic factors for disease-free survival in a multivariate analysis, and stage was the only significant prognostic factor for overall survival. In conclusion, detection of circulating melanoma cells by reverse transcriptase-PCR for tyrosinase mRNA is a significant adverse prognostic factor for disease-free survival in patients with malignant melanoma.


Assuntos
Regulação Neoplásica da Expressão Gênica , Melanoma/sangue , Melanoma/diagnóstico , Melanoma/patologia , Monofenol Mono-Oxigenase/sangue , Células Neoplásicas Circulantes , Neoplasias Cutâneas/sangue , Adulto , Idoso , Idoso de 80 Anos ou mais , Estudos de Casos e Controles , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Monofenol Mono-Oxigenase/biossíntese , Prognóstico , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Neoplasias Cutâneas/diagnóstico
6.
Clin Immunol ; 122(1): 28-40, 2007 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-16982214

RESUMO

The infiltration and accumulation of T cells in the rheumatoid arthritis (RA) synovial fluid (SF) are hallmarks of disease. We aimed to assess the functional relevance of FasL and of APO2L/TRAIL in the persistence of T cells in the rheumatoid SF. We have analyzed the expression of the activation markers HLA-DR and CD69 and also of the death receptor Fas/CD95 and death ligands FasL or APO2L/TRAIL in CD3+ lymphocytes from SF of 62 RA patients, together with their sensitivity to anti-Fas mAb or to rAPO2L/TRAIL, using as controls T lymphocytes present in SF of 20 patients with traumatic arthritis. T lymphocytes infiltrated in SF of RA patients have a chronically activated phenotype, but they are resistant to Fas-induced toxicity. However, they are more susceptible to rAPO2L/TRAIL than T cells in the SF of traumatic arthritis patients. In addition, we found very low amounts of bioactive FasL and APO2L/TRAIL associated with exosomes in SF from RA patients as compared with SF from traumatic arthritis patients. The observation on the sensitivity of RA SF T cells to rAPO2L could have therapeutic implications because bioactive APO2L/TRAIL could be beneficial as a RA treatment.


Assuntos
Artrite Reumatoide/imunologia , Líquido Sinovial/citologia , Linfócitos T/imunologia , Ligante Indutor de Apoptose Relacionado a TNF/imunologia , Antígenos CD/imunologia , Antígenos CD/metabolismo , Antígenos de Diferenciação de Linfócitos T/imunologia , Antígenos de Diferenciação de Linfócitos T/metabolismo , Complexo CD3/imunologia , Complexo CD3/metabolismo , Células Cultivadas , Proteína Ligante Fas/antagonistas & inibidores , Proteína Ligante Fas/imunologia , Proteína Ligante Fas/metabolismo , Feminino , Citometria de Fluxo , Antígenos HLA-DR/imunologia , Antígenos HLA-DR/metabolismo , Humanos , Células Jurkat , Lectinas Tipo C , Masculino , Pessoa de Meia-Idade , Fenótipo , Líquido Sinovial/imunologia , Linfócitos T/metabolismo , Ligante Indutor de Apoptose Relacionado a TNF/antagonistas & inibidores , Ligante Indutor de Apoptose Relacionado a TNF/metabolismo , Receptor fas/imunologia , Receptor fas/metabolismo
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...