Assessment of the properties of natural-based chiral deep eutectic solvents for chiral drug separation: insights from molecular dynamics simulation.

The structural and physicochemical properties of chiral deep eutectic solvents (DESs) consisting of racemic mixtures of menthol and acetic acid (DES1), racemic mixtures of menthol and lauric acid (DES2), and racemic mixtures of menthol and pyruvic acid (DES3) for enantioselective extraction processes are investigated. Structural results, such as the radial distribution function (RDF) and the combined distribution function (CDF), indicate that the hydroxyl hydrogen of menthol has a dominant interaction with the carbonyl oxygen of the acids in the considered DESs. The number of hydrogen bonds and non-bonded interaction energies formed between S-menthol and HBDs are larger than those with R-menthol, resulting in the self-diffusion coefficient of S-menthol being larger than that of R-menthol. Therefore, it can be said that the proposed DESs are good candidates for the separation of drugs with S chirality. The effects of acid type on the density and isothermal compressibility of DESs show the behaviour of DES2 > DES3 > DES1 and DES1 > DES3 > DES2, respectively. Our results provide a better perspective on new chiral DESs at the molecular level for enantioselective processes.

Quantum DFT methods to explore the interaction of 1-Adamantylamine with pristine, and P, As, Al, and Ga doped BN nanotubes.

Nanostructures, nowadays, found growing applications in different scientific and industrial areas. Nano-coins, nanosheets, and nanotubes are used in medical applications as sensors or drug delivery substances. The aim of this study is to explore the adsorption of 1-Adamantylamine drug on the pristine armchair boron nitride nanotubes (BNNTs) with BNNT(5,5), BNNT(6,6), and BNNT(7,7) chirality along with the P, As, Al and Ga-doped BNNTs, using the quantum mechanical density functional methods. Considering the fact that dispersion effects are important in the case of weak Van der Waals interactions, computations have been done using B3LYP hybrid functional with the implementation of the D3(BJ) empirical dispersion correction methods. Quantum theory of atoms in molecules, natural bonding orbitals, and Kohn-Sham orbitals were used to investigate the nature and type of the adsorption process. The results showed that, while the adsorption of 1-Adamantylamine on the outer surface of pristine BNNT is physical in nature, doping can improve the ability of detracted BN to adsorb the drug through chemical bonds. Also, it was found that, by increasing the radius of the BNNT the adsorption energy was decreased. In conclusion, results of the present work suggest that, Ga doped nanotube, due the chemisorption, is not an ideal nanotube in drug delivery of 1-Adamantylamine drug, whereas, the other studied cases physiosorbed the drug, and may not have serious problem in release of the 1-Adamantylamine drug.

The adsorption of NO2, SO2, and O3 molecules on the Al-doped stanene nanotube: a DFT study.

Adsorption of pollutant gas molecules (NO2, SO2, and O3) on the surface of the Al-doped stanene nanotube was investigated within the first principle calculations of density functional theory (DFT). Adsorption mechanisms were studied by analyzing optimized structures, band structures, projected density of states (PDOS), charge density difference (CDD), molecular orbitals, and band theory. Investigation of charge transfer by Mulliken population showed that NO2 accumulated while SO2 and O3 depleted charge density on the Al-doped nanotube. The differences in band structures before and after adsorption implied that the electronic characteristics of Al-doped nanotube changed dramatically in case of NO2 adsorption, which converted Al-doped nanotube to a semiconductor material. High adsorption energy and the significant overlap between PDOS spectra indicated that the adsorption process was chemisorption for NO2, SO2, and O3 on the doped nanotube with the obtained order of O3 > SO2 > NO2. The results showed that the adsorption of NO2, SO2, and O3 occurred on the Al-doped stanene nanotube, and that all the three gas molecules could be detected by Al-doped stanene nanotube with various detection strengths.

Molecular dynamics simulation study of gold nanosheet as drug delivery vehicles for anti-HIV-1 aptamers.

The adsorption process of three aptamers with gold nanosheet (GNS) as a drug carrier has been investigated with the help of molecular dynamics simulations. The sequencing of the considered aptamers are as (CUUCAUUGUAACUUCUCAUAAUUUCCCGAGGCUUUUACUUUCGGGGUCCU) and (CCGGGUCGUCCCCUACGGGGACUAAAGACUGUGUCCAACCGCCCUCGCCU) for AP1 and AP2, respectively. AP3 is a muted version of AP1 in which nucleotide positions 4, 6, 18, 28 and 39 have C4A, U6G, A18G, G28A, and U39C mutations. At positions 24, and 40, a deletion mutation is seen to eliminate U24 and U40 bases. These aptamers are inhibitors for HIV-1 protease and can be candidates as potential pharmaceutics for treatment of AIDS in the future. The interactions between considered aptamers and GNS have been analyzed in detail with help of structural and energetic properties. These analyses showed that all three aptamers could well adsorb on GNS. Overall, the final results show that the adsorption of AP2 on the GNS is more favorable than other considered ones and consequently GNS can be considered as a device in order to immobilize these aptamers.

Molecular dynamics simulations of choline chloride and phenyl propionic acid deep eutectic solvents: Investigation of structural and dynamics properties.

The prediction of deep eutectic composition is hard and so far, has been distinguished by trial and error. Therefore, in this work, molecular dynamics simulations were performed for specifying the composition of the eutectic point of phenyl propionic acid (Phpr) and choline chloride (ChCl) mixtures. The distinctive properties of the Phpr and ChCl eutectic mixture at the composition of the eutectic point were investigated and were compared to other eutectic mixtures with the different mole fractions of Phpr and ChCl. Structural properties such as radial distribution function (RDF), coordination number, hydrogen-bond number, interaction energies, and dipole moment of species, as well as dynamical properties such as mean square displacement (MSD), viscosity, and self-diffusion coefficient were analyzed. The obtained results of structural properties indicated that each chloride anion is surrounded by two Phpr molecules for deep eutectic point states that is in good agreement with available experimental reports. Moreover, the viscosity of studied mixtures evaluated by the Green-Kubo method was found to be consistent with the reported experimental data. Besides, the stress-autocorrelation function (SACF) and convergency of viscosity with time were calculated. Finally, the eutectic point could be detected by the changes in the trends of total van der Waals interaction energies and the viscosity.

CuN3 doped graphene as an active electrocatalyst for oxygen reduction reaction in fuel cells: A DFT study.

Based on first-principles DFT calculations, copper-nitrogen embedded graphene (CuN3-Gra) is introduced as an efficient electrocatalyst for oxygen reduction reaction (ORR) in fuel cells. The possible reaction mechanisms as well as the corresponding stationary points on potential energy surfaces are studied in acidic media. Our results indicate that dissociation of O2 over CuN3-Gra cannot occur at normal condition due to its large energy barrier. In contrast, the O2 hydrogenation into OOH, followed by the hydrogenation of OOH into O and H2O species is the most favorable pathway for the ORR process. The energy barrier for rate-determining step of this reaction is calculated to be 1.00 eV which is related to the formation of first H2O molecule. The free energy diagrams reveal that for OOH hydrogenation pathway, all of the elementary steps are exothermic at potentials 0.0-0.8 V.

The Interaction of Acrolein with Pristine and N-doped TiO2 Anatase Nanoparticles: A DFT Study.

Density functional theory calculations were carried out in order to study the effects of the adsorption of acrolein molecule on the structural and electronic properties of TiO2 anatase nanoparticles. The ability of pristine and N-doped TiO2 anatase nanoparticles to recognize toxic acrolein (C3H4O) molecule was surveyed in detail. It was concluded that acrolein molecule chemisorbs on the N-doped anatase nanoparticles with large adsorption energy and small distance with respect to the nanoparticle. The results indicate that the adsorption of acrolein on the N-doped TiO2 is energetically more favorable than the adsorption on the pristine one, suggesting that the N doping can energetically facilitate the adsorption of acrolein on the N-doped nanoparticle. It means that the N-doped TiO2 nanoparticle can react with acrolein molecule more efficiently. The interaction between acrolein molecule and N-doped TiO2 can induce substantial variations in the HOMO/LUMO molecular orbitals of the nanoparticle, changing its electrical conductivity which is helpful for developing novel sensor devices for the removal of harmful acrolein molecule. The large overlaps in the projected density of states spectra reveal the formation of chemical bond between two interacting atoms. Charge analysis based on Mulliken charges indicates that charge is transferred from the acrolein molecule to the TiO2 nanoparticle.

Study of thermodynamic properties of solution of ampicillin sodium in methanol at T = 298.15 k.

Osmotic coefficients of the solution of Ampicillin sodium in methanol at T = 298.15 K were measured using the isopiestic technique and head space-gas chromatography. The experimental osmotic coefficients have been correlated using the ion interaction model of Pitzer, e-NRTL model of Chen, NRF and a fourth- order polynomial in terms of molality. In this work, reference solution is NaI-CH(3)OH. The vapor pressures of the solutions and the solvent activities have been calculated from the osmotic coefficients. Reliability of the models in expression of the osmotic coefficients were compared on the basis of standard deviation of the fittings. The best fit of experimental osmotic coefficients data have been obtained by the Pitzer based ion interaction model.