Designing a TiO2-MoO3-BMIMBr nanocomposite by a solvohydrothermal method using an ionic liquid aqueous mixture: an ultra high sensitive acetaminophen sensor.

This study shows a simplistic, efficient procedure to synthesize TiO2-MoO3-BMIMBr nanocomposites. Powder X-ray diffraction, scanning electron microscopy, energy-dispersive X-ray spectroscopy, and X-ray photoelectron spectroscopy have all been used to completely analyse the materials. The detection of acetaminophen (AC) has been examined at a modified glassy carbon electrode with TiO2-MoO3-BMIMBr nanocomposites. Moreover, the electrochemical behavior of the nanocomposite modified electrode has been studied by cyclic voltammetry (CV), differential pulse voltammetry (DPV), chronoamperometry and electrochemical impedance spectroscopy (EIS). The linear response of AC was observed in the range 8.26-124.03 nM. The sensitivity and detection limits (S/N = 3) were found to be 1.16 µA L mol-1 cm-2 and 11.54 nM by CV and 24 µA L mol-1 cm-2 and 8.16 nM by DPV respectively.

Thermodynamics of Azo Dye Adsorption on a Newly Synthesized Titania-Doped Silica Aerogel by Cogelation: A Comparative Investigation with Silica Aerogels and Activated Charcoal.

The adsorption isotherms of azo dyes on a newly synthesized titania-doped silica (TdS) aerogel compared to silica aerogels and activated charcoal (AC) are systematically investigated. Monolithic TdS aerogels were synthesized by the cogelation process followed by supercritical drying of tetraethyl orthosilicate (TEOS) as a gel precursor and titanium(IV) isopropoxide (TTIP) as a metal complex precursor for co-polymerization in ethanol solvent. An acid-base catalyst was used for the hydrolysis and condensation of TEOS and TTIP. The effect of Ti4+ doping in a silica aerogel on the mesoporous structure and the adsorption capacity of methylene blue (MB) and crystal violet (CV) dyes were evaluated from the UV-vis absorption spectra. In order to compare the adsorption isotherms, the surface areas of silica and TdS aerogels were first normalized with respect to AC, as adsorption is a surface phenomenon. The azo dye equilibrium adsorption data were analyzed using different isotherm equations and found to follow the Langmuir adsorption isotherm. The maximum monolayer adsorption capacities for the adsorbent TdS aerogel normalized with the AC of the Langmuir isotherm are 131.58 and 159.89 mg/g for MB and CV dyes, respectively. From the Langmuir curve fitting, the Q max value of the TdS aerogel was found to increase by 1.22-fold compared to AC, while it increased 1.25-1.53-fold compared to the silica aerogel. After four cycles, regeneration efficiency values for MB and CV dyes are about 84 and 80%, respectively. The study demonstrates the excellent potential and recovery rate of silica and TdS aerogel adsorbents in removing dyes from wastewater. The pore volume and average pore size of the new aerogel, TdS, were found to be lower than those of the silica aerogel. Thus, a new TdS aerogel with a high capacity of adsorption of azo dyes is successfully achieved.

Synthesis of a Ag/rGO nanocomposite using Bos taurus indicus urine for nitroarene reduction and biological activity.

The present study develops a unique in situ synthesis of a catalytically and biologically active Ag/reduced graphene oxide (rGO) nanocomposite. Herein, we employed Bos taurus indicus urine to synthesize a Ag/rGO nanocomposite in an environmentally benign, facile, economical, and sustainable manner. The elemental composition analysis reveals the presence of Ag, O and C elements. The scanning electron micrograph shows the formation of spherical silver in nanoform whereas rGO is found to be flake shaped with a wrinkled nature. The synthesized nanomaterial and its composite shows a positive catalytic effect in simple organic transformation for the reduction of nitroarene compounds. Investigations were conducted into the catalytic effectiveness of the prepared nanomaterials for diverse nitroarene reduction. Then, using NaBH4 at 25 °C, the catalytic roles of Ag and the Ag/rGO nano-catalyst were assessed towards the catalytic reduction of several environmental pollutants such as 2-, 3- and 4-nitroaniline and 4-nitrophenol into their respective amino compounds. To test their catalytic performance, bio-mimetically synthesized Ag NPs were thermally treated at 200 °C and compared with the Ag/rGO nanocomposite. Furthermore, biomedical applications such as the antibacterial and antioxidant properties of the as-prepared nanomaterials were investigated in this study.

Bos taurus (A-2) urine assisted bioactive cobalt oxide anchored ZnO: a novel nanoscale approach.

In this study, a novel synthetic method for cobalt oxide (Co3O4) nanoparticles using Bos taurus (A-2) urine as a reducing agent was developed. In addition to this ZnO nanorods were produced hydrothermally and a nanocomposite is formed through a solid-state reaction. The synthesized materials were characterized through modern characterization techniques such as XRD, FE-SEM with EDS, DLS, zeta potential, FT-IR, Raman spectroscopic analysis, and TGA with DSC. The free radical destructive activity was determined using two different methods viz. ABTS and DPPH. The potential for BSA denaturation in vitro, which is measured in comparison to heat-induced denaturation of egg albumin and results in anti-inflammatory effects of nanomaterial was studied. All synthesized nanomaterials have excellent antibacterial properties, particularly against Salmonella typhi and Staphylococcus aureus. The composite exhibits excellent antioxidant and anti-inflammatory activities in comparison to pure nanomaterials. This reveals that these nanomaterials are advantageous in medicine and drug administration.

Sustainable approach to almond skin mediated synthesis of tunable selenium microstructures for coating cotton fabric to impart specific antibacterial activity.

Currently, the synthesis of nanostructured inorganic materials with tunable morphology is still a great challenge. In this study, almond skin extract was employed for the biogenic synthesis of selenium nanoparticles with tunable morphologies such as rods and brooms. The effects of various synthesis parameters on morphologies were investigated using UV-Visible spectroscopy and scanning electron microscopy (SEM) which indicated that selenium brooms (SeBrs) were best synthesized using almond skin extract and optimized conditions of SeO2, ascorbic acid, pH, incubation temperature and time. Based on these results, the mechanism of SeBrs synthesis is proposed as having involved four stages such as nucleation, self-assembly, Ostwald ripening, and decomposition. Further, the test of antibacterial activity together with minimum inhibitory concentrations and minimum bactericidal concentrations indicated the selective, specific and good activity against B. subtilis. In addition, in situ coating of SeBrs on cotton fabric and its investigation by SEM demonstrated successful coating. Evident from plate-based assay and study of growth kinetics, coated fabric exhibited excellent anti-B. subtilis activity which demonstrated that biogenic SeBrs can be employed to coat cotton fabrics that can be used in operation theatres to reduce the episodes of Bacillus related Bacteraemia.

Gold Nanoparticle as a Lewis Catalyst for Water Elimination of Tyrosine-•OH Adducts: A Radiation and Quantum Chemical Study.

The role of gold nanoparticles (AuNPs) in the degradation of tyrosine intermediates formed during the radiation-induced •OH reaction with tyrosine at pH 6.5 is investigated by measuring the radiolytic yields, G, of tyrosine (-Tyr), dityrosine (DT), and 3,4 dihydroxyphenylalanine (DOPA). The G(DT) is doubled, whereas G(-Tyr) calculated is halved in the presence of 6.0 × 10-10 mol dm-3 AuNPs. Pulse radiolysis studies are carried out to elucidate the mechanism and nature of the transient formed in the reaction of •OH and •N3 with tyrosine. The formation of tyrosyl radical in the presence of AuNPs is found to be a major pathway through the decay of tyrosine-•OH adducts via the water elimination reaction, which is found to be 3× faster in the presence of AuNPs. Quantum chemical calculations on the system showed favorable formation of the tyrosine-AuNP complex. A new plausible mechanism of tyrosine-AuNP complex acting as a Lewis type catalyst in the decay of tyrosine-•OH adducts leading to reduced DOPA formation is proposed. The proposed mechanism is also complemented by the electronic spectra and energetics of the reaction of •OH with tyrosine using density functional theory calculations. Significantly, the H-shift reaction of ortho-tyrosine-•OH adducts is also found to be energetically viable. The investigation provides a new physical insight into the effect of AuNPs on the decay of free-radical transient species and demonstrates the potential of radiation chemical techniques and quantum chemical calculations as a tool for understanding the impact of metal nanoparticles in free-radical oxidation of amino acids, which is important in the use of metal nanoparticles for biomedical applications.

Synthesis of Ni2+ ion doped ZnO-MWCNTs nanocomposites using an in situ sol-gel method: an ultra sensitive non-enzymatic uric acid sensing electrode material.

Nickel (Ni2+) ion doped zinc oxide-multi-wall carbon nanotubes (NZC) with different composition ratios of MWCNTs (from 0.01 to 0.1 wt%) are synthesized through an in situ sol-gel method. The synthesized NZC nanocomposites (NCs) are used as electrode materials with glassy carbon electrodes (GCEs) for electrochemical detection of uric acid (UA). The cyclic voltammogram of the representative NZC 0.1 modified GCE (NZC 0.1/GCE) revealed the highest electrochemical sensing activity towards the oxidation of UA at 0.37 V in 0.2 M phosphate buffer solution (PBS) having pH 7.4 ± 0.02. The limit of detection (LOD) and limit of quantification (LOQ) for the NZC 0.1/GCE are determined to be 5.72 nM and 19.00 nM (S/N = 3) respectively, which is the lowest compared to the literature values reported for enzymatic and non-enzymatic detection techniques. The synergistic effect of NZC 0.1 NCs is proposed as one of the factors for the enhanced electrochemical oxidation of UA complemented by the phase, lattice parameters, functional groups, morphology, elemental compositions, types of bonding and specific surface area with pore size ascertained using various techniques. The synthesized NZC 0.1 NCs are further proposed as selective electrode materials for the electrochemical detection of UA as authenticated further by performing interference tests with other metabolites such as ascorbic acid (AA), dopamine (DA) and d-glucose. The optimized electrochemical studies are further adopted for sensing of UA from human excretion samples using NZC 0.1 NCs.

Swollen liquid crystalline mesophase assisted synthesis of GO-PANI nanocomposite as a fluorescent probe for purines.

This article focuses on the use of graphene oxide-polyaniline (GO-PANI) nanocomposite as fluorescent probe for sensing of adenine (A) and guanine (G). Swollen liquid crystalline mesophase were used for the synthesis of graphene oxide-polyaniline nanocomposite. GO-PANI nanocomposite showed enhanced fluorescent at 441 nm (ƛ excitation = 361 nm) on interaction of purines viz A and G solutions in dimethyl sulfoxide, GO exhibited quenching at 540 nm (ƛ excitation = 261 nm). The fluorescence emission spectra of GO-PANI nanocomposite and GO were recorded in the the pressence of A and G concentrations upto 1.2 × 10-4 M. The limits of detection (LOD) calculated from the concentration dependence study for GO-PANI nanocomposite and GO are 7.5 × 10-6 M and 13.4 × 10-6 M respectively. The LOD in the case of GO is identical for both A (13.0 × 10-6) and G (13.6 × 10-6 M). The binding constant (Kb) determined for GO-PANI with purines are in the range of 0.05-0.08 × 103 M-1 which is higher in the case of GO (2.42-7.52 × 103 M-1). The lifetime measurement demonstrates, an excited state interaction of GO-PANI nanocomposite and GO with purines. This is evident from the increasing lifetime from 4.3 ns to 29.2 ns for GO-PANI nanocomposite, while 17.5 ns to 37.2 ns for GO respectively. The relatively short lifetime of the GO-PANI nanocomposite in comparison with GO suggest an electronic charge dissipation of the excited state between polyaniline and graphene oxide possibly due to the alignment of polyaniline on the graphene oxide sheet. The photopysical properties of GO-PANI nanocomposite and GO observed in this study is new and has potential for application as fluorescent probe for the detection of purines.

Identification and Validation of Reference Genes and Their Impact on Normalized Gene Expression Studies across Cultivated and Wild Cicer Species.

Quantitative Real-Time PCR (qPCR) is a preferred and reliable method for accurate quantification of gene expression to understand precise gene functions. A total of 25 candidate reference genes including traditional and new generation reference genes were selected and evaluated in a diverse set of chickpea samples. The samples used in this study included nine chickpea genotypes (Cicer spp.) comprising of cultivated and wild species, six abiotic stress treatments (drought, salinity, high vapor pressure deficit, abscisic acid, cold and heat shock), and five diverse tissues (leaf, root, flower, seedlings and seed). The geNorm, NormFinder and RefFinder algorithms used to identify stably expressed genes in four sample sets revealed stable expression of UCP and G6PD genes across genotypes, while TIP41 and CAC were highly stable under abiotic stress conditions. While PP2A and ABCT genes were ranked as best for different tissues, ABCT, UCP and CAC were most stable across all samples. This study demonstrated the usefulness of new generation reference genes for more accurate qPCR based gene expression quantification in cultivated as well as wild chickpea species. Validation of the best reference genes was carried out by studying their impact on normalization of aquaporin genes PIP1;4 and TIP3;1, in three contrasting chickpea genotypes under high vapor pressure deficit (VPD) treatment. The chickpea TIP3;1 gene got significantly up regulated under high VPD conditions with higher relative expression in the drought susceptible genotype, confirming the suitability of the selected reference genes for expression analysis. This is the first comprehensive study on the stability of the new generation reference genes for qPCR studies in chickpea across species, different tissues and abiotic stresses.

Biotechnological advances for combating Aspergillus flavus and aflatoxin contamination in crops.

Aflatoxins are toxic, carcinogenic, mutagenic, teratogenic and immunosuppressive byproducts of Aspergillus spp. that contaminate a wide range of crops such as maize, peanut, and cotton. Aflatoxin not only affects crop production but renders the produce unfit for consumption and harmful to human and livestock health, with stringent threshold limits of acceptability. In many crops, breeding for resistance is not a reliable option because of the limited availability of genotypes with durable resistance to Aspergillus. Understanding the fungal/crop/environment interactions involved in aflatoxin contamination is therefore essential in designing measures for its prevention and control. For a sustainable solution to aflatoxin contamination, research must be focused on identifying and improving knowledge of host-plant resistance factors to aflatoxin accumulation. Current advances in genetic transformation, proteomics, RNAi technology, and marker-assisted selection offer great potential in minimizing pre-harvest aflatoxin contamination in cultivated crop species. Moreover, developing effective phenotyping strategies for transgenic as well as precision breeding of resistance genes into commercial varieties is critical. While appropriate storage practices can generally minimize post-harvest aflatoxin contamination in crops, the use of biotechnology to interrupt the probability of pre-harvest infection and contamination has the potential to provide sustainable solution.

Isolation and functional characterization of a novel seed-specific promoter region from peanut.

The importance of using tissue-specific promoters in the genetic transformation of plants has been emphasized increasingly. Here, we report the isolation of a novel seed-specific promoter region from peanut and its validation in Arabidopsis and tobacco seeds. The reported promoter region referred to as groundnut seed promoter (GSP) confers seed-specific expression in heterologous systems, which include putative promoter regions of the peanut (Arachis hypogaea L.) gene 8A4R19G1. This region was isolated, sequenced, and characterized using gel shift assays. Tobacco transgenics obtained using binary vectors carrying uidA reporter gene driven by GSP and/or cauliflower mosaic virus 35S promoters were confirmed through polymerase chain reaction (PCR), RT-PCR, and computational analysis of motifs which revealed the presence of TATA, CAAT boxes, and ATG signals. This seed-specific promoter region successfully targeted the reporter uidA gene to seed tissues in both Arabidopsis and tobacco model systems, where its expression was confirmed by histochemical analysis of the transgenic seeds. This promoter region is routinely being used in the genetic engineering studies in legumes aimed at targeting novel transgenes to the seeds, especially those involved in micronutrient enhancement, fungal resistance, and molecular pharming.

Investigation into the catalytic activity of porous platinum nanostructures.

The catalytic activity of porous platinum nanostructures, viz. platinum nanonets (PtNNs) and platinum nanoballs (PtNBs), synthesized by radiolysis were studied using two model reactions (i) electron transfer reaction between hexacyanoferrate (III) and sodium thiosulfate and (ii) the reduction of p-nitrophenol by sodium borohydride to p-aminophenol. The kinetic investigations were carried out for the platinum nanostructure-catalyzed reactions at different temperatures. The pseudofirst-order rate constant for the electron transfer reaction between hexacyanoferrate (III) and sodium thiosulfate catalyzed by PtNNs and PtNBs at 293 K are (9.1 ± 0.7) × 10(-3) min(-1) and (16.9 ± 0.6) × 10(-3) min(-1), respectively. For the PtNN- and PtNB-catalyzed reduction of p-nitrophenol to p-aminophenol by sodium borohydride, the pseudofirst-order rate constant was (8.4 ± 0.3) × 10(-2) min(-1) and (12.6 ± 2.5) × 10(-2) min(-1), respectively. The accessible surface area of the PtNNs and PtNBs determined before the reaction are 99 and 110 m(2)/g, respectively. These nanostructures exhibit significantly higher catalytic activity, consistent with the largest accessible surface area reported so far for the solid platinum nanoparticles. The equilibrium of the reactants on the surface of the platinum nanostructures played an important role in the induction time (t0) observed in the reaction. A possible role of structural modifications of PtNBs catalyzed the reaction leading to change in the accessible surface area of PtNBs is being explored to explain the nonlinear behavior in the kinetic curve. The activation energy of the PtNN- and PtNB-catalyzed reduction of p-nitrophenol are 26 and 6.4 kJ/mol, respectively. These observations open up new challenges in the field of material science to design and synthesize platinum nanostructures which could withstand such reaction conditions.

Spectral characterization of guanine C4-OH adduct: a radiation and quantum chemical study.

The reaction of hydroxyl radical ((•)OH) with guanine was investigated under restricted pH condition (pH 4.6) using pulse radiolysis technique. The time-resolved optical transient absorption spectra showed two peaks centered at 300 and 330 nm at 4 µs after the pulse which exhibited different reactivity toward molecular oxygen (O(2)). The peak at 300 nm was found to be relatively more stable than the peak at 330 nm. The peak corresponding to 330 nm decayed within 20 µs having a first order rate constant 4-7 × 10(4) s(-1) and was pH dependent. On longer time scale, the species decayed by a bimolecular process. The presence of O(2) did not affect its decay rate constant. The (•)OH reacts with guanine at pH 4.6 with a diffusion-controlled second order rate constant of ≥1 × 10(10) mol(-1) dm(3) s(-1). The reaction of Br(2)(•-), O(2)(•-), and 2-hydroxy-2-propyl radical with guanine was also investigated to differentiate among the one-electron oxidized, one-electron reduced species of guanine and the guanine-OH adducts formed in the reaction of (•)OH at pH 4.6. On the basis of the spectral characteristics and reactivity toward O(2), two guanine-OH adduct species were identified (i) the C4-OH adduct species absorbing at 330 nm which has not been reported so far and (ii) the C8-OH adduct species absorbing at 300 nm in agreement with the known literature absorption features. Quantum chemical calculations using BHandHLYP with 6-31+G(d,p) basis set and excited state calculations using TDDFT for all possible transients complement the assignment of the observed spectral peak at 330 nm to the C4-OH adduct of guanine. Furthermore, steady state radiolysis revealed the formation of 8-hydroxy-guanine whose precursor is known to be the C8-OH adduct species.

Direct damage to the backbone of DNA oligomers is influenced by the OH moiety at strand ends, by the type of base, and by context.

Previous studies on high molecular weight DNA found that backbone damage, as monitored by free base release, is relatively independent of the type of base; i.e., the yields of all four bases were nearly equal. This could be due to a lack of influence of any given base over damage to its own deoxyribose or it could be a consequence of averaging out disparities due to each base sampling a wide range of base contexts. This study is aimed at distinguishing between these two possibilities. Transparent films, prepared from palindromic oligodeoxynucleotides of d(CTCTCGAGAG), d(CTCTCGAGAGp), d(pCTCTCGAGAGp), d(GAGAGCTCTC), d(ACGCGCGCGT), d(AACGCGCGCGTT), d(CTCTCTTAATAATTATAATTATTAAGAGAG), and d(CTCTCTTAATATTAAGAGAG), were used for this investigation. The DNA films, hydrated to approximately 2.5 waters per nucleotide, were irradiated at RT under air using X-rays generated by a tungsten tube, immediately dissolved in nuclease-free water, and stored at 277 K for 24 h, and then unaltered free base release was measured using HPLC. Yields of free base release were based on a target mass consisting of the DNA and one counterion+2.5 H2O/nucleotide. The yields of each base, G(C), G(G), G(T), and G(A) were determined for each of the above sequences. The observed yields lead to the following conclusions: (i) base release at the oligomer ends is favored over release at internal positions (called the end effect), (ii) phosphorylation of the OH moiety at the oligomer ends quenches the end effect, (iii) the magnitude of the end effect is influenced by the base at the end and the bases proximal to it, and (iv) the release of base is influenced by the base and its context.

Multiplicity of DNA single-strand breaks produced in pUC18 exposed to the direct effects of ionizing radiation.

The transition of plasmid DNA from a supercoiled to an open circle conformation, as detected by gel electrophoresis, affords an extraordinarily sensitive method for detecting single-strand breaks (SSBs), one measure of deoxyribose damage. To determine the yield of SSBs, G(ssb), by this method, it is commonly assumed that Poisson statistics apply such that, on average, one SSB occurs per supercoiled plasmid lost. For the direct effect, at a large enough plasmid size, this assumption may be invalid. In this report, the assumption that one SSB occurs per pUC18 plasmid (2686 bp) is tested by measuring free base release (fbr), which is also a measure of deoxyribose damage in films prepared under controlled relative humidity so as to produce known levels of DNA hydration. The level of DNA hydration, Gamma, is expressed in mol water/mol nucleotide. The yield of free base release, G(fbr), was measured by HPLC after exposure of the films to 70 kV X rays and subsequent dissolution in water. It is well known that damage in deoxyribose leads to SSBs and free base release. Based on known mechanisms, there exists a close correspondence between free base release and SSBs, i.e., G(fbr) congruent with G(ssb). Following this assumption, the SSB multiplicity, m(ssb), was determined, where m(ssb) was defined as the mean number of SSBs per supercoiled plasmid lost. The yield of lost supercoil was determined previously (S. Purkayastha et al., J. Phys. Chem. B 110, 26286-26291, 2006). We found that m(ssb) = 1.4 +/- 0.2 at Gamma = 2.5 and m(ssb) = 2.8 +/- 0.5 to 3.1 +/- 0.5 at Gamma = 22.5, indicating that the assumption of one SSB per lost supercoil is not likely to hold for a 2686-bp plasmid exposed to the direct effect. In addition, an increase in G(fbr), upon stepping from Gamma = 2.5 to Gamma = 22.5, was paralleled by an increase in the yield of trapped deoxyribose radicals, G(dRib)(fr), also measured previously. As a consequence, the shortfall between SSBs and trapped radicals, G(diff) = G(ssb) - G(dRib)(fr), remained relatively constant at 90-110 nmol/J. The lack of change between the two extremes of hydration is in keeping with the suggestion that non-radical species, such as doubly oxidized deoxyribose, are responsible for the shortfall.

Chickpea (Cicer arietinum L.).

Chickpea is one of the most important leguminous, cool-season, food crops, cultivated prevalently in the Asian Pacific region. In spite of its nutritional importance, its area of cultivation has been low, with virtually no increase. Conventional breeding has resulted in several important improvements in this crop, and recent advances in biotechnology such as plant tissue culture and genetic transformation can significantly contribute to better sustainability of this important food crop. Here, we describe an efficient Agrobacterium-mediated transformation protocol for chickpea using axillary meristem explants, which results in a high frequency of genetic transformation (70%) and recovery of valuable transgenic plants. The protocol is significant owing to its high reproducibility and recovery of the transgenics in a relatively short period (90-100 days).

Peanut (Arachis hypogaea L.).

Arachis hypogea (peanut, groundnut), an annual oil seed belonging to the Leguminosae family and the Papillionacea subfamily, is a legume native to South America but now grown in diverse environments in six continents between latitudes 40 degrees N and 40 degrees S. Arachis hypogea can grow in a wide range of climatic conditions. The low yields of this crop are mainly attributed to unreliable rainfall patterns with frequent droughts, lack of high-yielding adapted cultivars, damage by diseases and pests, poor agronomic practices, and limited use of inputs. Genetic engineering approaches have been shown to be comparatively fast, leading to better isolation and cloning of desired traits for combating the various biotic and abiotic stresses. This chapter describes an Agrobacterium-mediated transformation protocol in peanut using the cotyledon system. The system described here is potentially applicable to a vast range of genotypes with a high transformation frequency of >70% based on the preliminary molecular data, indicating the production of a large number of independently transformed transgenic plants. The method reported here provides opportunities for crop improvement of this important legume crop via genetic transformation.

Pigeonpea (Cajanus cajan L. Millsp.).

Pigeonpea [Cajanus cajan (L.) Millsp.], also known as redgram, is one of the major grain legume (pulses) crops grown in the semiarid tropics (SAT) extending between 30 degrees N and 30 degrees S; it is the second most important food legume of India. It is cultivated in about 50 countries of Asia, Africa, and the Americas for a variety of uses (food, fodder, fuel wood, rearing lac insects, hedges, wind breaks, soil conservation, green manure, roofing, and so on). The constraints of enhancing its productivity include the damage caused by various fungi, bacteria, viruses, and insect pests. Conventional plant breeding methods have not been successful for the improvement of pigeonpea because of genetic variation and incompatibility among the wild varieties. Genetic engineering technology can therefore be used as an additional tool for the introduction of agronomically useful traits into established varieties. The development of plant transformation techniques has been a major breakthrough in overcoming constraints to achieve precision in genetic manipulation. The development of efficient plant regeneration protocols is a prerequisite for recombinant technology to carry out genetic transformation. This chapter describes an Agrobacterium-mediated transformation protocol for pigeonpea, a simple, efficient, and reproducible method that is applicable across diverse genotypes of pigeonpea.