RESUMO
AIM: To investigate the genetic and clinical characteristics of patients with a large heterozygous copy number deletion on 7q31.31-7q31.32. METHODS: A family with familial exudative vitreoretinopathy (FEVR) phenotype was included in the study. Whole-exome sequencing (WES) was initially used to locate copy number variations (CNVs) on 7q31.31-31.32, but failed to detect the precise breakpoint. The long-read sequencing, Oxford Nanopore sequencing Technology (ONT) was used to get the accurate breakpoint which is verified by quantitative real-time polymerase chain reaction (QPCR) and Sanger Sequencing. RESULTS: The proband, along with her father and younger brother, were found to have a heterozygous 4.5 Mb CNV deletion located on 7q31.31-31.32, which included the FEVR-related gene TSPAN12. The specific deletion was confirmed as del(7)(q31.31q31.32)chr7:g.119451239_123956818del. The proband exhibited a phase 2A FEVR phenotype, characterized by a falciform retinal fold, macular dragging, and peripheral neovascularization with leaking of fluorescence. These symptoms led to a significant decrease in visual acuity in both eyes. On the other hand, the affected father and younger brother showed a milder phenotype. CONCLUSION: The heterozygous CNV deletion located on 7q31.31-7q31.32 is associated with the FEVR phenotype. The use of long-read sequencing techniques is essential for accurate molecular diagnosis of genetic disorders.
RESUMO
OBJECTIVE: The aim of this study was to investigate the molecular mechanism by which the transcription factor ETS1 regulates N-myc downstream regulatory gene 1 (NDRG1) to provide a new theoretical basis for the study of oral squamous cell carcinoma (OSCC). METHODS: In this study, eight human OSCC and paraneoplastic samples were collected. The expressions of NDRG1, ETS1, and Ki67 were detected by immunohistochemistry; apoptosis was detected by tdt-mediated dUTP notched end labeling; cell migration and invasion were detected by Transwell; quantitative real-time PCR was performed to detect the expression of NDRG1; RNA-binding protein immunoprecipitation (RIP) assays detected NDRG1 expression; immunofluorescence assays detected ETS1 expression. RESULTS: NDRG1 and ETS1 expression was significantly upregulated in cancer tissues and CAL-27 and SCC-6 cells. Knockdown of NDRG1 and ETS1 inhibited cell proliferation, migration, invasion, cloning, and EMT while promoting apoptosis and inhibited tumor development; ETS1 positively regulated NDRG1 expression; Finally, overexpression of NDRG1 in vivo and in vitro reversed the effect of ETS1 knockdown on CAL-27 and SCC-6 cells. CONCLUSIONS: ETS1 positively regulates the expression of NDRG1 and promotes OSCC. Therefore, ETS1 may serve as a new target for the clinical diagnosis and treatment of OSCC.
RESUMO
Purpose: The study aims to identify genetic variants in five Chinese families with Keratoconus (KC) and describe the characteristics of parental corneal topography. Methods: Fifteen participants, including five probands and ten parents from five Chinese families with KC, were recruited for genetic and clinical analyses. Targeted next-generation sequencing using a custom-designed panel for KC was applied on the probands for variant identification. Sanger sequencing and cosegregation analysis of the suspected pathogenic variants were performed on the family members. The pathogenicities of variants were evaluated according to the American College of Medical Genetics and Genomics guidelines (ACMG). Pentacam 3D anterior segment analysis system was applied for keratectasia detection and the Corvis ST for corneal biomechanics measurement. Fifteen parameters were recorded, including nine keratectasia indicators (BAD-D, TP, Kmax, Df, Db, Dp, Dt, Da, ARTH), six corneal biomechanical indicators (CBI, DA ratio, SP-A1, IR, bIOP, TBI). Results: A total of six novel variants, including five missense variants and one frameshift variant, were detected in the HMX1, SLC4A11, TGFBI, PIKFYVE, and ZEB1 genes in five probands, all of which showed co-segregation of genotype and clinical phenotype and were determined to be pathogenic. The genetic model was autosomal dominant (AD) in four families and autosomal recessive (AR) in 1 family. The analysis of keratectasia and corneal biomechanical indicators of the proband's parents (first-generation relatives) in AD families revealed that there were several abnormal indexes in BAD-D, TP, Kmax, Df, Db, Dp, Dt, Da, CBI, DA ratio, SP-A1, IR, bIOP and TBI test indexes, showing clinical characteristics of incipient KC. Conclusion: Our study shows that variants in HMX1, SLC4A11, TGFBI, PIKFYVE, and ZEB1 were associated with KC. Our study extends the gene spectrum associated with KC, provides novel insights into KC phenotypic assessments, and contributes to early diagnosis for these patients.
RESUMO
PURPOSE: Alström Syndrome (AS) is an autosomal recessive hereditary disease with the characteristics of multiorgan dysfunction. Due to the heterogeneity of clinical manifestations of AS, genetic testing is crucial for the diagnosis of AS. Herein, we used whole-exome sequencing (WES) to determine the genetic causes and characterize the clinical features of three affected patients in two Chinese families with Alström Syndrome. MATERIALS AND METHODS: Three affected patients (initially diagnosed as achromatopsia). and five asymptomatic members were recruited for both genetic and clinical tests. The complete ophthalmic examinations and systemic examinations were performed on all participants. Whole exome sequencing (WES) was performed for mutation detection. The silico analysis was also applied to predict the pathogenesis of identified pathogenic variants. RESULTS: In family 1, the proband showed low vision, hyperopia, photophobia, nystagmus, and total color blindness. DNA analysis revealed that she carried a compound heterozygote with two novel pathogenic variants in the ALMS1 gene NM_015120.4:c.10379del (NP_055935.4:p.(Asp2252Tyr)) and NM_015120.4:c.11641_11642del (NP_055935.4:p.(Val3881ThrfsTer11)). Further systemic examinations showed short stature, acanthosis nigricans, and sensorineural hearing loss. In family 2, two affected siblings presented the low vision, hyperopia, photophobia, nystagmus, and total color blindness. DNA analysis revealed that they carried a same compound heterozygote with two novel pathogenic variants in the ALMS1 gene NM_015120.4:c.10379del (NP_055935.4:p.(Asn3460IlefsTer49)), NM_015120.4:c.10819C > T (NP_055935.4:p.(Arg3607Trp)). Further systemic examinations showed obesity and mild abnormalities of lipid metabolism. According to the genetic testing results and further systemic analysis, the three affected patients were finally diagnosed as Alström Syndrome (AS). CONCLUSIONS: We found two new compound heterozygous pathogenic variants of the ALMS1 gene and determined the diagnosis as Alström Syndrome in three patients of two Chinese families. Our study extends the genotypic and phenotypic spectrums for ALMS1 -AS and emphasizes the importance of gene testing in assisting the clinical diagnosis for cases with phenotypic diversities, which would help the AS patients with early diagnosis and treatment to reduce future systemic damage.
Assuntos
Síndrome de Alstrom , Hiperopia , Baixa Visão , Síndrome de Alstrom/diagnóstico , Síndrome de Alstrom/genética , Proteínas de Ciclo Celular/genética , China , Defeitos da Visão Cromática , DNA/genética , Feminino , Humanos , Mutação , Linhagem , FotofobiaRESUMO
BACKGROUND: This study aims to screen and identify the biological functions and prognostic value of CXC chemokines in ovarian cancer (OC) through bioinformatics and molecular biology methods, and to provide data support for the selection of biomarkers and prognostic analysis of OC. METHODS: In this study, GEO, ONCOMINE, GEPIA, cBioPortal, GeneMANIA, Metascape, STRING, TRRUST, and TIMER databases were used to study CXC chemokines. Angiogenesis and T cell killing assay were used to detect the effect of CXCL10 on tumor cell immunity and angiogenesis. Real-time quantitative PCR (qRT-PCR), immunoblotting, and ectopic tumor formation experiments were used to verify the effect of CXCL10 on ovarian cancer tumors. RESULTS: We found that CXCL1, CXCL10, CXCL11, CXCL13, and CXCL14 were significantly upregulated in OC samples compared with normal tissues. Our data showed that there was a relationship between the expression of CXC chemokines and the infiltration of six types of immune cells significant correlation. In vitro assay confirmed that overexpression of CXCL10 could enhance the killing effect of T cells and inhibit angiogenesis. Further in vivo assay had shown that CXCL10 could affect the progression of ovarian cancer by increasing the expression of cytotoxic T cells and inhibiting angiogenesis. CONCLUSION: In conclusion, we hope that our data will provide new insights into the development of immunotherapy and the selection of prognostic markers for patients with OC.
Assuntos
Detecção Precoce de Câncer , Neoplasias Ovarianas , Carcinoma Epitelial do Ovário , Quimiocina CXCL10 , Quimiocinas CXC/genética , Feminino , Humanos , Prognóstico , Microambiente TumoralRESUMO
AIM: To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES). METHODS: Thirteen patients with BPES and eight healthy family members were included in this study. All participants received routine ophthalmic examinations. The target next-generation sequencing (NGS) was performed to determine the causative mutation for this family. The silico analysis was also applied to predict the pathogenesis of identified mutations. RESULTS: All patients had severe ptosis, normal intelligence, female patients have normal fertility. Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene, c.672_701insGCGGCTGCCGC CGCAGCTGCTG CAGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA), carried by 13 patient but absent in all unaffected members. In silico analysis supported the pathogenic nature of this highly conserved variant. This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain, which increased the number of original polyalanine chains from 14 to 24, resulting in an extended protein. CONCLUSION: A novel FOXL2 mutation c.672_701ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA) was identified in a large Chinese family with BPES. This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotype correlations, which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.
RESUMO
PURPOSE: The purpose of the study is to describe the genetic and clinical features of 17 patients with ABCA4-related inherited retinal degenerations (IRDs) and define the phenotype-genotype correlations. METHODS: In this multicenter retrospective study, 17 patients from 16 families were enrolled, and ABCA4 gene variants were detected using targeted next-generation sequencing using a custom designed panel for IRDs. Sanger sequencing and co-segregation analysis of the suspected pathogenic variants were performed with the family members. The pathogenicities of variants were evaluated according to the American College of Medical Genetics and Genomics guidelines (ACMG). Protein structure modifications mediated by the variants were studied using bioinformatic analyses. RESULTS: The probands were diagnosed with Stargardt disease 1 (7), cone-rod dystrophy type 3 (8), cone dystrophy (1), and retinitis pigmentosa 19 (1). Onset of symptoms occurred between 5 and 27 years of age (median age = 12.4 years). A total of 30 unique ABCA4 suspicious pathogenic variations were observed, including 18 missense mutations, seven frameshift mutations, two nonsense mutations, one canonical splice site mutation, one small in-frame deletion, and one insertion. Four novel ABCA4 variants were identified. Two novel frameshift variants, c.1290dupC (p.W431fs), and c.2967dupT (G990fs), were determined to be pathogenic. A novel missense variant c.G5761T (p.V1921L) was likely pathogenic, and another novel missense c.C170G (p.P57R) variant was of undetermined significance. All ABCA4 variants tested in this study inordinately changed the physico-chemical parameters and structure of protein based on in silico analysis. CONCLUSION: ABCA4-related IRD is genetically and clinically highly heterogeneous. Four novel ABCA4 variants were identified. This study will expand the spectrum of disease-causing variants in ABCA4, which will further facilitate genetic counseling.
RESUMO
Neonatal hypoxia/ischemia (H/I), injures white matter, results in neuronal loss, disturbs myelin formation, and neural network development. Neuroinflammation and oxidative stress have been reported in neonatal hypoxic brain injuries. We investigated whether Paeoniflorin treatment reduced H/I-induced inflammation and oxidative stress and improved white matter integrity in a neonatal rodent model. Seven-day old Sprague-Dawley pups were exposed to H/I. Paeoniflorin (6.25, 12.5, or 25 mg/kg body weight) was administered every day via oral gavage from postpartum day 3 (P3) to P14, and an hour before induction of H/I. Pups were sacrificed 24 h (P8) and 72 h (P10) following H/I. Paeoniflorin reduced the apoptosis of neurons and attenuated cerebral infarct volume. Elevated expression of cleaved caspase-3 and Bad were regulated. Paeoniflorin decreased oxidative stress by lowering levels of malondialdehyde and reactive oxygen species generation and while, and it enhanced glutathione content. Microglial activation and the TLR4/NF-κB signaling were significantly down-regulated. The degree of inflammatory mediators (interleukin 1ß and tumor necrosis factor-α) were reduced. Paeoniflorin markedly prevented white matter injury via improving expression of myelin binding protein and increasing O1-positive olidgodendrocyte and O4-positive oligodendrocyte counts. The present investigation demonstrates the potent protective efficiency of paeoniflorin supplementation against H/I-induced brain injury by effectually preventing neuronal loss, microglial activation, and white matter injury via reducing oxidative stress and inflammatory pathways.
RESUMO
Naringenin is highly potent dietary phenolic compound (Flavonoids) found as a major bioactive in citrus fruits. The low solubility of Naringenin, decreases its availability at the site of action by hindering solubility and transportation across the biological membrane. Naringenin loaded nanoparticles enhance the solubility and drug availability at site of action. Naringenin solid lipid nanoparticles were prepared by emulsification and homogenization method using GMO (glycerylmonooleate) and TPGS (Tocopheryl polyethylene glycol succinate) as co-stabilizer. Physico-chemical characterization confirmed the particles were of nanometer size, smooth and spherical morphology. The FTIR and DSC studies conforms that drug and polymers are compatible. The in-vitro study shows prolong and sustained release of Naringenin upto 90 Hrs. In-vivo studies conforms the prolonged and efficient treatment of Hepatic fibrosis. The liver enzymes and pro inflammatory cytokines in blood got significantly reversed with the rats exposed to Naringenin nanoparticle indicating reduced liver damage and fibrosis. Nanoformulation enhances the bioavailability of Naringenin and liver specific delivery of the same, which up-regulates MMP-2 hepatic proteins resulting in reduced liver fibrosis.
Assuntos
Portadores de Fármacos/química , Flavanonas/química , Flavanonas/farmacologia , Cirrose Hepática/tratamento farmacológico , Nanopartículas Multifuncionais/química , Administração Oral , Animais , Disponibilidade Biológica , Flavanonas/farmacocinética , Flavanonas/uso terapêutico , Masculino , Polietilenoglicóis/química , Ratos , SolubilidadeRESUMO
AIM: To identify mutations with whole exome sequencing (WES) in a Chinese X-linked retinitis pigmentosa (XLRP) family. METHODS: Patients received the comprehensive ophthalmic evaluation. Genomic DNA was extracted from peripheral blood and subjected to SureSelect Human All Exon 6+ UTR exon capture kit. The exons were sequenced as 100 base paired reads on Illumina HiSeq2500 system. Only mutations that resulted in a change in amino acid sequence were selected. A pattern of inheritance of the RP family was aligned to identified causal mutation. RESULTS: We analysed the data of WES information from XLRP family. The analysis revealed a hemizygous large genomic deletion of RPGR c.29_113del was responsible for this XLRP. The gross deletion lead to a frame-shift mutation and generate stop codon at 7 animo acid behind Asp (D10Afs*7), which would serious truncate RPGR protein. The novel frame-shift mutation was found to segregate with retinitis pigmentosa (RP) phenotype in this family. Bilateral myopia was present on the male patients, but carrier female showed unilateral myopia without RP. CONCLUSION: Our study identifies a novel frame-shift mutation of RPGR in a Chinese family, which would expand the spectrum of RPGR mutations. The geno-phenotypic analysis reveals a correlation between RP and myopia. Although exact mechanism of RP related myopia is still unknown, but the novel frame-shift mutation will give our hit on studying the molecular pathogenesis of RP and myopia.
RESUMO
BACKGROUND: There are growing number of researches have shown that mesoderm posterior basic helix-loop helix (BHLH) transcription factor 1 (MESP1) plays a crucial role in the development of tumors. However, its expression pattern and function in non-small cell lung cancer (NSCLC) are still unknown. METHODS: MESP1 expression and biological process were investigated in NSCLC based on bioinformatics analysis. The mRNA or protein expression levels of MESP1 were measured by quantitative real-time PCR (qRT-PCR) and western blot (WB) assay in NSCLC cells and clinical tissue samples. Then, we used small interfering RNA (siRNA) interference to knocking down expression of gene in NSCLC cells. Cell proliferation was performed using cell counting kit-8 (CCK-8), colony forming assay and real-time cell analyzer (RTCA); transwell chambers and RTCA were used to analysis cell migration and invasion. Besides, analyses of the cell cycle progression and apoptosis were measured via BD JAZZ flow cytometric analysis. All the experiments were repeated ≥3 times. And analyses were performed using SPSS software version 21.0 and GraphPad Prism 6.0. P<0.05 was considered statistically significant. RESULTS: Detection of MESP1 showed that mRNA was up-regulated in NSCLC cells and patients compared with the normal controls (P<0.05). And high expression of MESP1 were correlated with increasingly cell proliferation, metastasis, cycle and apoptosis. Besides, through WB experiments, it was found that knocking down MESP1 mainly activated the caspase-3/PARP1 signal pathway. Furthermore, it was also verified from clinical samples that MESP1 was highly expressed on both mRNA and protein aspect. CONCLUSIONS: Our study suggested that MESP1 is indeed highly expressed in NSCLC, and MESP1 high expression obviously promote cell proliferation, migration, invasion. What's more, it has good sensitivity to the occurrence and development of NSCLC patients. This can be used as a novel potential therapeutic target for NSCLC.
RESUMO
X-ray photoelectron spectroscopy, reflection-absorption infrared spectroscopy, and temperature-programmed reaction/desorption have been employed to investigate the adsorption and reaction pathways of CH2=CHCOOH and CH3CHFCOOH on Cu(100) and oxygen-precovered Cu(100) [O/Cu(100)]. In the case of CH2=CHCOOH on O/Cu(100), CH2=CHCOO is the surface intermediate detected between 110 K and 400 K. CH2=CHCOO is adsorbed vertically and can change adsorption sites at a higher temperature. The propenoate (acrylate) decomposes at higher temperatures (>500 K), with formation of >C=C=O (ketenylidene) surface species and gaseous products. On Cu(100), CH2=CHCOOH is adsorbed in dimer form and can dissociate to generate CH2=CHCOO and CH3CHCOO intermediates on the surface. The CH3CHCOO continuously recombines with the H from deprotonation of CH2=CHCOOH, resulting in the formation CH3CH2COO. The co-existing CH2=CHCOO and CH3CH2COO further decompose at â¼550 K to evolve reaction products, but without >C=C=O being detected. On O/Cu(100), CH3CHFCOOH readily deprotonates to form CH3CHFCOO at 120 K. This intermediate reacts on the surface at â¼460 K to evolve gaseous products, also producing CH2=CHCOO. In the case of Cu(100), deprotonation of CH3CHFCOOH occurs at â¼250 K, forming CH3CHFCOO. Without oxygen on the surface, this intermediate decomposes into HF and CH2=CHCOO at â¼455 K.
RESUMO
OBJECTIVE: The accuracy of the occlusion vertical dimensions of edentulous Han patients from Yunnan province was compared and analyzed on the basis of cone-beam computed tomography (CBCT)-synthesized cephalograms, closest speaking space method, and interocclusal distance. METHODS: A database correlating the CBCT head lateral images of Han patients from Yunnan province with normal occlusal conditions was first constructed. Then, five edentulous Han patients aged 63-78 years old from Yunnan Province were selected. NNT.View software was used to measure and analyze hard tissue cephalometric radiographs that had been transformed by the CBCT marker. The radiographs were then combined with the normal population database for the assessment of occlusion vertical dimensions. The occlusion vertical dimensions determined on the basis of CBCT-synthesized cephalograms, the closest speaking space method, and the free-way space were analyzed. RESULTS: The closest speaking space method was used as the standard control group, the differences between seven methods and the closest speaking space method were analyzed. The seven methods include free-way space method and six CBCT-synthesized cephalograms methods (N-ANS/ANS-Me, S-Go/N-Me, ANS-Gn/N-ANS, ANS-FH/Me-FH, ANS-Xi-Pm, and CA/LA). The seven methods were highly consistent with the closest speaking space method (intraclass correlation coefficient>0.986). The absolute values of the differences between the methods of free-way space, N-ANS/ANS-Me, S-Go/N-Me and the closest speaking space method were lower than those of the other four groups (P<0.05), while the differences between ANS-FH/Me-FH and the closest speaking space method was higher than those other groups (P<0.05). CONCLUSIONS: CBCT-synthesized cephalograms, with the exception of ANS-FH/Me-FH, can provide references for the clinical evaluation of the occlusion vertical dimensions of patients with edentulous jaws.
Assuntos
Tomografia Computadorizada de Feixe Cônico , Boca Edêntula , Idoso , Cefalometria , China , Humanos , Imageamento Tridimensional , Pessoa de Meia-Idade , Dimensão VerticalRESUMO
The aim of this study was to evaluate the oral health among the elderly in Southwest China and to analyze the correlation between common oral diseases and quality of life (QOL) in the same population, thus providing recommendations to improve their oral health and life quality.Elderly people (>60 years' old) were randomly recruited into our study, and we performed oral health examinations and diagnoses, using the Community Periodontal Index (CPI) to assess the periodontal condition, and Oral Health Impact Profile-14 (OHIP-14) to score life quality associated with oral health. Then we analyzed correlations between oral health and QOL as well as body mass index (BMI).A total of 687 subjects participated in our study and 212 (30.9%) were diagnosed with gingivitis or subgingival calculus, 291 (42.4%) with moderate chronic periodontitis, 136 (19.8%) with severe chronic periodontitis, 514 (74.8%) with dental caries, and 648 (94.3%) with dentition defects. A total of 653 (95.1%) qualified OHIP-14 scores were collected, with a median score of 13. The scores of the severe and moderate periodontitis were similar to the dentition defects, but higher than the scores for gingivitis and subgingival calculus. Considering the most common side effect, 11% of the subjects with severe chronic periodontitis were reported to be "unsatisfied with eating," and 48.4% of the participants with dentition defects complained about "troubles with pronunciation." A logistic regression analysis revealed that underweight (BMI <20) correlated with dental caries (odds ratio [OR]: 0.167, Pâ=â.040) and dentition defects (OR: 0.119, Pâ=â.016).The general oral health condition was poor among the elderly in Southwest China. Periodontitis and dentition defects have considerable negative effects on the QOL among this population.
Assuntos
Doenças da Boca/epidemiologia , Saúde Bucal/estatística & dados numéricos , Qualidade de Vida , Idoso , Idoso de 80 Anos ou mais , Índice de Massa Corporal , China/epidemiologia , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Índice Periodontal , Fatores de Risco , Inquéritos e QuestionáriosRESUMO
Enzymes from various natural resources are valuable in management of thrombosis. Blood-sucking arthropods are one of these resources because they have a wide array of anti-hemostasis molecules in their salivary gland. However, it is difficult to purify enough protein samples from the salivary glands for pharmacological studies. In this work, a fibrinogenolytic enzyme (tablysin 2) identified from salivary glands of the horsefly Tabanus yao was expressed in Escherichia coli to further study its biological activities. The primary structure of tablysin 2 showed significant domain similarity to arthropod proteins from the antigen 5 family containing SCP domain, whose biological functions are poorly understood. Tablysin 2 cleaved the Aα and part of Bß chains of fibrinogen and did not affect γ chain and fibrin. It inhibited platelet aggregation induced by ADP. It did not directly induce hemorrhage or activate plasminogen. The fibrinogenolytic activity of tablysin 2 provides a clue for the functions of antigen 5-related proteins in other haematophagous arthropods. This work demonstrate a method of expression of arthropod salivary proteins which are difficult to obtain from natural resources for further functional studies.
Assuntos
Dípteros/genética , Fibrinolíticos , Glândulas Salivares , Animais , Dípteros/enzimologia , Fibrinolíticos/química , Fibrinolíticos/isolamento & purificação , Fibrinolíticos/metabolismo , Humanos , Proteínas de Insetos/biossíntese , Proteínas de Insetos/química , Proteínas de Insetos/genética , Proteínas de Insetos/isolamento & purificação , Proteínas Recombinantes , Proteínas e Peptídeos Salivares/biossíntese , Proteínas e Peptídeos Salivares/genética , Proteínas e Peptídeos Salivares/isolamento & purificaçãoRESUMO
@#It is the key step of the occlusal reconstruction to determine the correct occlusal vertical dimension for edentulous patients. Although there are several methods in clinical practice, there is no ideal way. This paper summarizes the following methods: inter-occlusal distance, closest speaking space method, pre-extraction record, face proportion division method and facial appearance observation, cephalometric analysis, electromyography, swallowing, bite force determination and self feeling method. In this paper, the current research status and the feasibility of each method are discussed.
RESUMO
AIM: To describe the clinical characteristics with genetic lesions in a Chinese family with Crouzon syndrome. METHODS: All five patients from this family were included and received comprehensive ophthalmic and systemic examinations. Direct sequencing of the FGFR2 gene was employed for mutation identification. Crystal structure analysis was applied to analyze the structural changes associated with the substitution. RESULTS: All patients presented typical Crouzon features, including short stature, craniosynostosis, mandibular prognathism, shallow orbits with proptosis, and exotropia. Intrafamilial phenotypic diversities were observed. Atrophic optic nerves were exclusively detected in the proband and her son. Cranial magnetic resonance imaging (MRI) implied a cystic lesion in her sellar and third ventricular regions. A missense mutation, FGFR2 p.Cys342Trp, was found as disease causative. This substitution would generate conformational changes in the extracellular Ig-III domain of the FGFR-2 protein, thus altering its physical and biological properties. CONCLUSION: We describe the clinical presentations and genotypic lesions in a Chinese family with Crouzon syndrome. The intrafamilial phenotypic varieties in this family suggest that other genetic modifiers may also play a role in the pathogenesis of Crouzon syndrome.
RESUMO
Thermal atomic layer deposition (ALD)-grown AlN passivation layer is applied on AlGaN/GaN-on-Si HEMT, and the impacts on drive current and leakage current are investigated. The thermal ALD-grown 30-nm amorphous AlN results in a suppressed off-state leakage; however, its drive current is unchanged. It was also observed by nano-beam diffraction method that thermal ALD-amorphous AlN layer barely enhanced the polarization. On the other hand, the plasma-enhanced chemical vapor deposition (PECVD)-deposited SiN layer enhanced the polarization and resulted in an improved drive current. The capacitance-voltage (C-V) measurement also indicates that thermal ALD passivation results in a better interface quality compared with the SiN passivation.
RESUMO
PURPOSE: To determine the prevalence and associations of pterygium in a multiethnic adult population in rural China and to examine potential ethnic differences Methods: A total of 6418 adults (2133 ethnic Bai, 2130 ethnic Yi, and 2155 ethnic Han) aged 50 years or older participated in the study. Anterior segment examination was performed without pupil dilation using a slit lamp. Pterygium was deï¬ned as a raised ï¬eshy triangular ï¬brovascular tissue growth of the conjunctiva encroaching onto a clear cornea. RESULTS: Pterygium was least prevalent among adults of Yi ethnicity (29.5%) compared with Bai (39.0%, p < 0.001) or Han (39.5%, p < 0.001) ethnicities. Those of Bai ethnicity were most likely to be affected by severe pterygium (7.5%), while Yi were least likely to be affected (3.8%). Multivariate analysis revealed that increasing age (odds ratio, OR, 1.017), female sex (OR 1.53), lower educational level (OR 1.25), higher blood pressure levels (OR 1.002), and greater time spent outdoors per day (OR 1.09) were significantly associated with a higher prevalence of pterygium, while Yi ethnicity (OR 0.65, comparing Yi with Han) and wearing brimmed hats outdoors (OR 0.82) were protective factors. CONCLUSION: Ethnicity was significantly associated with prevalence of pterygium. Our findings may be applicable to many other countries located within the "pterygium belt" for health resource allocation among different ethnic groups.
Assuntos
Povo Asiático/etnologia , Etnicidade/estatística & dados numéricos , Grupos Minoritários/estatística & dados numéricos , Pterígio/etnologia , População Rural/estatística & dados numéricos , Idoso , China/epidemiologia , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Prevalência , Fatores de RiscoRESUMO
OBJECTIVE: Operation on the infrarenal aorta could cause ischemic-reperfusion (IR) injury in local tissues and remote organs (e.g. the lung). We aim to explore the method of reducing lung ischemia-reperfusion damage after lower limb IR with post conditioning (LIPC). METHODS: Bilateral lower limb ischemia was performed in Sprague-Dawley (SD) rats, and then animals were divided into 4 groups: IR-Sham-operated, IR, post conditioned-IR (LIPC) and bilateral lower limb ischemia (LIR). The serum free radical, histological changes, Wet/Dry (W/D) ratio, levels of TNF-α, IL-6, cytokines and chemokines were tested and compared. RESULTS: Post-conditioning could ameliorate histological injuries in the lung when compared to IR group. The serum free radical is significantly lower in LIPC group than IR groups. W/D ratio in LIPC groups is significantly lower. LIPC also could reduce the expression of cytokines and chemokines. CONCLUSION: post conditioning could reduce long-term damages of the lung after lower limb ischemic-reperfusion injury.