The Clinical Impact of Metagenomic Next-Generation Sequencing (mNGS) Test in Hospitalized Patients with Suspected Sepsis: A Multicenter Prospective Study.

Background: Metagenomic Next Generation Sequencing (mNGS) has the potential to detect pathogens rapidly. We aimed to assess the diagnostic performance of mNGS in hospitalized patients with suspected sepsis and evaluate its role in guiding antimicrobial therapy. Methods: A multicenter, prospective cohort study was performed. We enrolled patients with suspected sepsis, collected clinical characteristics and blood samples, and recorded the 30-day survival. Diagnostic efficacy of mNGS test and blood culture was compared, and the clinical impact of mNGS on antibiotic regimen modification was analyzed. Results: A total of 277 patients were enrolled, and 162 were diagnosed with sepsis. The mortality was 44.8% (121/270). The mNGS test exhibited shorter turn-out time (27.0 (26.0, 29.0) vs. 96.0 (72.0, 140.3) hours, p < 0.001) and higher sensitivity (90.5% vs. 36.0%, p < 0.001) compared with blood culture, especially for fungal infections. The mNGS test showed better performance for patients with mild symptoms, prior antibiotic use, and early stage of infection than blood culture, and was capable of guiding antibiotic regimen modification and improving prognosis. Higher reads of pathogens detected by mNGS were related to 30-day mortality (p = 0.002). Conclusions: Blood mNGS testing might be helpful for early etiological diagnosis of patients with suspected sepsis, guiding the antibiotic regimen modification and improving prognosis.

The requirement of mitochondrial RNA polymerase for non-small cell lung cancer cell growth.

POLRMT (RNA polymerase mitochondrial) is responsible for the transcription of mitochondrial genome encoding key components of oxidative phosphorylation. This process is important for cancer cell growth. The current study tested expression and potential functions of POLRMT in non-small cell lung cancer (NSCLC). TCGA cohorts and the results from the local lung cancer tissues showed that POLRMT is overexpressed in human lung cancer tissues. In both primary human NSCLC cells and A549 cells, POLRMT silencing (by targeted lentiviral shRNAs) or knockout (through CRSIPR/Cas9 gene editing method) potently inhibited cell viability, proliferation, migration, and invasion, and induced apoptosis activation. On the contrast, ectopic overexpression of POLRMT using a lentiviral construct accelerated cell proliferation and migration in NSCLC cells. The mtDNA contents, mRNA levels of mitochondrial transcripts, and subunits of respiratory chain complexes, as well as S6 phosphorylation, were decreased in POLRMT-silenced or -knockout NSCLC cells, but increased after ectopic POLRMT overexpression. In vivo, intratumoral injection of POLRMT shRNA adeno-associated virus (AAV) potently inhibited NSCLC xenograft growth in severe combined immune deficiency mice. The mtDNA contents, mRNA levels of mitochondria respiratory chain complex subunits, and S6 phosphorylation were decreased in POLRMT shRNA AAV-injected NSCLC xenograft tissues. These results show that POLRMT is a novel and important oncogene required for NSCLC cell growth in vitro and in vivo.

The anti-infection drug furazolidone inhibits NF-κB signaling and induces cell apoptosis in small cell lung cancer.

Targeting nuclear factor kappa B (NF-κB) signaling pathway has become a promising strategy for the development of new antitumor drugs. In this paper, we found that anti-infection drug furazolidone (FZD) could significantly inhibit NF-κB-driven luciferase activity, and FZD could markedly inhibit both of the constitutive and tumor necrosis factor-α (TNFα)-triggered phosphorylation of NF-κB p65 in small cell lung cancer (SCLC). Further studies revealed that FZD inhibited the expression of inhibitor of kappa B kinase ß (IKKß) in SCLC cells. In addition, we found that FZD had significant antitumor activities in SCLC cells. FZD could markedly suppress the cell viability of SCLC cells dose-dependently, and FZD could significantly induce the cleavages of poly ADP-ribose polymerase (PARP) and Caspase3, the biomarkers of cell apoptosis, in SCLC cells. The flow cytometry also revealed that FZD induced cell apoptosis in SCLC cells. Finally, we also found that overexpression of constitutively activated IKKß could significantly abolish FZD-induced cell growth inhibition in SCLC cells, which further confirmed that FZD displayed its anti-SCLC activity through regulating NF-κB signaling pathway.

Somatic and germline mutations in the tumor suppressor gene PARK2 impair PINK1/Parkin-mediated mitophagy in lung cancer cells.

PARK2, which encodes Parkin, is a disease-causing gene for both neurodegenerative disorders and cancer. Parkin can function as a neuroprotector that plays a crucial role in the regulation of mitophagy, and germline mutations in PARK2 are associated with Parkinson's disease (PD). Intriguingly, recent studies suggest that Parkin can also function as a tumor suppressor and that somatic and germline mutations in PARK2 are associated with various human cancers, including lung cancer. However, it is presently unknown how the tumor suppressor activity of Parkin is affected by these mutations and whether it is associated with mitophagy. Herein, we show that wild-type (WT) Parkin can rapidly translocate onto mitochondria following mitochondrial damage and that Parkin promotes mitophagic clearance of mitochondria in lung cancer cells. However, lung cancer-linked mutations inhibit the mitochondrial translocation and ubiquitin-associated activity of Parkin. Among all lung cancer-linked mutants that we tested, A46T Parkin failed to translocate onto mitochondria and could not recruit downstream mitophagic regulators, including optineurin (OPTN) and TFEB, whereas N254S and R275W Parkin displayed slower mitochondrial translocation than WT Parkin. Moreover, we found that deferiprone (DFP), an iron chelator that can induce mitophagy, greatly increased the death of A46T Parkin-expressing lung cancer cells. Taken together, our results reveal a novel mitophagic mechanism in lung cancer, suggesting that lung cancer-linked mutations in PARK2 are associated with impaired mitophagy and identifying DFP as a novel therapeutic agent for PARK2-linked lung cancer and possibly other types of cancers driven by mitophagic dysregulation.

Nitroxoline induces cell apoptosis by inducing MDM2 degradation in small-cell lung cancer.

The proto-oncogene MDM2 is a nuclear-localized E3 ubiquitin ligase, which promotes tumor formation by targeting tumor suppressor proteins, such as p53, for proteasomal degradation. In this study, the anti-infective drug nitroxoline (NXQ) was screened out to effectively inhibit cell survival of small-cell lung cancer (SCLC) cells, and induce SCLC cell apoptosis by suppressing antiapoptotic proteins (such as Bcl-2 and MCL1) and upregulating proapoptotic protein Bim. In the mechanistic study, NXQ was found to downregulate MDM2 expression by inducing its proteasomal degradation, and thus upregulated p53 expression, which was a substrate protein of MDM2. Moreover, overexpression of MDM2 decreased the cytotoxicity of NXQ on SCLC cells. These results demonstrated that NXQ displayed anti-SCLC activity by suppressing MDM2 expression, which suggested that anti-infective NXQ had potential for SCLC treatment by targeting the MDM2/p53 axis.

MicroRNA-26b suppresses tumorigenicity and promotes apoptosis in small cell lung cancer cells by targeting myeloid cell leukemia 1 protein.

The aim of this study was to investigate the role of microRNA-26b (miR-26b) in regulating the proliferation, migration, and apoptosis of small cell lung cancer (SCLC) cells. First, we examined the expression level of miR-26b in human normal fetal lung fibroblasts (NFLFs) and three SCLC cell lines NCI-H466, NCI-H1688, and NCI-H196. In the following experiments, the three SCLC cell lines were transfected with miR-26b mimic and inhibitor. Cell growth and survival, as well as migration and invasion capacities were determined by MTT, colony formation, Transwell migration and invasion, and wound healing assays. Cell apoptosis, production of reactive oxygen species, and mitochondrial membrane potential were also measured in the three cell lines following various treatments. As a result, we found that the level of miR-26b was significantly lower in SCLC cells than in NFLFs. Additionally, transfection with miR-26b mimic could inhibit proliferation, colony formation, and migration, as well as induce apoptosis in these SCLC cell lines; while miR-26b inhibitor showed the opposite effects. Further mechanistic experiment revealed that miR-26b could suppress the expression of myeloid cell leukemia 1 protein (Mcl-1) and the 3'-untranslated region (3'-UTR) of Mcl-1 may be the direct binding site of miR-26b, suggesting that the effect of miR-26b may be mediated by targeting Mcl-1. Collectively, our findings offer a new insight into the role of miR-26b in the pathogenesis of SCLC, and provide primary evidence supporting the potential of miR-26b-based therapy for the treatment of SCLC.

Bacterial contamination of medical uniforms: a cross-sectional study from Suzhou city, China.

Few studies have been conducted which evaluate the prevalence of contamination of medical uniforms in China. The present study was designed to explore the characteristics of uniform contamination and associated factors. A total of 120 participants were enrolled in the study and 122 uniforms were sampled. Each uniform was sampled at three different sites to determine the colonisation of microorganisms. A total of 366 swab samples were cultured; 294 (80.3%) samples yielded various microorganisms and 75(61.5%) uniforms were contaminated with bacteria. The uniforms of medical students had the highest prevalence of contamination. The cuffs of uniforms were the most easily infected with bacteria. Participants who wiped their hands at the back of uniforms had higher contamination rate in the hanging part of uniforms. Our study demonstrated that medical uniforms can harbour microorganisms. Proper handling of medical uniforms and adequate education to medical staffs are required to decrease healthcare-associated infections.

The impact of PM2.5 on the human respiratory system.

Recently, many researchers paid more attentions to the association between air pollution and respiratory system disease. In the past few years, levels of smog have increased throughout China resulting in the deterioration of air quality, raising worldwide concerns. PM2.5 (particles less than 2.5 micrometers in diameter) can penetrate deeply into the lung, irritate and corrode the alveolar wall, and consequently impair lung function. Hence it is important to investigate the impact of PM2.5 on the respiratory system and then to help China combat the current air pollution problems. In this review, we will discuss PM2.5 damage on human respiratory system from epidemiological, experimental and mechanism studies. At last, we recommend to the population to limit exposure to air pollution and call to the authorities to create an index of pollution related to health.

Serum pleiotrophin could be an early indicator for diagnosis and prognosis of non-small cell lung cancer.

AIMS: Pleiotrophin (PTN), an angiogenic factor, is associated with various types of cancer, including lung cancer. Our aim was to investigate the possibility of using serum PTN as an early indicator regarding disease diagnosis, classification and prognosis, for patients with non-small cell lung cancer (NSCLC). METHODS: Significant differences among PTN levels in patients with small cell lung cancer (SCLC, n=40), NSCLC (n=136), and control subjects with benign pulmonary lesions (n=21), as well as patients with different pathological subtypes of NSCLC were observed. RESULTS: A serum level of PTN of 300.1 ng/ml, was determined as the cutoff value differentiating lung cancer patients and controls, with a sensitivity and specificity of 78.4% and 66.7%, respectively. Negative correlations between serum PTN level and pathological differentiation level, stage, and survival time were observed in our cohort of patients with NSCLC. In addition, specific elevation of PTN levels in pulmonary tissue in and around NSCLC lesions in comparison to normal pulmonary tissue obtained from the same subjects was also observed (n=2). CONCLUSION: This study suggests that the serum PTN level of patients with NSCLC could be an early indicator for diagnosis and prognosis. This conclusion should be further assessed in randomized clinical trials.

[Effect of soluble PD-L1 released by lung cancer cells in regulating the function of T lymphocytes].

OBJECTIVE: To explore the expression of soluble programmed death ligand-1 on lung cancer cells and to clarify its biological function through PD-1/PD-L1 pathway in regulating the function of T lymphocytes. METHODS: Labeled monoclonal antibody and flow cytometry were used to analyze the expression of PD-L1 and its receptor PD-l on lung cancer cells and human T lymphocytes, respectively. The level of sPD-L1 in the supernatant of lung cancer cells was determined with an ELISA kit. The inhibition of proliferation of T lymphocytes by mPD-L1 and sPD-L1 was studied using CCK-8 incorporation. RESULTS: Low or no expression [(16.08 ± 2.28)%] of PD-1 was found on resting T lymphocytes from human peripheral blood with flow cytometry, but up-regulated expression of PD-1 [(78.06 ± 7.21)%] was found on the surface of activated T lymphocytes. Soluble PD-L1 was found in supernatant of some lung cancer cell lines, such as H1299, HO8910, SPCA-1, H460, H446 cells, with PD-L1 expressing on their cell surface [(78.34 ± 10.25)%, (68.17 ± 11.56)%, (45.32 ± 7.98)%, (47.52 ± 9.62)% and (40.95 ± 8.56)%, respectively], but very low expression on A549 cells [(16.02 ± 6.28)%]. The level of mPD-L1 on H1299 cells was highest [(78.34 ± 10.25)%], compared with HO8910 cells (68.17 ± 11.56)%, SPCA-1 cells (45.32 ± 7.98)%, H446 cells (40.95 ± 8.56)%, and H460 cells (47.52 ± 9.62)%. At the same time, the sPD-L1 level on H1299 cells was low [(0.17 ± 0.01) ng/ml], compared with HO8910 cells (0.30 ± 0.03) ng/ml, SPCA-1cells (0.59 ± 0.03) ng/ml, H446 cells (0.34 ± 0.02) ng/ml, and H460 cells (0.57 ± 0.03) ng/ml, but not expressed on A549 cells. PD-L1 expressing H1299 cells inhibited the proliferation of T lymphocytes in the co-culture system. Supernatant of the cultured PD-L1(+) lung cancer cells also inhibited T cell proliferation. Anti-human PD-L1 blocking antibody could partly restore the proliferation capacity of T lymphocytes. CONCLUSIONS: Membrane-bound PD-L1 and soluble PD-L1 released from lung cancer cells can effectively inhibit the proliferation of T lymphocytes in mixed culture system and down-regulate cell-mediated immunity in vitro. This may lead to inactivation of tumor antigen-specific T cells and immune escape of lung cancer cells.

[The level of soluble programmed death-1 in peripheral blood of patients with lung cancer and its clinical implications].

OBJECTIVE: To analyze the expression of soluble programmed death-1 ligand 1 (sPD-L1) in the serum of patients with lung cancer and to explore its biological and clinical implications. METHODS: Fifty-five male and twenty-six female lung cancer patients ages 34 to 87 years (mean age 65 ± 6) were selected from the Department of Respiratory Diseases in The Second Affiliated Hospital of Soochow University from June 2009 to March 2011. All lung cancer patients were newly-diagnosed, treatment-free and confirmed by histopathology or cytopathology. Eight-eight healthy volunteers matching in sex and age from the Healthcare Center of the hospital were also enrolled as controls. The sPD-L1 protein expression in serum was determined by Western blot and self-developed ELISA kit. Fluorescence-labeled monoclonal antibody and cytometry were used to examine changes in lymphocyte subsets in the peripheral blood of lung cancer patients and healthy controls. RESULTS: A higher level of sPD-L1 level in the lung cancer patients [1.6 (0.7 - 7.8) µg/L] was found compared to the control group [0.9 (0.4 - 3.7) µg/L] (P < 0.001). High expression of sPD-L1 in the lung cancer patients was closely correlated to lymph node metastasis and the extent of distant metastasis (χ(2) = 5.636, P < 0.05; χ(2) = 4.601, P < 0.05). The sPD-L1 level in lung cancer patients with objective response to treatment (complete response + partial response) was 2.7 (1.6 - 7.0) µg/L and 1.1 (0.8 - 1.7) µg/L before and after treatment, respectively (P < 0.01). The level of sPD-L1 with progression disease was 1.9 (1.3 - 8.5 µg/L) which was significantly increased compared to the baseline level 1.4 (0.8 - 2.2) µg/L (P < 0.01). Additionally, abnormal changes of T and B lymphocytes and their subsets were found, with a significant decrease of CD(8)(+) T lymphocytes (P < 0.05) and a rise in CD(4)/CD(8) ratio (P < 0.05). Further double-labeling study showed increased percentages of CD(4)(+)PD-1(+) T lymphocytes and CD(8)(+)PD-1(+) T lymphocytes (P < 0.05). CONCLUSIONS: The elevated expression of sPD-L1 in lung cancer patients was closely related to lung cancer staging, metastasis and clinical response. sPD-L1 may become a predictive marker and an important anti-tumor target in individualized treatment of lung cancer.

[Analysis of expression profiles of some tumor growth-related genes after silencing of pleiotrophin in human small cell lung cancer H446 cells].

OBJECTIVE: To investigate the changes in expression profiles of angiomotin (Amot), schlafen5 (Slfn5), metalloproteinase-9 (MMP-9) and vascular endothelial cell growth factor (VEGF), which are genes associated with angiogenesis, tumor growth and invasion, after gene silencing of pleiotrophin (PTN) in human small cell lung cancer H446 cells. METHODS: PTN expression in H446 cells was determined by RT-PCR and Western blot. After constructing a lentiviral vector interfering PTN expression, it was packaged into virus in 293T cells. Then the virus was used to infect human small cell lung cancer H446 cells. The expressions of Amot, Slfn5, MMP-9 and VEGF were detected by RT-PCR in normal non-interference group, negative control group, PTN-interference group and group combining PTN interference and chemotherapy. RESULTS: The results of RT-PCR and Western blot test showed that PTN expression in H446 cells was high. The interference efficiency of constructed ShRNA sequences (GCAGCTGTGGATACTGCTGAA) targeting PTN was as high as 72.1% and 59.2% at the mRNA and protein levels, respectively, in H446 cells. Compared with the negative control group, the expressions of Slfn5 and MMP-9 in H446 cells were increased by 165.1% and 47.3%, while the ones of Amot and VEGF were down-regulated by 33.1% and 26.6%, respectively, after gene silencing of PTN. The changes of gene expression profile became more evident when chemotherapy was superimposed on PTN interference. CONCLUSION: Gene silencing of PTN using siRNA lentiviral expressing vector can influence the expression of proliferation and metastasis-related genes in human small cell lung cancer H446 cells.

[Construction of siRNA lentiviral expressing vector targeting pleiotrophin gene and its impact on growth and apoptosis in H446 cells of human small cell lung cancer].

OBJECTIVE: To construct a siRNA lentiviral expressing vector targeting PTN (pleiotrophin) gene in human small cell lung cancer H446 cells and to study the RNAi effect on tumor growth and apoptosis. METHODS: Four pairs of small hairpin RNA specific for PTN were designed, synthesized and cloned into the Plvthm vector. The resulting lentiviral vector containing shPTN was confirmed by DNA sequencing named LV-shPTN. 293T cells were co-transfected with LV-shPTN, pRsv-REV, pMDlg-pRRE and pMD2G, then packed and purified slightly to produce lentivirus. After infecting H446 cells with recombinant lentivirus, PTN expression was determined by real-time RT-PCR and Western blot. Finally the selected lentiviral vector was packed and purified with best interference efficiency in large scale and the titer of virus was determined. The packed virus was used to infect H446 cells, and then the experiment was divided to a normal cell group, a negative control group, a PTN interference group, a chemotherapy group and a combined group with RNAi and chemotherapy. The effect on cell growth and apoptosis of H446 cells infected with high titer virus was analyzed using MTT and FCM. RESULTS: DNA sequencing analysis confirmed that shPTN lentiviral vector was successfully established as expected with interference efficiency as high as 72% and 59% at the mRNA and protein level. The titer of concentrated virus was 1 x 10(8) TU/ml. Compared to normal cells and control group, the cell viability of PTN interference group was decreased. Compared to RNAi group and chemotherapy group alone, the combined group with RNAi and chemotherapy showed less cell viability and a higher apoptotic rate in a concentration independent manner of the virus. CONCLUSION: PTN RNAi vector construction and H446 cell transfection effectively reduced the PTN transcription and expression, inhibited the growth and promoted the apoptosis of tumor cells. This method may become a useful therapeutic strategy for small cell lung cancer overexpressing PTN.

Clinical evaluation of oral levofloxacin 500 mg once-daily dosage for treatment of lower respiratory tract infections and urinary tract infections: a prospective multicenter study in China.

Levofloxacin (LVFX), a fluoroquinolone agent, has a broad spectrum that covers Gram-positive and -negative bacteria and atypical pathogens. It demonstrates good clinical efficacy in the treatment of various infections, including lower respiratory tract infections (LRTIs) and urinary tract infections (UTIs). To evaluate the efficacy and safety of oral LVFX 500 mg once daily, a large open-label clinical trial was conducted in 1266 patients (899 with LRTIs and 367 with UTIs) at 32 centers in China. In the per-protocol population, the clinical efficacy rate (cure or improvement) at 7 to 14 days after the end of treatment was 96.4% (666/691) for LRTIs and 95.7% (267/279) for UTIs. In 53 patients diagnosed with atypical pneumonia the treatment was effective. The bacteriological efficacy rate was 96.6% (256/265) for LRTIs and 93.3% (126/135) for UTIs. The eradication rate of the causative pathogens was 100% (33/33) for Haemophilus influenzae and 96.0% (24/25) for Streptococcus pneumoniae in LRTIs, and 94.1% (80/85) for Escherichia coli in UTIs. The overall efficacy rates were 89.3% (617/691) for LRTIs and 87.8% (245/279) for UTIs. The incidence of drug-related adverse events (ADRs) was 17.3% (215/1245), and the incidence of drug-related laboratory abnormalities was 15.7% (191/1213). Common ADRs were dizziness, nausea, and insomnia. Common laboratory abnormalities included "WBC decreased", "alanine aminotransferase (ALT) increased", "aspartate aminotransferase (AST) increased", and "lactate dehydrogenase (LDH) increased". All of these events were mentioned in the package inserts of fluoroquinolones including LVFX, and most events were mild and transient. Thirty-four patients (2.7%) were withdrawn from the study because of the ADRs. No new ADRs were found. This study concluded that the dosage regimen of LVFX 500 mg once daily was effective and tolerable for the treatment of LRTIs and UTIs.

[The significance of volumetric capnography in assessment of asthmatic acute exacerbation staging].

OBJECTIVE: To investigate the diagnostic value of volumetric capnography in the assessment of asthmatic exacerbation. METHODS: Sixty-four patients with asthma exacerbation and 20 normal controls performed spirometry and volumetric capnography recording. The patients with asthma were divided into three sub-groups according to FEV1% pred (A: > 80%, B:40% - 80%, C: < 40%). RESULTS: FEV1% pred, FEV1/FVC, PEF% pred and MMEF% pred were (98 +/- 9)%, (80 +/- 6)%, (91 +/-15)% and (73 +/- 7)% respectively in the control group, but were (52 +/- 20)%, (50 +/- 10)%, (49 +/-16)% and (28 +/- 16)% respectively in the asthma group, the difference being significant (t = 6.93 - 13.29, all P < 0.01). Compared with the control group, dC2/DV [(19 +/- 6)%/L vs (31 +/- 8)%/L, t = 5. 09, P < 0.01] showed a decrease in the asthma group, dC3/DV [(2.9 +/- 1.2)%/L vs (1.0 +/- 0.4)%/L, t = -6. 14, P < 0.01] and SR23 [(16.8 +/- 10.6)% vs (3.3 +/-1.5)%, t = -6.54, P < 0.01] showed an increase in the asthma group compared to the control group, the difference being significant. Compared with that of the control group, dC2/DV [B:(17 +/-5)%/L, C: (13 +/-4)%/L] showed a decrease (t = -11.82, -16.75, all P < 0.01) and dC3/DV [B:(3.2 +/- 0.8)%/L, C:(4.1 +/-1.2)%/L] and SR23 [B:(17.2 +/- 3.5)%, C:(28.3 +/- 6.9)%] showed an increase (t = 2. 16-26.08, all P < 0.01) in asthma sub-groups B and C. For dC3/DV and SR23, the difference was significant between asthma sub-groups (t = 0.91 -22.18, all P < 0.05). In Pearson correlation analysis, dC2/DV (r = 0.69, 0.54, 0.59, 0.54, all P < 0.01) and dC3/DV (r = -0.62, -0.45, -0.69, -0.58, all P < 0.01) and SR23 (r = -0.75, -0.52, -0.74, -0.62, all P < 0.01) correlated with FEV1% pred, FEV1/FVC, PEF% pred and MMEF% pred. CONCLUSION: Volumetric capnography is a quantitative method for evaluating the severity of airflow obstruction and it can be performed easily during tidal breathing.

[Expression and clinical significance of a disintegrin and metalloprotease 8 (ADAM8) and epidermal growth factor receptor (EGFR) in non-small cell lung cancer].

BACKGROUND & OBJECTIVE: Up-regulation of a disintegrin and metalloprotease 8 (ADAM8) is correlated with genesis, progression, invasion, and metastasis of tumors. However, the expression of ADAM8, especially its correlation to epidermal growth factor receptor (EGFR), has seldom been reported in non-small cell lung cancer (NSCLC). This study was to investigate expressions of ADAM8 and EGFR in NSCLC, and to analyze their correlations. METHODS: Expressions of ADAM8 and EGFR in 49 specimens of NSCLC, 28 specimens of adjacent lung tissues and 13 specimens of benign lung tissues were detected using tissue microarray (TMA) and immunohistochemistry (IHC). The interrelationship between the two factors and their correlations to clinicopathologic features of NSCLC were analyzed. RESULTS: ADAM8 and EGFR were mainly expressed in the cytoplasm and on the cell membrane. The positive rates of ADAM8 and EGFR were significantly higher in NSCLC than in adjacent lung tissues and benign lung tissues (73.5% vs. 10.7% and 15.4%, 69.4% vs. 14.2% and 23.1%, P<0.01). The positive rates of ADAM8 and EGFR were slightly lower in squamous cell carcinoma than in adenocarcinoma (73.1% vs. 80.0%, 65.4% vs. 75.0%, P>0.05), while were significantly higher in stage N1-N3 NSCLC than in stage N0 (85.7% vs. 42.8%, 82.8 vs. 35.7%, P<0.01) and significantly higher in stage III-IV NSCLC than in stage I-II (90.0% vs. 62.1%, 90.0% vs. 65.5%, P<0.05). The expression of ADAM8 was positively correlated to EGFR (r=0.589, P<0.01), with a kappa value of 0.522. CONCLUSION: ADAM8 and EGFR are overexpressed in NSCLC, and their expressions are consistent.

Molecular and chemical characterization of blood cells by infrared spectroscopy: a new optical tool in hematology.

Infrared (IR) spectroscopy has made important contributions to the arena of hematology in the past decade. The normal physiology and pathologic modifications of the three cellular elements in blood, i.e., leukocytes, erythrocytes and platelets, have been thoroughly investigated by this recently emerged optical tool. By revealing subtle alterations in the structures of macromolecules in these blood cells, IR spectroscopy has become an ideal complementary analytical tool to conventional biochemical assays used to diagnose various common hematological disorders. Such traditional assays include molecular structure measurements that determine erythrocyte membrane fluidity and conformational changes, lipid profiling of platelet membranes, as well as assays of leukocyte proliferation and differentiation. IR spectroscopic-based techniques can be used to analyze DNA alterations, secondary structural changes in proteins, and to profile cellular lipids. From a molecular and biomedical perspective, IR spectroscopy has been explored for the diagnosis and prognosis of leukemia and beta-thalassemia, to predict drug sensitivity and resistance in chemotherapy patients, and more recently to examine apoptotic processes in blood cells. These studies have shown great promise in the early identification of drug-resistant patients and the early diagnosis of hematological disorders, especially malignancies. Furthermore, IR spectroscopic-based investigations will enable specific mechanisms underlying hematological disorders to be elucidated by revealing the molecular changes in the blood cells at a very early pathogenesis stage.