Integrative analysis reveals 53BP1 copy loss and decreased expression in a subset of human diffuse large B-cell lymphomas.

p53-Binding protein 1 (53BP1) encodes a critical checkpoint protein that localizes to sites of DNA double-strand breaks (DSBs) and participates in DSB repair. Mice that are 53bp1 deficient or hemizygous have an increased incidence of lymphoid malignancies. However, 53BP1 abnormalities in primary human tumors have not been described. By combining high-density single nucleotide polymorphism (HD SNP) array data and gene expression profiles, we found 9 of 63 newly diagnosed human diffuse large B-cell lymphomas (DLBCLs) with single copy loss of the chromosome 15q15 region including the 53BP1 locus; these nine tumors also had significantly lower levels of 53BP1 transcripts. 53BP1 single copy loss found with the HD SNP array platform was subsequently confirmed by fluorescence in situ hybridization. These studies highlight the role of 53BP1 copy loss in primary human DLBCLs and the value of integrative analyses in detecting this genetic lesion in human tumors.

Modified magrath regimens for adults with Burkitt and Burkitt-like lymphomas: preserved efficacy with decreased toxicity.

Burkitt and Burkitt-like lymphomas are rapidly growing tumors which require specialized therapy. Although intensive, multi-agent regimens have been effective in children, results are more variable in adults. Magrath et al. previously described a regimen that was highly effective in children and young adults. This phase II study of a modified Magrath regimen was designed to assess its efficacy in older adults and reduce treatment-related toxicity. Fourteen patients with Burkitt/Burkitt-like lymphoma and median age of 47 years were stratified into two categories: low-risk (normal LDH and a single focus of disease measuring less than 10 cm, 3 patients) and high risk (all other, 11 patients). Low-risk patients received three cycles of modified CODOX-M (cyclophosphamide, doxorubicin, adriamycin, vincristine with intrathecal methotrexate and cytarabine followed by high-dose systemic methotrexate, regimen A). High-risk patients received four alternating cycles of regimens A and B (A-B-A-B). Regimen B consisted of ifosfamide, cytarabine, etoposide and intrathecal methotrexate (IVAC). The modified treatment regimen was associated with no grade 3/4 neuropathy and only one episode of grade 3/4 mucositis. All patients completed protocol therapy and there were no treatment-related deaths. Twelve patients (86%, 90% CI: 61 97%) achieved a complete response; 1 patient achieved a PR and 1 patient died of progressive disease. Nine patients (64%) are alive and disease free at a median follow-up of 29 months. This modified Magrath regimen is effective and well-tolerated in a representative group of older adult patients.

Demographic and geographic variations of oral health among African Americans based on NHANES III.

UNLABELLED: As efforts continue to improve the health of all US citizens, oral health must not be overlooked. Oral health is an integral part of overall health status and oral diseases are among the most prevalent of all health problems. OBJECTIVES: To describe the oral health status and oral health behaviors of African Americans. METHODS: The National Health and Nutrition Examination Survey (NHANES III) data set was used to examine a range of oral health indicators of African Americans with specific attention to demographic and geographic factors. The original data set consisted of 20,050 subjects, gathered through the use of complex, multi-stage, stratified and clustered sampling techniques. Only African Americans were included in this study which resulted in a sample of 5,616. Statistical analysis was conducted to allow the proper modeling of the complex, stratified, multistage survey design and sample weights of NHANES III. RESULTS: Sixty-two percent of respondents indicated that they only visit the dentist when needed and had no regular visitation schedule. Dental health was worse for those individuals who were poor, unemployed, and uninsured. Regional differences in dental care appeared with individuals living in the south reporting poorer dental health. CONCLUSIONS: The findings from this study are useful for identifying sociodemographic and geographic factors related to oral health status. The insights gained from this study illustrate the need for tailoring oral health promotion programmes and services to specific groups within the African American community because service utilisation and response patterns and perceptions may be different.

Expression of bcl-6 and CD10 in primary mediastinal large B-cell lymphoma: evidence for derivation from germinal center B cells?

Primary mediastinal large B-cell lymphomas (LBCLs) constitute a unique subtype of diffuse LBCLs, with distinct clinical, immunophenotypic, and morphologic features. These lymphomas are thought to originate from the thymus, and it has been hypothesized that they derive from a population of B lymphocytes normally present in the thymic medulla. Most diffuse LBCLs harbor somatic mutations in their immunoglobulin genes, suggesting that they have been exposed to the germinal center. To investigate the possible relationship of mediastinal LBCLs to germinal center B cells, we analyzed the expression of bcl-6 and CD10 in 19 mediastinal LBCLs, using an immunoperoxidase technique on formalin-fixed tissue. We found that 19 of 19 (100%) mediastinal LBCLs were bcl-6+ and 6 of 19 (32%) mediastinal LBCLs were CD10+. Because mediastinal LBCLs usually lack BCL-6 gene rearrangement or mutations, expression of bcl-6 and CD10 in these tumors tends to support a germinal center derivation.

Awareness status and prevalence of hypertension in a group of urban Haitians: findings of a population-based survey.

PURPOSE: The primary purpose of this project was to evaluate knowledge and awareness status about hypertension among a group of Haitian adults in Port-au-Prince, Haiti, and also to assess treatment status among hypertensive persons within this group. METHODS: Adults (> or =18 yrs) accompanying a sick person to a private clinic or a health center were asked to participate in a cross-sectional survey. Face-to-face questionnaires were administered to volunteers. Blood pressure measurements, weight, and height were obtained on site. RESULTS: A total of 382 subjects enrolled. Two hundred and eighty-nine subjects (approximately 76%) were normotensives. Among hypertensives: thirty-nine (10%) had borderline hypertension with systolic pressure > or =140<160 mm Hg and diastolic pressure > or =90<95 mm Hg, while fifty-four (14%) had blood pressure levels > or =160/95 mm Hg. Among subjects classified as hypertensive, fifty-seven (61%) were unaware of their high blood pressure and its risk. Only 3 of those aware (8%) reported receiving regular therapy. Thirty percent (30%) of participants believed hypertension was not a serious problem. CONCLUSION: These results highlight the need for information about awareness, prevalence, and control of hypertension in Haiti's population. This information could be used as the baseline in the planning of a cost-effective national primary prevention strategy.

Stromelysin-3 suppresses tumor cell apoptosis in a murine model.

Stromelysin-3 (STR-3) is a matrix metalloproteinase with a unique pattern of expression and substrate specificity. During embryogenesis and remodeling of normal adult tissues, STR-3 is produced by stromal cells in direct contact with epithelial cells undergoing regional apoptosis and selective cell survival. STR-3 is also overexpressed by interdigitating stromal cells in primary epithelial malignancies. Although STR-3 does not degrade classic extracellular matrix components, the enzyme promotes the establishment of local tumors in nude mice by as yet undefined mechanisms. STR-3 is induced when malignant epithelial cells come into contact with surrounding stromal elements; the active stromal cell-derived 45 kDa enzyme is subsequently processed to a 35 kDa protein without enzymatic activity. We have generated MCF-7 transfectants expressing wild type or catalytically inactive 45 kDa STR-3 (STR-3wt and STR-3cat-) or secreted 35 kDa STR-3 (35 kDa STR-3sec) and evaluated their implantation and survival in nude mice. Tumors developed significantly more rapidly in animals receiving STR-3wt, rather than vector-only, STR-3cat- or 35 kDa STR-3sec transfectants. Most importantly, STR-3wt tumors had a significantly lower percentage of apoptotic cells than tumors derived from vector-only, STR-3cat- or 35 kDa STR-3sec transfectants. Taken together, these studies suggest that the active STR-3 enzyme may increase tumor take by suppressing tumor cell apoptosis and that 45 kDa to 35 kDa STR-3 processing limits STR-3 activity at the tumor/stromal interface. Because STR-3 is secreted as an active enzyme rather than a proform, subsequent 45 kDa to 35 kDa STR-3 processing may represent a novel mechanism for regulating enzymatic activity.

BAL is a novel risk-related gene in diffuse large B-cell lymphomas that enhances cellular migration.

Clinical risk factor models such as the International Prognostic Index are used to identify diffuse large B-cell lymphoma (DLB-CL) patients with different risks of death from their diseases. To elucidate the molecular bases for these observed clinical differences in outcome, differential display was used to identify a novel gene, termed BAL (B-aggressive lymphoma), which is expressed at significantly higher levels in fatal high-risk DLB-CLs than in cured low-risk tumors. The major BAL complementary DNA encodes a previously uncharacterized 88-kd nuclear protein with a duplicated N-terminal domain homologous to the nonhistone portion of histone-macroH2A and a C-terminal alpha-helical region with 2 short coiled-coil domains. Of note, the BAL N-terminus and secondary structure resemble those of a recently identified human protein, KIAA1268. In addition, both BAL and KIAA1268 map to chromosome 3q21, further suggesting that these genes belong to a newly identified family. BAL is expressed at increased levels in DLB-CL cell lines with an activated peripheral B cell, rather than a germinal center B cell, phenotype. This observation and the characteristic dissemination of high risk DLB-CLs prompted studies regarding the role of BAL in B-cell migration. In classical transwell assays, stable BAL-overexpressing B-cell lymphoma transfectants had significantly higher rates of migration than vector-only transfectants, indicating that the risk-related BAL gene promotes malignant B-cell migration. (Blood. 2000;96:4328-4334)

The angiogenic factor interleukin 8 is induced in non-small cell lung cancer/pulmonary fibroblast cocultures.

The interactions between tumor cells and surrounding stromal elements may promote the release of angiogenic factors. Although interleukin 8 (IL-8) is a major angiogenic factor in non-small cell lung cancer (NSCLC), the stromal contribution to IL-8 expression in primary NSCLC remains to be defined. To elucidate the role of stromal elements in NSCLC IL-8 production, normal pulmonary fibroblasts were cocultured with six representative NSCLC lines in direct and transwell assays. IL-8 transcripts and protein were consistently induced in fibroblasts and a subset of NSCLCs as a consequence of tumor/stromal coculture. In these cocultures, IL-8 was induced by IL-1alpha and an additional, as yet unidentified, soluble factor. These data underscore the importance of tumor/stromal interaction in the production of angiogenic peptides such as IL-8 in NSCLC.

Identification and characterization of two androgen response regions in the human neutral endopeptidase gene.

Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in prostate cancer cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and prostate cancer cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.

Motorist vision policy.

BACKGROUND: The primary purpose of public policy requiring vision testing for driver license renewal is to identify individuals with functional vision impairments and, when necessary, to restrict their driving. This is based on the presumption that poor vision is causally related to poor driving and traffic crashes. METHODS: The AOA Environmental and Occupational Vision Committee performed a synthesis of relevant empirical literature on policy-based research and developed potential options for enhancing traffic safety. RESULTS: Presently, some states require vision testing for driver's license renewal and some do not. Regional and nationwide studies report that vision-related license renewal policies are associated with enhanced traffic safety. However, contemporary vision screening tests may be of limited value in identifying individuals with functional vision impairments. CONCLUSION: The most cost-effective and valid method for identifying, treating and counseling visually impaired drivers is to require a comprehensive eye examination as a condition for driver license renewal for those with a high prevalence or high probability of vision impairment.

Report of an international workshop to standardize response criteria for non-Hodgkin's lymphomas. NCI Sponsored International Working Group.

Standardized guidelines for response assessment are needed to ensure comparability among clinical trials in non-Hodgkin's lymphomas (NHL). To achieve this, two meetings were convened among United States and international lymphoma experts representing medical hematology/oncology, radiology, radiation oncology, and pathology to review currently used response definitions and to develop a uniform set of criteria for assessing response in clinical trials. The criteria that were developed include anatomic definitions of response, with normal lymph node size after treatment of 1.5 cm in the longest transverse diameter by computer-assisted tomography scan. A designation of complete response/unconfirmed was adopted to include patients with a greater than 75% reduction in tumor size after therapy but with a residual mass, to include patients-especially those with large-cell NHL-who may not have residual disease. Single-photon emission computed tomography gallium scans are encouraged as a valuable adjunct to assessment of patients with large-cell NHL, but such scans require appropriate expertise. Flow cytometric, cytogenetic, and molecular studies are not currently included in response definitions. Response rates may be the most important objective in phase II trials where the activity of a new agent is important and may provide support for approval by regulatory agencies. However, the goals of most phase III trials are to identify therapies that will prolong the progression-free survival, if not the overall survival, of the treated patients. We hope that these guidelines will serve to improve communication among investigators and comparability among clinical trials until clinically relevant laboratory and imaging studies are identified and become more widely available.

PTPROt: an alternatively spliced and developmentally regulated B-lymphoid phosphatase that promotes G0/G1 arrest.

Protein tyrosine phosphatases (PTP) regulate the proliferation, differentiation, and viability of lymphocytes by modulating their signaling pathways. By using the differential display assay, we have cloned a putative receptor-type PTP, which is predominantly expressed in B-lymphoid tissues (lymph nodes and spleen). This PTP, termed PTPROt (truncated), is a tissue-specific alternatively-spliced form of a human epithelial PTP, PTPRO (PTPU2/GLEPP1). Whereas the epithelial PTPRO includes an approximately 800-amino acid extracellular domain, the major (3 kb) PTPROt cDNA predicts a unique 5' untranslated region and truncated (8 amino acids) extracellular domain with a conserved transmembrane region and single catalytic domain. PTPROt cDNAs encode functional approximately 47-kD and approximately 43-kD PTPs, which are most abundant in normal naive quiescent B cells and decreased or absent in germinal center B cells and germinal center-derived diffuse large B-cell lymphomas. Because PTPROt was predominantly expressed in naive quiescent B cells, the enzyme's effects on cell-cycle progression were examined. When multiple stable PTPROt sense, antisense, and vector only B-cell transfectants were grown in reduced serum and synchronized with nocodazole, PTPROt sense clones exhibited markedly increased G0/G1 arrest. Taken together, these data implicate PTPROt in the growth control of specific B-cell subpopulations.

The cellular and molecular heterogeneity of the aggressive non-Hodgkin's lymphomas.

The majority of patients with aggressive non-Hodgkin's lymphomas (NHLs) still die of their disease. Although clinical prognostic factors can be used to characterize a patient's risk profile, these clinical features are likely to be surrogate variables for the intrinsic cellular and molecular heterogeneity of the aggressive NHLs. The purpose of this review is to identify newly described cellular and molecular features of aggressive NHLs that may be of prognostic value.

A directly spliced exon 10-containing CD44 variant promotes the metastasis and homotypic aggregation of aggressive non-Hodgkin's lymphoma.

Variants of the CD44 cell-surface adhesion molecule include additional sequences encoded by combinations of exons from the membrane proximal domain (exons 6-14). Preliminary studies suggest that these additional variable membrane proximal sequences may alter the ligand specificity, glycosylation, and biologic function of CD44. In earlier studies, we found that primary extranodal and widely disseminated aggressive non-Hodgkin's lymphomas (NHLs) and normal activated B cells expressed a directly spliced exon 10-containing variant (CD44ex10), whereas normal resting B cells expressed larger exon 10-containing variants (CD44ex10-14 and CD44ex7-14). To obtain additional information regarding the function of exon 10-containing CD44 variants in aggressive NHL, we generated aggressive NHL transfectants that expressed CD44ex10, CD44ex10-14, CD44ex7-14, the standard CD44 isoform (CD44H), or vector alone, and evaluated the local tumorogenicity, aggregation, and metastatic potential of these transfectants. CD44ex10 aggressive NHL transfectants were more likely to cause local tumor formation in nude mice than transfectants expressing the larger exon 10-containing variants, CD44H, or vector alone. In addition, cell suspensions derived from CD44ex10 local tumors exhibited far greater homotypic aggregation than those obtained from other CD44 or vector-only local tumors. In nude mice that received CD44ex10 transfectants, distant metastases were also significantly more likely to develop than in animals that were given either the CD44ex10-14, CD44ex7-14, CD44H, or vector-only transfectants. These data provide the first evidence that the directly spliced exon 10-containing CD44 variant (CD44ex10) has a unique biologic function in aggressive NHL.

Potential human and economic cost-savings attributable to vision testing policies for driver license renewal, 1989-1991.

PURPOSE: This study assessed the impact of vision-related relicensing policies on traffic fatalities in the United States. There is a limited empirical basis for state vision testing policies for relicensing. Furthermore, it is uncertain whether contemporary vision standards for driver licensing achieve their implicit goal of protecting the public's health, or inappropriately restrict the mobility of competent drivers. METHODS: The 48 contiguous states and the District of Columbia were the "subjects" in this investigation. During the study period (1989 to 1991), 10 states did not require vision testing for driver license renewal. Multiple regression modeling was used to assess the impact of vision-related relicensing policies on traffic safety and to estimate the number of avoidable vehicle occupant fatalities and corresponding economic costs associated with traffic crashes involving older drivers (> or = 60 years). The primary data source for this investigation was the Fatal Accident Reporting System (FARS) database. RESULTS: Vision-related relicensing policies were significantly associated (p < 0.05) with lower vehicle occupant fatality rates of older drivers. According to the final regression model, approximately 222 fewer vehicle occupant fatalities (-12.2%) associated with older drivers would be expected for the 3-year period if mandatory vision testing policies had been in effect in 8 of the 10 states without such policies. Conservatively, those avoidable deaths represent an estimated $31 million in avoidable economic costs. CONCLUSIONS: State-level mandatory vision testing for relicensure may enhance traffic safety and reduce the economic burden of fatal crashes. Vision testing requirements should be maintained by jurisdictions with such requirements, and jurisdictions without such requirements should consider the potential traffic safety benefits of vision testing for driver license renewal.

Stromelysin-3 is induced in tumor/stroma cocultures and inactivated via a tumor-specific and basic fibroblast growth factor-dependent mechanism.

Stromelysin-3 (STR-3) is a recently characterized matrix metalloproteinase (MMP) with a unique pattern of expression and substrate specificity. Unlike other MMPs, STR-3 is consistently and dramatically overexpressed by multiple epithelial malignancies, including carcinomas of the breast, lung, colon, head and neck, and skin. Recent studies suggest that STR-3 promotes the local establishment of epithelial malignancies, contributing to tumor cell survival and implantation in host tissues; however, STR-3's mechanism of action remains undefined. STR-3 is a stromal cell product, prompting speculation that infiltrating stromal cells secrete STR-3 in response to tumor-derived factors. To explore this possibility, we developed a tumor/"stroma" coculture assay in which non-small cell lung cancer (NSCLC) cell lines were grown on confluent monolayers of normal pulmonary fibroblasts. In these tumor/stroma cocultures, NSCLCs stimulate normal pulmonary fibroblasts to secrete STR-3 and release extracellular basic fibroblast growth factor. Thereafter, STR-3 is processed at a unique internal sequence via a basic fibroblast growth factor- and MMP-dependent mechanism to a previously unidentified 35-kDa protein that lacks enzymatic activity. 35-kDa STR-3 is the most abundant STR-3 protein in tumor/stroma cocultures and is only detected when normal pulmonary fibroblasts are cultured with malignant bronchial epithelial cells. Therefore, the tumor-specific processing of STR-3 to the 35-kDa protein is likely to be an important regulatory mechanism.

The type 2 CD10/neutral endopeptidase 24.11 promoter: functional characterization and tissue-specific regulation by CBF/NF-Y isoforms.

The cell surface zinc metalloproteinase CD10/neutral endopeptidase 24.11 ([NEP] neprilysin) functions as part of a regulatory loop to control local concentrations of peptide substrates and associated peptide-mediated signal transduction. The physiologic role of the enzyme depends on available substrates in specific organs and cell types. Although CD10/NEP is expressed on a restricted subset of normal and malignant lymphoid progenitors, the enzyme is also expressed by a variety of epithelial cells. To explore the mechanism of tissue-specific expression of this regulatory enzyme, we characterized the major (type 2) CD10/NEP promoter and identified three functionally active transcription factor binding sites (regions I to III). CBF/NF-Y binds to the inverted CCAAT box in region I, whereas a second positive and a third negative factor bind to regions II and III, respectively. Although region I is required for maximal CD10/NEP-driven luciferase activity in the examined epithelial cell lines, this region is not required for maximal activity in the evaluated lymphoid cell lines. The apparent tissue-specific differences in requirements for region I (and CBF/NF-Y) are of particular interest because lymphoid and epithelial cells express alternatively spliced versions of CBF/NF-Y that differ in biologic activity.