Integrative analysis reveals 53BP1 copy loss and decreased expression in a subset of human diffuse large B-cell lymphomas.

p53-Binding protein 1 (53BP1) encodes a critical checkpoint protein that localizes to sites of DNA double-strand breaks (DSBs) and participates in DSB repair. Mice that are 53bp1 deficient or hemizygous have an increased incidence of lymphoid malignancies. However, 53BP1 abnormalities in primary human tumors have not been described. By combining high-density single nucleotide polymorphism (HD SNP) array data and gene expression profiles, we found 9 of 63 newly diagnosed human diffuse large B-cell lymphomas (DLBCLs) with single copy loss of the chromosome 15q15 region including the 53BP1 locus; these nine tumors also had significantly lower levels of 53BP1 transcripts. 53BP1 single copy loss found with the HD SNP array platform was subsequently confirmed by fluorescence in situ hybridization. These studies highlight the role of 53BP1 copy loss in primary human DLBCLs and the value of integrative analyses in detecting this genetic lesion in human tumors.

Stromelysin-3 suppresses tumor cell apoptosis in a murine model.

Stromelysin-3 (STR-3) is a matrix metalloproteinase with a unique pattern of expression and substrate specificity. During embryogenesis and remodeling of normal adult tissues, STR-3 is produced by stromal cells in direct contact with epithelial cells undergoing regional apoptosis and selective cell survival. STR-3 is also overexpressed by interdigitating stromal cells in primary epithelial malignancies. Although STR-3 does not degrade classic extracellular matrix components, the enzyme promotes the establishment of local tumors in nude mice by as yet undefined mechanisms. STR-3 is induced when malignant epithelial cells come into contact with surrounding stromal elements; the active stromal cell-derived 45 kDa enzyme is subsequently processed to a 35 kDa protein without enzymatic activity. We have generated MCF-7 transfectants expressing wild type or catalytically inactive 45 kDa STR-3 (STR-3wt and STR-3cat-) or secreted 35 kDa STR-3 (35 kDa STR-3sec) and evaluated their implantation and survival in nude mice. Tumors developed significantly more rapidly in animals receiving STR-3wt, rather than vector-only, STR-3cat- or 35 kDa STR-3sec transfectants. Most importantly, STR-3wt tumors had a significantly lower percentage of apoptotic cells than tumors derived from vector-only, STR-3cat- or 35 kDa STR-3sec transfectants. Taken together, these studies suggest that the active STR-3 enzyme may increase tumor take by suppressing tumor cell apoptosis and that 45 kDa to 35 kDa STR-3 processing limits STR-3 activity at the tumor/stromal interface. Because STR-3 is secreted as an active enzyme rather than a proform, subsequent 45 kDa to 35 kDa STR-3 processing may represent a novel mechanism for regulating enzymatic activity.

BAL is a novel risk-related gene in diffuse large B-cell lymphomas that enhances cellular migration.

Clinical risk factor models such as the International Prognostic Index are used to identify diffuse large B-cell lymphoma (DLB-CL) patients with different risks of death from their diseases. To elucidate the molecular bases for these observed clinical differences in outcome, differential display was used to identify a novel gene, termed BAL (B-aggressive lymphoma), which is expressed at significantly higher levels in fatal high-risk DLB-CLs than in cured low-risk tumors. The major BAL complementary DNA encodes a previously uncharacterized 88-kd nuclear protein with a duplicated N-terminal domain homologous to the nonhistone portion of histone-macroH2A and a C-terminal alpha-helical region with 2 short coiled-coil domains. Of note, the BAL N-terminus and secondary structure resemble those of a recently identified human protein, KIAA1268. In addition, both BAL and KIAA1268 map to chromosome 3q21, further suggesting that these genes belong to a newly identified family. BAL is expressed at increased levels in DLB-CL cell lines with an activated peripheral B cell, rather than a germinal center B cell, phenotype. This observation and the characteristic dissemination of high risk DLB-CLs prompted studies regarding the role of BAL in B-cell migration. In classical transwell assays, stable BAL-overexpressing B-cell lymphoma transfectants had significantly higher rates of migration than vector-only transfectants, indicating that the risk-related BAL gene promotes malignant B-cell migration. (Blood. 2000;96:4328-4334)

The angiogenic factor interleukin 8 is induced in non-small cell lung cancer/pulmonary fibroblast cocultures.

The interactions between tumor cells and surrounding stromal elements may promote the release of angiogenic factors. Although interleukin 8 (IL-8) is a major angiogenic factor in non-small cell lung cancer (NSCLC), the stromal contribution to IL-8 expression in primary NSCLC remains to be defined. To elucidate the role of stromal elements in NSCLC IL-8 production, normal pulmonary fibroblasts were cocultured with six representative NSCLC lines in direct and transwell assays. IL-8 transcripts and protein were consistently induced in fibroblasts and a subset of NSCLCs as a consequence of tumor/stromal coculture. In these cocultures, IL-8 was induced by IL-1alpha and an additional, as yet unidentified, soluble factor. These data underscore the importance of tumor/stromal interaction in the production of angiogenic peptides such as IL-8 in NSCLC.

Identification and characterization of two androgen response regions in the human neutral endopeptidase gene.

Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in prostate cancer cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and prostate cancer cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.

Report of an international workshop to standardize response criteria for non-Hodgkin's lymphomas. NCI Sponsored International Working Group.

Standardized guidelines for response assessment are needed to ensure comparability among clinical trials in non-Hodgkin's lymphomas (NHL). To achieve this, two meetings were convened among United States and international lymphoma experts representing medical hematology/oncology, radiology, radiation oncology, and pathology to review currently used response definitions and to develop a uniform set of criteria for assessing response in clinical trials. The criteria that were developed include anatomic definitions of response, with normal lymph node size after treatment of 1.5 cm in the longest transverse diameter by computer-assisted tomography scan. A designation of complete response/unconfirmed was adopted to include patients with a greater than 75% reduction in tumor size after therapy but with a residual mass, to include patients-especially those with large-cell NHL-who may not have residual disease. Single-photon emission computed tomography gallium scans are encouraged as a valuable adjunct to assessment of patients with large-cell NHL, but such scans require appropriate expertise. Flow cytometric, cytogenetic, and molecular studies are not currently included in response definitions. Response rates may be the most important objective in phase II trials where the activity of a new agent is important and may provide support for approval by regulatory agencies. However, the goals of most phase III trials are to identify therapies that will prolong the progression-free survival, if not the overall survival, of the treated patients. We hope that these guidelines will serve to improve communication among investigators and comparability among clinical trials until clinically relevant laboratory and imaging studies are identified and become more widely available.

PTPROt: an alternatively spliced and developmentally regulated B-lymphoid phosphatase that promotes G0/G1 arrest.

Protein tyrosine phosphatases (PTP) regulate the proliferation, differentiation, and viability of lymphocytes by modulating their signaling pathways. By using the differential display assay, we have cloned a putative receptor-type PTP, which is predominantly expressed in B-lymphoid tissues (lymph nodes and spleen). This PTP, termed PTPROt (truncated), is a tissue-specific alternatively-spliced form of a human epithelial PTP, PTPRO (PTPU2/GLEPP1). Whereas the epithelial PTPRO includes an approximately 800-amino acid extracellular domain, the major (3 kb) PTPROt cDNA predicts a unique 5' untranslated region and truncated (8 amino acids) extracellular domain with a conserved transmembrane region and single catalytic domain. PTPROt cDNAs encode functional approximately 47-kD and approximately 43-kD PTPs, which are most abundant in normal naive quiescent B cells and decreased or absent in germinal center B cells and germinal center-derived diffuse large B-cell lymphomas. Because PTPROt was predominantly expressed in naive quiescent B cells, the enzyme's effects on cell-cycle progression were examined. When multiple stable PTPROt sense, antisense, and vector only B-cell transfectants were grown in reduced serum and synchronized with nocodazole, PTPROt sense clones exhibited markedly increased G0/G1 arrest. Taken together, these data implicate PTPROt in the growth control of specific B-cell subpopulations.

The cellular and molecular heterogeneity of the aggressive non-Hodgkin's lymphomas.

The majority of patients with aggressive non-Hodgkin's lymphomas (NHLs) still die of their disease. Although clinical prognostic factors can be used to characterize a patient's risk profile, these clinical features are likely to be surrogate variables for the intrinsic cellular and molecular heterogeneity of the aggressive NHLs. The purpose of this review is to identify newly described cellular and molecular features of aggressive NHLs that may be of prognostic value.

A directly spliced exon 10-containing CD44 variant promotes the metastasis and homotypic aggregation of aggressive non-Hodgkin's lymphoma.

Variants of the CD44 cell-surface adhesion molecule include additional sequences encoded by combinations of exons from the membrane proximal domain (exons 6-14). Preliminary studies suggest that these additional variable membrane proximal sequences may alter the ligand specificity, glycosylation, and biologic function of CD44. In earlier studies, we found that primary extranodal and widely disseminated aggressive non-Hodgkin's lymphomas (NHLs) and normal activated B cells expressed a directly spliced exon 10-containing variant (CD44ex10), whereas normal resting B cells expressed larger exon 10-containing variants (CD44ex10-14 and CD44ex7-14). To obtain additional information regarding the function of exon 10-containing CD44 variants in aggressive NHL, we generated aggressive NHL transfectants that expressed CD44ex10, CD44ex10-14, CD44ex7-14, the standard CD44 isoform (CD44H), or vector alone, and evaluated the local tumorogenicity, aggregation, and metastatic potential of these transfectants. CD44ex10 aggressive NHL transfectants were more likely to cause local tumor formation in nude mice than transfectants expressing the larger exon 10-containing variants, CD44H, or vector alone. In addition, cell suspensions derived from CD44ex10 local tumors exhibited far greater homotypic aggregation than those obtained from other CD44 or vector-only local tumors. In nude mice that received CD44ex10 transfectants, distant metastases were also significantly more likely to develop than in animals that were given either the CD44ex10-14, CD44ex7-14, CD44H, or vector-only transfectants. These data provide the first evidence that the directly spliced exon 10-containing CD44 variant (CD44ex10) has a unique biologic function in aggressive NHL.

Stromelysin-3 is induced in tumor/stroma cocultures and inactivated via a tumor-specific and basic fibroblast growth factor-dependent mechanism.

Stromelysin-3 (STR-3) is a recently characterized matrix metalloproteinase (MMP) with a unique pattern of expression and substrate specificity. Unlike other MMPs, STR-3 is consistently and dramatically overexpressed by multiple epithelial malignancies, including carcinomas of the breast, lung, colon, head and neck, and skin. Recent studies suggest that STR-3 promotes the local establishment of epithelial malignancies, contributing to tumor cell survival and implantation in host tissues; however, STR-3's mechanism of action remains undefined. STR-3 is a stromal cell product, prompting speculation that infiltrating stromal cells secrete STR-3 in response to tumor-derived factors. To explore this possibility, we developed a tumor/"stroma" coculture assay in which non-small cell lung cancer (NSCLC) cell lines were grown on confluent monolayers of normal pulmonary fibroblasts. In these tumor/stroma cocultures, NSCLCs stimulate normal pulmonary fibroblasts to secrete STR-3 and release extracellular basic fibroblast growth factor. Thereafter, STR-3 is processed at a unique internal sequence via a basic fibroblast growth factor- and MMP-dependent mechanism to a previously unidentified 35-kDa protein that lacks enzymatic activity. 35-kDa STR-3 is the most abundant STR-3 protein in tumor/stroma cocultures and is only detected when normal pulmonary fibroblasts are cultured with malignant bronchial epithelial cells. Therefore, the tumor-specific processing of STR-3 to the 35-kDa protein is likely to be an important regulatory mechanism.

The type 2 CD10/neutral endopeptidase 24.11 promoter: functional characterization and tissue-specific regulation by CBF/NF-Y isoforms.

The cell surface zinc metalloproteinase CD10/neutral endopeptidase 24.11 ([NEP] neprilysin) functions as part of a regulatory loop to control local concentrations of peptide substrates and associated peptide-mediated signal transduction. The physiologic role of the enzyme depends on available substrates in specific organs and cell types. Although CD10/NEP is expressed on a restricted subset of normal and malignant lymphoid progenitors, the enzyme is also expressed by a variety of epithelial cells. To explore the mechanism of tissue-specific expression of this regulatory enzyme, we characterized the major (type 2) CD10/NEP promoter and identified three functionally active transcription factor binding sites (regions I to III). CBF/NF-Y binds to the inverted CCAAT box in region I, whereas a second positive and a third negative factor bind to regions II and III, respectively. Although region I is required for maximal CD10/NEP-driven luciferase activity in the examined epithelial cell lines, this region is not required for maximal activity in the evaluated lymphoid cell lines. The apparent tissue-specific differences in requirements for region I (and CBF/NF-Y) are of particular interest because lymphoid and epithelial cells express alternatively spliced versions of CBF/NF-Y that differ in biologic activity.

Early restaging gallium scans predict outcome in poor-prognosis patients with aggressive non-Hodgkin's lymphoma treated with high-dose CHOP chemotherapy.

PURPOSE: This prospective study assessed the predictive value of early restaging gallium (Ga) and computed tomographic (CT) scans in poor-prognosis patients with aggressive non-Hodgkin's lymphoma (NHL) who were treated with high-dose cyclophosphamide, doxorubicin, vincristine, and prednisone (CHOP) chemotherapy. PATIENTS AND METHODS: Thirty newly diagnosed patients with bulky (> or = 10 cm) advanced-stage aggressive NHL were treated with a four-cycle high-dose CHOP regimen (22 patients at maximum-tolerated dose [MTD]: cyclophosphamide 4 g/m2, doxorubicin 70 mg/m2, vincristine 2 mg, and prednisone 100 mg orally for 5 days). All patients had chest/abdominal/pelvic CT scans and 10-mCi Ga scans at baseline and following two and four cycles of therapy. Scans were reviewed in a blinded manner for CT-documented rates of response and sizes of residual masses and Ga avidity of residual masses. The results of early (post-cycle 2) and final (post-cycle 4) restaging were subsequently associated with clinical outcome. RESULTS: CT-documented rates of response and residual mass sizes were indistinguishable in complete responders who remained continuously disease-free (CR-Cont), complete responders who subsequently relapsed (CR-Rel), and partial responders who then progressed (PR/Prog). In marked contrast, early restaging (post-cycle 2) Ga scans accurately delineated these three categories of patients: CR-Cont 90% Ga-negative (18 of 20 patients) versus CR-Rel 25% Ga-negative (one of four patients) versus PR/Prog 0% Ga-negative (zero of six patients) (P = .000014). At a median follow-up duration of 31 months (range, 21 to 46), 94% of patients who had negative early restaging Ga scans remain free from progression (FFP), whereas only 18% of patients who had positive early restaging Ga scans remain FFP (P = .000007). Early restaging Ga scans were more predictive for FFP than final restaging Ga scans because patients who required four full cycles of therapy to become Ga-negative were more likely to develop recurrent disease. CONCLUSION: Early restaging Ga scans delineate patients who are likely to have prolonged disease-free survival from those who fail to respond to intensive induction therapy. Patients whose tumors remain Ga-positive midway through high-dose CHOP therapy have a poor outcome and may be candidates for alternative treatment.

Can we improve upon the International Index?

The heterogeneity in outcomes in aggressive non-Hodgkin's lymphoma has prompted the development of clinical prognostic factor models which identify patients with different likelihoods of being cured of their disease. However, these clinical prognostic factor models are based on clinical features that are, in large part, surrogate variables for the biological heterogeneity of the disease. This review summarizes the development of clinical prognostic factor models and discusses some of the more recently described cellular and molecular features that may contribute to the biologic heterogeneity of aggressive NHL.

CD10/neutral endopeptidase 24.11 is phosphorylated by casein kinase II and coassociates with other phosphoproteins including the lyn src-related kinase.

CD10/neutral endopeptidase 24.11 (NEP) regulates peptidemediated proliferation of lymphoid progenitors and certain epithelial cells and is itself regulated by cellular proliferation. To further characterize mechanisms by which cell-surface signaling might regulate CD10/NEP expression, we determined whether CD10/NEP was phosphorylated and whether the enzyme co-associated with additional cellular phosphoproteins. The CD10/NEP cytoplasmic tall contains two consensus recognition sequences for casein kinase II (CKII), a serine and threonine kinase that increases in activity following peptide signaling. In standard in vitro kinase assays, CKII phosphorylated full-length recombinant CD10/NEP but did not phosphorylate a truncated CD10/NEP protein that lacked the transmembrane region and cytoplasmic tail. To determine whether CD10/NEP might interact with additional cellular phosphoproteins, in vitro kinase assays were performed on CD10/NEP immune complexes from Nalm-6 cells. Three additional tyrosine phosphoproteins of approximately 40 kD, approximately 58 kD, and approximately 75 kD were identified in the CD10/NEP immunoprecipitates. The approximately 56-kD CD10/NEP-associated phosphoprotein was immunoprecipitated with an anti-lyn antibody confirming its identity as the lyn src-related kinase. Taken together, these data indicate that CD10/NEP is itself phosphorylated by CKII and that CD10/NEP co-associates with additional tyrosine phosphoproteins including lyn.

Combination therapy including a gelatinase inhibitor and cytotoxic agent reduces local invasion and metastasis of murine Lewis lung carcinoma.

The efficacy of combination therapy including an oral gelatinase inhibitor (CT1746) and cytotoxic agent was analyzed using the murine Lewis lung carcinoma model. Primary tumors, pulmonary metastases, and sera from tumor-bearing animals had increased gelatinase B activity that was inhibited by CT1746 levels achievable in vivo. The combination of CT1746 and cyclophosphamide (CTX) was significantly more effective than either single agent in delaying local tumor growth (CT1746/CTX, 30.9 +/- 1.7 days; CT1746, 2.6 +/- 0.3 days; CTX, 19.5 +/- 1.1 days; P < .001) and reducing the number and size of pulmonary metastases [CT1746/CTX, 5 +/- 2 (15% metastases > 3 mm); CT1746, 15 +/- 4 (55% > 3 mm); CTX, 11 +/- 3 (63% > 3 mm); no treatment, 24 +/- 5 (62% > 3 mm); P < .001]. These data support the notion of combining matrix metalloproteinase inhibitors and cytotoxic agents to treat certain epithelial malignancies.

Phorbol ester-mediated regulation of CD10/neutral endopeptidase transcripts in acute lymphoblastic leukemias.

The cell-surface zinc metalloproteinase CD10/neutral endopeptidase 24.11 (CD10/NEP) hydrolyzes a variety of peptide substrates and regulates related peptide-mediated cellular responses. Because the enzyme functions as part of a peptide regulatory loop, the fact that CD10/NEP itself varies with cellular activation is of considerable interest. In hematopoietic and nonhematopoietic cell types, the levels of CD10/NEP protein and enzymatic activity correlate with transcript abundance. For these reasons, we investigated the regulation of CD10/NEP transcripts in the phorbol ester-treated acute lymphoblastic leukemia cell line, REH. When REH cells are treated with phorbol myristate acetate (PMA), CD10/NEP transcripts rapidly decrease in a labile protein-dependent manner. PMA has a modest effect on CD10/NEP transcription and significantly reduces CD10/NEP mRNA stability. Of note, the predicted secondary structure of the CD10/NEP 3' untranslated region includes several stem loop structures that may affect the stability of CD10/NEP transcripts.

High-dose CHOP as initial therapy for patients with poor-prognosis aggressive non-Hodgkin's lymphoma: a dose-finding pilot study.

PURPOSE: To purpose of this study was to develop a more effective approach to the treatment of patients with poor-prognosis aggressive non-Hodgkin's lymphoma (NHL). PATIENTS AND METHODS: Thirty newly diagnosed patients with bulky (> or = 10 cm) advanced-stage aggressive NHL were enrolled onto a pilot study. The study was designed to determine the maximum-tolerated dosages (MTD) of cyclophosphamide and doxorubicin that could be used in a high-dose cyclophosphamide, doxorubicin, vincristine, and prednisone (CHOP) regimen with granulocyte colony-stimulating factor (G-CSF) support and to assess preliminarily the efficacy of the regimen. RESULTS: In the initial dose-finding portion of the study, cumulative thrombocytopenia was the dose-limiting toxicity. At the MTD, the regimen included four 21-day cycles of cyclophosphamide 4 gm/m2, doxorubicin 70 mg/m2, vincristine 2 mg, and prednisone 100 mg for 5 days with mesna and G-CSF support. At the MTD, 65% of treatment cycles were complicated by febrile neutropenia, 84% of patients received at least one platelet transfusion for platelet counts less than 20,000/microL, and there was one treatment-related death. Nineteen of 22 (86%; 90% confidence interval [CI], 68 to 96) patients treated at the MTD achieved an initial complete response (CR), and 79% (90% CI, 58 to 92) of the complete responders and 69% of all patients remain progression-free with 20 months median follow-up. CONCLUSION: The high-dose CHOP regimen may be an effective alternative for patients with poor-prognosis aggressive NHL.

Stromelysin-3 is overexpressed by stromal elements in primary non-small cell lung cancers and regulated by retinoic acid in pulmonary fibroblasts.

Stromelysin-3 (STR-3) is a recently characterized matrix metalloproteinase (MMP) that was cloned on the basis of differential expression in benign and malignant breast tumors. This MMP has a unique processing mechanism and substrate specificity. Unlike previously characterized MMPs that are secreted as inactive zymogens, STR-3 is processed within the constitutive secretory pathway and secreted as an active enzyme. Although STR-3 has a characteristic MMP structure, the enzyme does not hydrolyze many of the extracellular matrix components that are substrates for other MMPs. However, STR-3 cleaves certain serine protease inhibitors (serpins), including the alpha 1 proteinase inhibitor (alpha 1 anti-trypsin). Because alpha 1 proteinase inhibitor deficiency has a known pathogenetic role in pulmonary disease, the role of STR-3 in non-small cell lung carcinomas (NSCLC) is of great interest. STR-3 transcripts and protein were significantly more abundant in primary NSCLC than in adjacent normal lung specimens in an extensive panel of stage I-III squamous cell and adenocarcinomas. The major form of STR-3 detectable in the primary NSCLC was the mature fully processed active enzyme. STR-3 transcripts and protein were primarily localized to NSCLC stromal elements, prompting analysis of STR-3 induction in normal pulmonary fibroblasts. Although STR-3 could be induced in normal pulmonary fibroblasts with growth factors (basic fibroblast growth factor and platelet-derived growth factor) and/or 12-O-tetradecanoylphorbol-13-acetate, STR-3 induction was inhibited by all-trans retinoic acid, a commonly used chemopreventive agent for aerodigestive tract malignancies. Taken together, these data suggest that STR-3 may be a novel marker and potential therapeutic target in NSCLC.