RESUMO
OBJECTIVE@#To retrospectively analyze the clinical phenotype and genetic characteristics of a child with severe mental retardation, language and motor development delays and autism.@*METHODS@#High-throughput sequencing was carried out for the patient. Candidate variant was verified by Sanger sequencing and bioinformatics analysis.@*RESULTS@#The child was found to harbor a heterozygous variant of exon 11:c.1421_1422insTGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) of the ASXL3 gene. The same variant was found in neither of her parents, suggesting that it has a de novo origin.@*CONCLUSION@#The exon 11:c.1421_1422ins TGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) variant of the ASXL3 gene probably underlay the pathogenesis of Bainbridge-Ropers syndrome in this patient. Above finding has enriched the spectrum of ASXL3 gene variants.