Changes in the GN/GCof the M segment show positive selection and recombination of one aggressive isolate and two mild isolates of tomato spotted wilt virus.

We isolated and compared three tomato spotted wilt virus (TSWV) isolates from lettuce (TSWV-Let), pepper (TSWV-Pep), and tomato (TSWV-Tom) from central Mexico to determine their ability to infect a set of eighteen differential plant species from seven families. TWSV-Let was an aggressive isolate with the ability to infect up to 52% of the differential plants, including maize, under greenhouse conditions. The nucleotide (nt) sequences of the three isolates are more than 90% similar in the M and S RNA segments. In the M segment of the TSWV-Let isolate, we detected nt changes in their intergenic region (IGR) and, in the Gc gene, a region containing a recombination site, as well as a synapomorphy associated with one of three sites under positive selection with a change in one aa residue (a cysteine-to-valine mutation). We speculate on the association of these features in the Gc gene with host selection, adaptation, aggressiveness, and ability to infect maize plants.

First Report of Impatiens necrotic spot virus in Mexico in Tomatillo and Pepper Plants.

Mexico contributes 20% of the total worldwide pepper exports (1). Impatiens necrotic spot virus (INSV) (genus Tospovirus; family Bunyaviridae) has emerged and has possibly caused diseases in various crops and ornamentals in Mexico. INSV was treated as a quarantine virus in Mexico (2) but not anymore. During the growing seasons of 2009 to 2011, surveys were conducted in the counties of Guanajuato and Querétaro in the states of the same names. Sampling included tomatillo (Physalis ixocarpa) and pepper (Capsicum spp.) plantations where plants with possible viral symptoms were observed. The symptoms observed were dark necrotic spots on some leaves and on the stems. These were similar to those observed elsewhere (3). Leaf spots further developed into localized necrotic areas. Using ELISA (Agdia, Elkhart, IN) with polyclonal antibodies, all collected samples showing symptoms tested positive for INSV and negative for Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV), Potato X virus (PVX), Potato Y virus (PVY), Tobacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV), Tobacco ringspot virus (TRSV), and Tomato ringspot virus (ToRSV). In order to identify the causal agent of these symptoms, INSV-specific sequences available for the S genomic fragments were obtained from NCBI GenBank. They were aligned and used to design primers to amplify a 250-bp fragment from total extracted RNA from healthy and symptomatic plants using reverse transcription (RT)-PCR. Primers used were INSVF (5'CCCAACTGCCTCTTTAGTGC3') and INSVR (5'GGACAATGGATCTGCTCTGA3'). Three extracted plasmids, each containing an amplified and cloned fragment for the pepper and tomatillo isolates, were sequenced (GenBank Accession Nos. KC503051 and KC503052, respectively). Both nucleotide sequences showed 95% identity with the Chinese, Italian, and Japanese INSV sequences (FN400773, DQ425096, and AB207803, respectively) and 94% identity to other INSV isolates (4). The putative Mexican INSV pepper isolate, derived from a necrotic spot, was mechanically inoculated to other experimental host plants after grinding 1 g of symptomatic leaf tissue in 3 ml of a buffer with quaternary ammonium salts at 0.5%, pH 7.8. Ten plants, at the second true-leaf stage, of each Capsicum annuum cv. cannon and Citrullus lanatus were inoculated after carborundum abrasion of the second true leaf. At 15 days post inoculation, systemic chlorotic necrotic spots, stunting, and apical malformation were observed in capsicum plants while wilting was shown in watermelon plants. RT-PCR analyses and nucleotide sequence of the amplified product confirmed the presence and identity of both virus isolates. To our knowledge, this is the first report of INSV in Mexico found naturally in tomatillo and pepper and experimentally in watermelon plants. Derived from this report, INSV distribution in Mexico should be studied due to its potential impact on these two economically important crops. References: (1) Food and Agriculture Organization of the United Nations. FAOSTAT, retrieved online at http://faostat.fao.org , 2013. (2) DGSV-CNRF. Impatiens necrotic spot virus (INSV). SAGARPA-SENASICA. México, 2011. (3) M. Ding et al. Plant Dis. 95:357, 2011. (4) I. Mavric et al. Plant Dis. 85:12, 2001.

First Report of Fragaria chiloensis cryptic virus, Fragaria chiloensis latent virus, Strawberry mild yellow edge virus, Strawberry necrotic shock virus, and Strawberry pallidosis associated virus in Single and Mixed Infections in Strawberry in Central Mexico.

For phytosanitary purposes, the prevalence and incidence of viruses found in strawberry production within a centralized breeding program was investigated in Abasolo and Irapuato Counties, Guanajuato State, Mexico. Single and mixed infections of Strawberry mottle virus (SMoV) and Strawberry crinkle virus (SCV) were originally reported in the area (3), and subsequently, Strawberry latent ringspot virus (SLRSV) was also found (4). Samples of strawberry plants showing viral symptoms: stunting, mild chlorosis and reddening, occasional wrinkled, curled, and deformed leaves that may exhibit mottling, and chlorotic spots, forming a putative virus complex were collected in April and December 2007 and July and December 2008. The detection and identification of viruses reported in the United States, the country of origin of most of the imported plantlets, was carried out with sets of primers for 11 viruses, through reverse transcription (RT)-PCR (developed by Robert Martin and Ioannis Tzanetakis in Corvallis, OR). The endogenous NADH 2 subunit was employed to test the quality of the RNA extracted. Amplification conditions were: 40 cycles of 1 min at each temperature, denaturation at 95°C, annealing at 50°C for Strawberry necrotic shock virus (SNSV); 52°C for Strawberry mild yellow edge virus (SMYEV); 55°C for Fragaria chiloensis latent virus (FClLV), Strawberry pallidosis associated virus (SPaV), Fragaria chiloensis cryptic virus (FClCV), and SMoV; and 58°C for SCV and NADH dehydrogenase, followed by a final extension at 72°C of 5 min after completion of the 40 cycles. The cloning and nucleotide sequencing of amplified fragments revealed the presence of seven viral species in 40 samples collected. These were FClLV, SCV, SMoV, SNSV, SPaV, and SMYEV, which were allocated GenBank accession numbers of JQ629412, JQ629413, JQ629414, JQ629415, JQ629416, and JQ629417, respectively. Strawberry UC-4 and UC-10 (1,2) were planted as indicators of viral infections on an experimental plot. All seven viruses were detected in single or mixed infections. SMoV was the most commonly found in combination with other viruses. Out of 40 samples, 35 were positive for the presence of viruses and six had single infections, of which five had SMoV and one had SPaV. The remaining 29 samples had mixed infections with two or more viruses in a total of 22 combinations. The combination of FCICV + SMoV was present in five samples, whereas the combination of SMoV + SMYEV was in two samples. All other samples had two and up to six different viruses per plant. SMoV was detected in 26 out of the 40 samples tested. SNSV and FClCV were detected in 14 samples. SMYEV was present in 13 samples. SCV was present in nine samples, whereas SPaV and FClLV were found in eight samples each. To the best of our knowledge, this is the first report of FClLV, FClCV, SNSV, SMYEV, and SPaV in Mexico. References: (1) N. W. Frazier. Plant Dis. Rep. 58:28, 1974. (2) N. W. Frazier. Plant Dis. Rep. 58:203, 1974. (3) D. Teliz-Ortiz and A. Trejo-Reyes. Rev. Mex. Fitopatol. 7:38, 1989. (4) L. Pérez-Moreno et al. Rev. Mex. Fitopatol. 22:187, 2004.

First Report of Leek yellow stripe virus in Garlic in the State of Guanajuato, Mexico.

Garlic (Allium sativum L.) can be affected by a virus complex (1) consisting of two potyviruses, Onion yellow dwarf virus (OYDV) and Leek yellow stripe virus (LYSV), and two carlaviruses, Garlic common latent virus (GCLV) and Shallot latent virus (SLV) (1). To identify the components of the virus complex that could be present in garlic plants in Guanajuato State, which is the second largest garlic producer in the country and where presumptive viral symptoms were initially observed in December 2004, a survey was carried out in six locations: San Miguel de Allende and San Luis de la Paz in northern Guanajuato; Irapuato and Villagrán in the central region; and Salamanca and Valle de Santiago in the southern part of the state. Enzyme-linked immunosorbent assay (ELISA) was carried out to detect LYSV, OYDV, GCLV, and SLV in 195 garlic leaf samples collected during January 2005 from plants with leaf yellow stripe, mosaic, enation, deformation, or dwarfism symptoms. A set of primers, previously reported and specific to the coat protein cistron of LYSV (1), were synthesized and used in a reverse transcriptase-polymerase chain reaction (RT-PCR). The amplified product (1,020 nucleotides) was cloned into plasmid pGEM T-Easy (Promega, Madison, WI) and sequenced (Gen-bank Accession No. DQ841554). Sequence analysis showed that the cloned DNA fragment shared 97% similarity with the coat protein cistron of LYSV isolate no. 3 from Okinawa (GenBank Accession No. AB194632). The fragment was then radioactively labelled and used as a probe in the RNA blot analysis of all samples to confirm the ELISA results of LYSV. Of the 195 samples, 64 tested positive by RNA blot analysis. Forty-one of these were also positive by ELISA for LYSV. Preliminary, positive ELISA results were also obtained for OYDV, GCLV and SLV. To our knowledge, this is the first report of LYSV in the State of Guanajuato and in Mexico. The correct identification of viruses present in garlic will help to use the appropriate strategies to reduce viral incidence in this garlic-producing region. Reference: (1) T. V. M. Fajardo et al. Fitopatol. Bras. 26:619, 2001.

Distribution of Papaya ringspot virus and Papaya mosaic virus in Papaya Plants (Carica papaya) in Mexico.

We report the results of a survey for the presence of Papaya ringspot virus (PRSV) along the coasts of the Gulf of Mexico and the Pacific Ocean, in 15 federal states of Mexico that account for over 98% of the national papaya production. More than 80 locations were visited in 58 counties. Out of a total of 267 papaya leaf samples, 157 tested positive for PRSV. We tested for the presence of three other viruses because of the occurrence of severe, atypical symptoms in plantations. Only Papaya mosaic virus (PapMV) was detected. PRSV was present in every county. PapMV was less frequent, but its overall distribution was almost identical. PRSV and PapMV occurred in single or mixed infections of papaya and other host species that could function as virus reservoirs. We investigated the diversity of the coat protein (CP) sequences of 36 PRSV isolates. The amino acid sequence divergence among all isolates ranged from 0.4 to 9.9%, and was comparable to that found in other regions of the world. In contrast to most of these world regions, there is a clear correlation between CP sequence variation and the geographical origins of the virus isolates.

Bean common mosaic virus and Bean common mosaic necrosis virus in Mexico.

A survey was performed in Mexico to study the distribution of Bean common mosaic virus (BCMV) and Bean common mosaic necrosis virus (BCMNV) using a set of primers directed to the coat protein gene (CP) that were designed to detect and characterize the two viral species. Both viral species were present in different locations in the country. BCMV was predominant in the central states of the country, whereas BCMNV proliferated toward the eastern tropical states. The alignment of nine nucleotide sequences for each viral species at the amino region of the CP gene confirmed the identities of the viruses and set the basis to assign them tentatively to pathogroups I, II, and VI.

First Report of a Mexican Isolate of Papaya mosaic virus in Papaya (Carica papaya) and Pumpkin (Cucurbita pepo).

Papaya mosaic virus (PMV) is a member of the Potexvirus group and has filamentous particles of 530 nm with a positive sense single-stranded RNA of 6.6Kb. PMV was detected in Mexico in diseased papaya plants growing alone and in mixed plantations with pumpkin. Reverse transcription polymerase chain reactions (RT-PCR) and standard double-antibody sandwich enzyme linked immunosorbent assay (DAS-ELISA) procedures were used on 45 leaf samples from single plants in seven locations in southeast Mexico (States of Yucatan, Campeche, and Quintana Roo). PCR primer design was based on a GenBank sequence with accession number D13957 (1). Amplified PCR products were cloned using a TOPO TA Cloning Kit and sequenced by the dideoxy chain termination method. Twenty-six samples tested positive for PMV using one or both detection techniques: 23 of 41 from papaya and three of four from pumpkin. The two sequences reported here, YY-15 and YY-22 (from papaya and pumpkin respectively, with accession numbers AYO17186 and AYO17187), were 1180 nucleotides long and contained a fragment of ORF3, the complete ORF4 and the putative CP gene, including the 3' end untranslatable region. Within the CP gene sequence, the amino acid sequence derived had a similarity of 88% with that of D13957 from the GenBank. The similarity of the CP between the two Mexican isolates (from papaya and pumpkin) was 94% and would therefore represent two variants of PMV. A healthy papaya plant in the greenhouse, inoculated with tissue from an infected papaya plant from the field, tested positive for PMV in DAS-ELISA. (PVX was used as a negative control). These results confirmed the identity of the isolate as PMV. Reference: (1) T. L. Sit, M. G. AbouHaidar, and S. Holi. J. Gen. Virol. 70:2335-2331, 1989.

Coat protein sequence comparisons of three Medican isolates of papaya ringspot virus with other geographical isolates reveal a close relationship to American and Australian isolates.

The coat protein gene of the papaya ringspot virus was cloned and sequenced in three Mexican isolates (two from Veracruz, and one from Chiapas). The sequences of these viral isolates were compared to those of eleven isolates from other parts of the world. They had higher similarity to isolates from Australia and the United States than to Asian isolates. A region of about one hundred nucleotides neighboring the putative aphid transmission triplet of the coat protein, contained repeats of an EK (glutamic acid-lysine) motif in all the sequences. The bearing of this region on the genetic relationships and geographical distribution of the isolates is analyzed and discussed.

First Report of Bean common mosaic necrotic virus Infecting Bean Plants in Aguascalientes and Veracruz, Mexico.

Bean common mosaic necrosis virus (BCMNV) is a pathogen of Phaseolus vulgaris L. BCMNV was previously classified in serogroup A (for necrotic strains) of the Bean common mosaic virus (BCMV) subgroup; serogroup B included non-necrotic strains of BCMV. Both serogroups are currently classified as two different species in the BCMV subgroup of the Poytvirus genus; strains of either species will produce mosaic symptoms and, in the presence of hypersensitive I gene, necrosis in bean plants (1). Prior to this classification, BCMV was reported in Mexico by the presence of mosaic and necrotic symptoms (2). To investigate the presence of BCMNV in Mexico, samples were collected in two of the main bean producing states. The total extracted RNA was used for reverse transcription polymerase chain reaction using primers complementary to the middle portion of the NIa gene (5') and the 3' UTR of the NL3 Michigan isolate (accession number U19287). Two cDNA segments of 2 and 3 kb were obtained from infected plants from the state of Aguascalientes, in the highlands of central Mexico, and from the state of Veracruz, in the lowlands of the Gulf of Mexico, respectively. The cDNAs were cloned and sequenced. Alignment analysis of these sequences with the NL3 strain of BCMNV showed a similarity of 96.4 and 96.7%, respectively. The similarity between the Aguascalientes (accession number AJ01265) and Veracruz isolates was 99.6%, indicating that both are variants of the same species. On the other hand, alignment analysis of these isolates with some published BCMV strain sequences (i.e., accession numbers L15332 and U55315) displayed low similarities of 52.9 and 64.4%, respectively. These comparisons indicate that the Aguascalientes and Veracruz viral isolates belong to the BCMNV species and is the causal agent of mosaic and necrosis observed on the bean plants in those states. References: (1) C. W. Collmer et al. Mol. Plant-Microbe Interact. 9:758, 1996. (2) E. Jimenez-García. SARH. Mexico. D. F. pp: 3-4, 1994.

Analysis of transgenic tobacco plants expressing a truncated form of a potyvirus coat protein nucleotide sequence.

Transgenic Nicotiana tabacum cv. Burley 49 plants were generated which expressed a tobacco etch virus (TEV) coat protein (CP) gene construct containing a stop codon positioned at codon 147. This gene construct was expected to produce a TEV CP lacking the carboxy-terminal 118 amino acids of the full-length 264 amino acid CP. TEV CP gene transcripts of the expected size could be detected in transgenic plants but the expected truncated CP could not be detected. Ten independent transgenic lines expressing this form of the TEV CP gene were examined in detail. Two transgenic plant lines were resistant to aphid- or mechanically transmitted TEV and one line was highly resistant. Protoplasts derived from the highly resistant plant line did not support virus replication. The data suggested that the expression of this mutated form of the TEV CP gene could interfere with TEV replication and displayed features associated with RNA-mediated virus resistance.

Induction of a Highly Specific Antiviral State in Transgenic Plants: Implications for Regulation of Gene Expression and Virus Resistance.

Transgenic tobacco plants expressing either a full-length form of the tobacco etch virus (TEV) coat protein or a form truncated at the N terminus of the TEV coat protein were initially susceptible to TEV infection, and typical systemic symptoms developed. However, 3 to 5 weeks after a TEV infection was established, transgenic plants "recovered" from the TEV infection, and new stem and leaf tissue emerged symptom and virus free. A TEV-resistant state was induced in the recovered tissue. The resistance was virus specific. Recovered plant tissue could not be infected with TEV, but was susceptible to the closely related virus, potato virus Y. The resistance phenotype was functional at the single-cell level because protoplasts from recovered transgenic tissue did not support TEV replication. Surprisingly, steady state transgene mRNA levels in recovered tissue were 12-to 22-fold less than transgene mRNA levels in uninoculated transgenic tissue of the same developmental stage. However, nuclear run-off studies suggested that transgene transcription rates in recovered and uninoculated plants were similar. We propose that the resistant state and reduced steady state levels of transgene transcript accumulation are mediated at the cellular level by a cytoplasmic activity that targets specific RNA sequences for inactivation.