Efficacy and outcome of indocyanine green-based intraoperative cholangiography using near-infrared fluorescence imaging: A prospective study.

INTRODUCTION: The most dreaded complication during laparoscopic cholecystectomy still remains to be injury to the common bile duct. The primary cause for bile duct injury during LC is misinterpretation of the biliary anatomy. Intra-operative cholangiography was introduced as a means of reducing the chances of biliary injury, done using Fluoroscopic imaging or Near-infrared fluorescence imaging method. NIRF is one of the most popular imaging methods in biomedical sciences. Indocyanine Green is sterile and water soluble which completely binds to albumin and is excreted in bile. PATIENTS AND METHODS: This prospective study was conducted among 70 patients between July 2020 and December 2021. Subjects were administered 5mg of ICG dye pre-operatively and procedure performed using Karl Storz HD image S1 system with a D-light P light source for NIRF imaging. RESULTS: The average duration of surgery was 58.10 minutes. After calot's dissection, the CBD was visualized in 88.71 % patients, with a mean time to visualization at 26.33 minutes. The cystic duct was visualized in 87.3% cases with a mean time of visualization of 32.10 minutes. The hepatic duct was visualized in 28.57% and the hepatic duct-CBD confluence was visualized in 34.28% patients. CONCLUSION: Near infrared imaging based intra-operative cholangiography, using Indocyanine Green dye, during Lap. Cholecystectomy is an easy, useful and inexpensive method of visualizing the biliary ductal anatomy.

Development of Diagnostic Markers and Applied for Genetic Diversity Study and Population Structure of Bipolaris sorokiniana Associated with Leaf Blight Complex of Wheat.

Bipolaris sorokiniana, a key pathogenic fungus in the wheat leaf blight complex, was the subject of research that resulted in the development of fifty-five polymorphic microsatellite markers. These markers were then used to examine genetic diversity and population structure in Indian geographical regions. The simple sequence repeat (SSR) like trinucleotides, dinucleotides, and tetranucleotides accounted for 43.37% (1256), 23.86% (691), and 16.54% (479) of the 2896 microsatellite repeats, respectively. There were 109 alleles produced by these loci overall, averaging 2.36 alleles per microsatellite marker. The average polymorphism information content value was 0.3451, with values ranging from 0.1319 to 0.5932. The loci's Shannon diversity varied from 0.2712 to 1.2415. These 36 isolates were divided into two main groups using population structure analysis and unweighted neighbour joining. The groupings were not based on where the isolates came from geographically. Only 7% of the overall variation was found to be between populations, according to an analysis of molecular variance. The high amount of gene flow estimate (NM = 3.261 per generation) among populations demonstrated low genetic differentiation in the entire populations (FST = 0.071). The findings indicate that genetic diversity is often minimal. In order to examine the genetic diversity and population structure of the B. sorokiniana populations, the recently produced microsatellite markers will be helpful. This study's findings may serve as a foundation for developing improved management plans for the leaf blight complex and spot blotch of wheat diseases in India.

First report of Tobacco rattle virus infecting Brassica oleracea var. botrytis (cauliflower) in India.

The Brassica oleracea var. botrytis (cauliflower) is an important annual vegetable crop in the Brassicaceae family and is extensively grown worldwide (Singh et al. 2018). In the early summer of 2022, the cauliflower plants grown at the Indian Agricultural Research Institute (IARI), New Delhi, India, showed virus-like symptoms. Symptoms comprised chlorosis, stunted growth, mottling, necrosis, and mosaic. Additionally, the infected plants had deformed, curled leaves and reduced growth. The symptomatic plant leaf samples were collected and examined under the transmission electron microscope (TEM), which showed rigid, rod-shaped particles with tubular morphology resembling tobacco rattle virus (TRV, genus Tobravirus) infection (Basavaraj et al. 2020). TRV has a vast host range and is reported to infect many vegetable crops (beans, beets, peppers, potatoes, and spinach) and ornamental plants (lily, marigold, and tulip) (Adams et al. 2012; Katoch et al. 2004; MacFarlane, 1999). The reverse transcription (RT)-PCR also tested infected samples. Total RNA was extracted with Plant RNeasy Mini Kit (Qiagen, Germany). The cDNA was prepared using a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, US). A 600-bp-long coat protein gene of TRV was PCR amplified using coat protein gene (CPG)-specific primers (TRVCPF: ATGGGAGATATGTACGATGAATC and TRVCPR: CTAGGGATTAGGACGTATCGGA). The PCR reaction contained 5.0µl of 5× Go-Taq Flexi buffer, 2.5µl of 25mM MgCl2, 1.0µl of 10mM dNTPs, 0.75µl each of 10µm forward and reverse primers of TRVCP, 1.0µl of cDNA, 13.8µl of nuclease-free water, and 0.2µl of Go-Taq polymerase (Promega, US). No template control was run with this PCR. The PCR (Gradient thermocycler, C-1000TM, BIORAD) was carried out under the following conditions: 94°C for 2 min, followed by 35 cycles of 94°C for 1 min, 50°C for 30 sec, and 72°C for 1 min, and final elongation at 72°C for 10 min. TRV was amplified in three cauliflower samples at IARI, New Delhi (Lat 28.08° N and Long 77.12°E). The amplicon of partial CPG was sequenced by Sanger sequencing (AgriGenome Labs Pvt. Ltd., India). The BLASTN analysis of the CPG revealed 100% nucleotide homology with TRV isolates (Accession No. Z36974) (Hernandez et al. 1995). Three isolates were sequenced and submitted to the GenBank database (Accession Nos. ON983976, ON983977, and ON983978). The sap from the TRV-infected cauliflower leaves were used to confirm the infection of TRV in healthy cauliflower plants grown in the greenhouse condition. TRV may be a new threat to cauliflower production and needs further research to elaborate more about the virus-host interactions and disease resistance. As per our knowledge, this is the first report of TRV infecting cauliflower in India.

Clinical Diagnosis, Management and Microbiological Profiling of Necrotizing Soft Tissue Infections - A Prospective Study of North India Region.

Background: Necrotizing Soft Tissue Infections (NSTIs) are rapidly progressive, potentially fatal illnesses characterized by necrosis of soft tissue. The disease is highly lethal if left untreated. However, its early diagnosis and management can result in significant decrease in mortality, saving the life of patient and preventing limb loss ; but its diagnosis in early stage is difficult. Therefore, the present work describes a step-by-step protocol for early diagnosis of NSTIs and its application for successful management of NSTIs (type III) in the North Indian population. Methods: This prospective study was conducted over a period of 1 year and 9 months (December 2017 to September, 2019) in a single tertiary center (Dayanand Medical College and Hospital, Ludhiana, Punjab, India) with 115 patients suffering from NSTIs. Demographic, symptomatic and clinical features were recorded. After initial resuscitation, debridement or amputation was done and collected samples were subjected to microbial profiling and drug sensitivity tests. Based on results, suitable pharmacological treatment was started to minimize the risk of mortality and fasten the recovery of patient. Results: The present work showed that in the selected population, monomicrobial gram negative infections are more prominent, more so, among diabetic males. The most prominent pathogen was found to be "Escherichia coli" (40% of cases). Enrolled patients had NSTIs in stage 1 and had no blood infection which means they sought medical attention in the early stages of the disease and the clinician was able to detect it. Debridement or amputation resulted in a significant decrease in the mortality rate (10.4%) even when the selected population had lethal Type III NSTIs. Conclusion: The presented approach can aid in early detection and management of NSTIs, thus, helping in saving patient's life and limb.

Unraveling Microbial Volatile Elicitors Using a Transparent Methodology for Induction of Systemic Resistance and Regulation of Antioxidant Genes at Expression Levels in Chili against Bacterial Wilt Disease.

Microbial volatiles benefit the agricultural ecological system by promoting plant growth and systemic resistance against diseases without harming the environment. To explore the plant growth-promoting efficiency of VOCs produced by Pseudomonas fluorescens PDS1 and Bacillus subtilis KA9 in terms of chili plant growth and its biocontrol efficiency against Ralstonia solanacearum, experiments were conducted both in vitro and in vivo. A closure assembly was designed using a half-inverted plastic bottle to demonstrate plant-microbial interactions via volatile compounds. The most common volatile organic compounds were identified and reported; they promoted plant development and induced systemic resistance (ISR) against wilt pathogen R. solanacearum. The PDS1 and KA9 VOCs significantly increased defensive enzyme activity and overexpressed the antioxidant genes PAL, POD, SOD, WRKYa, PAL1, DEF-1, CAT-2, WRKY40, HSFC1, LOX2, and NPR1 related to plant defense. The overall gene expression was greater in root tissue as compared to leaf tissue in chili plant. Our findings shed light on the relationship among rhizobacteria, pathogen, and host plants, resulting in plant growth promotion, disease suppression, systemic resistance-inducing potential, and antioxidant response with related gene expression in the leaf and root tissue of chili.

Thermal changes during drilling in human femur by rotary ultrasonic bone drilling machine: A histologic and ultrastructural study.

Undue heat production in surgical bone drilling leads to osteonecrosis and can be an important cause of failure of osteosynthesis, impaired healing, and loosening of implants following orthopedic surgery. The present work aims to minimize heat production below the critical temperature for thermal osteonecrosis (i.e., 47°C) and obviate thermal bone damage due to drilling. A total of 20 samples from the shaft of the human femur were obtained at autopsies and drilling was performed at room temperature by an operation theater (OT) compatible rotary ultrasonic bone drilling (RUBD) machine. K-type thermocouples were used to measure the temperature rise during drilling and the physical changes of the bone samples were observed by infrared gama camera. Light microscopic and transmission electron microscopic studies were performed to evaluate the bone cell damage. The maximum temperature recorded in RUBD (40.6 ± 1.3°C) was much below the critical temperature for thermal osteonecrosis (p < .05) at the rotational speed of 2000 rpm. Light microscopic and ultrastructural studies also revealed that there was no appreciable damage to the bone cells. Conventional bone drilling (CD) on the other hand recorded much higher temperature (66.6 ± 3.2°C), tissue burn and bone cell necrosis. Hence, RUBD machine has a potentiality for its use in orthopedic surgery and may provide better results.

Screening and Biocontrol Potential of Rhizobacteria Native to Gangetic Plains and Hilly Regions to Induce Systemic Resistance and Promote Plant Growth in Chilli against Bacterial Wilt Disease.

Plant growth-promoting rhizobacteria (PGPR) is a microbial population found in the rhizosphere of plants that can stimulate plant development and restrict the growth of plant diseases directly or indirectly. In this study, 90 rhizospheric soil samples from five agro climatic zones of chilli (Capsicum annuum L.) were collected and rhizobacteria were isolated, screened and characterized at morphological, biochemical and molecular levels. In total, 38% of rhizobacteria exhibited the antagonistic capacity to suppress Ralstonia solanacearum growth and showed PGPR activities such as indole acetic acid production by 67.64% from total screened rhizobacteria isolates, phosphorus solubilization by 79.41%, ammonia by 67.75%, HCN by 58.82% and siderophore by 55.88%. We performed a principal component analysis depicting correlation and significance among plant growth-promoting activities, growth parameters of chilli and rhizobacterial strains. Plant inoculation studies indicated a significant increase in growth parameters and PDS1 strain showed maximum 71.11% biocontrol efficiency against wilt disease. The best five rhizobacterial isolates demonstrating both plant growth-promotion traits and biocontrol potential were characterized and identified as PDS1-Pseudomonas fluorescens (MN368159), BDS1-Bacillus subtilis (MN395039), UK4-Bacillus cereus (MT491099), UK2-Bacillus amyloliquefaciens (MT491100) and KA9-Bacillus subtilis (MT491101). These rhizobacteria have the potential natural elicitors to be used as biopesticides and biofertilizers to improve crop health while warding off soil-borne pathogens. The chilli cv. Pusa Jwala treated with Bacillus subtilis KA9 and Pseudomonas fluorescens PDS1 showed enhancement in the defensive enzymes PO, PPO, SOD and PAL activities in chilli leaf and root tissues, which collectively contributed to induced resistance in chilli plants against Ralstonia solanacearum. The induction of these defense enzymes was found higher in leave tissues (PO-4.87-fold, PP0-9.30-fold, SOD-9.49-fold and PAL-1.04-fold, respectively) in comparison to roots tissue at 48 h after pathogen inoculation. The findings support the view that plant growth-promoting rhizobacteria boost defense-related enzymes and limit pathogen growth in chilli plants, respectively, hence managing the chilli bacterial wilt.

Rare case of gastrointestinal mucormycosis with colonic perforation in an immunocompetent patient with COVID-19.

Primary gastrointestinal mucormycosis is a rare disease associated with an increased mortality and is rarely reported in an immunocompetent host. We report the first case of mucormycosis-associated colonic perforation in a COVID-19 patient with a favourable outcome. A 48-year-old healthy male doctor in home isolation due to COVID-19 was admitted to COVID-19 intensive care unit when his symptoms deteriorated. The patient was put on non-invasive ventilation (NIV) using Bilevel Positive Airway Pressure (BiPAP) and treatment given as per existing hospital protocol. The patient improved clinically, and was discharged on day 10 of admission. Two days later, he presented with acute gastrointestinal symptoms to the emergency department. A diagnosis of perforation peritonitis was made, the patient was stabilised and sigmoid colectomy with descending colon colostomy was done. A diagnosis of gastrointestinal mucormycosis was made and injectable antifungal was started. The patient was discharged after his general conditions improved.

Video-assisted thoracoscopic surgery versus open thoracotomy in the management of empyema: A comparative study.

INTRODUCTION: With a rise in the incidence of thoracic empyema, surgical interventions also have evolved from the traditional open decortication to the current minimally invasive video-assisted thoracoscopic surgery (VATS). In this study, we determine the feasibility of VATS and also put the superiority of VATS over open thoracotomy (OT) to test. SUBJECTS AND METHODS: Prospective single-centre comparative analysis of clinical outcome in 60 patients undergoing either VATS or OT for thoracic empyema was done between 1st September, 2014, and 1st November, 2018. Furthermore, another group of patients, who were converted intraoperatively from VATS to OT, was studied descriptively. RESULTS: Nearly 75% of the patients were male with a mean age of 45.16 years. Every second patient had associated tuberculosis (TB), attributed to the endemicity of TB in India. When compared with OT, VATS had a shorter duration of surgery (268.15 vs. 178.33 min), chest tube drainage (11.70 vs. 6.13 days), post-operative hospital stay (13.56 vs. 7.42 days) and time to return to work (26.96 vs. 12.57 days). Post-operative pain and analgesic requirement were also significantly reduced in the VATS group (P < 0.0001). Conversion rate observed was 14.2%, the most common reason being the presence of dense adhesions. CONCLUSION: We conclude that VATS, a minimally invasive procedure with its substantial advantages over thoracotomy and better functional outcome, should be preferred whenever feasible to do so. Also if needed, conversion of VATS to the conventional open procedure, rather than a failure, is a wise surgical judgement.

Effect of Drilling Techniques on Microcracks and Pull-Out Strength of Cortical Screw Fixed in Human Tibia: An In-Vitro Study.

The strength between the cortical screw and bone following an orthopaedic implant surgery is an important determinant for the success of osteosynthesis. An excessive axial cutting force during drilling produces microcracks in the bone surface, resulting in reduced strength between the screw and bone, resulting in loosening of implant. The present work, investigates the influence of drilling parameters on microcracks generated in the drilled surface and pull-out strength of screw fixed in cortical bone of human tibia. The holes were drilled by two different techniques: conventional surgical bone drilling (CSBD) and rotary ultrasonic bone drilling (RUBD), by a recently developed operation theatre (OT) compatible machine. Cutting force generated in drilling of human tibia using RUBD was 30-40% lesser than that of CSBD. Scanning electron microscopy (SEM) also revealed that RUBD produced significantly lesser and thinner microcracks than that of CSBD in human bones. Biomechanical pull-out test results showed that, the pull-out strength of screws inserted into drilled holes by RUBD was much higher (100-150%) than that of CSBD. A significant difference in pull-out strength (p < 0.05) between RUBD and CSBD was revealed by statistical analysis at 95% confidence interval.

Effects of rotary ultrasonic bone drilling on cutting force and temperature in the human bones.

Efficacy and outcomes of osteosynthesis depend on various factors including types of injury and repair, host factors, characteristics of implant materials and type of implantation. One of the most important host factors appears to be the extent of bone damage due to the mechanical force and thermal injury which are produced at cutting site during bone drilling. The temperature above the critical temperature (47 °C) produces thermal osteonecrosis in the bones. In the present work, experimental investigations were performed to determine the effect of drilling parameters (rotational speed, feed rate and drill diameter) and techniques (conventional surgical bone drilling and rotary ultrasonic bone drilling) on cutting force and temperature generated during bone drilling. The drilling experiments were performed by a newly developed bone drilling machine on different types of human bones (femur, tibia and fibula) having different biological structure and mechanical behaviour. The bone samples were procured from male cadavers with the age of second to fourth decades. The results revealed that there was a significant difference (p < 0.05) in cutting force and temperature rise for rotary ultrasonic bone drilling and conventional surgical bone drilling. The cutting force obtained in rotary ultrasonic bone drilling was 30%-40%, whereas temperature generated was 50%-55% lesser than conventional surgical bone drilling process for drilling in all types of bones. It was also found that the cutting force increased with increasing feed rate, drill diameter and decrease in rotational speed, whereas increasing rotational speed, drill diameter and feed rate resulted in higher heat generation during bone drilling. Both the techniques revealed that the axial cutting force and the temperature rise were significantly higher in femur and tibia compared with the fibula for all combinations of process parameters.

An in-vitro study of temperature rise during rotary ultrasonic bone drilling of human bone.

Temperature rise in surgical bone drilling is an important factor that leads to death of the bone cells, known as Osteonecrosis, and results into poor osteosynthesis i.e. implant failure. The present work aims to study the temperature rise during bone drilling by a recently developed operation theatre (OT) compatible machine. The temperature during the drilling process was recorded from K-type thermocouple devices, which were embedded in the human tibial bone at four different positions (at 0.5 mm, 1.0 mm, 1.5 mm, and 2.0 mm) from the drilling site. Comparative study revealed that rotary ultrasonic bone drilling (RUBD) technique produced lesser temperature (40 - 50%) than conventional drilling on human tibia. Statistical model was developed to predict the temperature rise in RUBD process using response surface methodology (RSM), and the optimum parameters were determined using Genetic Algorithm. Analysis of variance (ANOVA) was carried out at a confidence interval of 95 percent (α = 0.05) to determine the influence of various drilling parameters such as rotational speed, feed rate, drill diameter and abrasive particle size on temperature rise. It was observed that the rotational speed was responsible for the maximum temperature rise (51.8%) followed by drill diameter (18.8%), and abrasive particle size (14.3%); whereas, the feed rate contributed minimal (4%) temperature rise.

In vitro comparison of conventional surgical and rotary ultrasonic bone drilling techniques.

In orthopedic and trauma surgical operations, drilling of bone is one of the commonly used procedures performed in hospitals and is a clinical practice for fixing the fractured parts of human bones. Force, torque and temperature play a significant role during the bone drilling and decide the stability of the medical implants. Therefore, it is necessary to minimize force, torque and temperature while drilling to avoid the thermal necrosis and osteosynthesis. This study focused on studying the influence of various types of bone drilling parameters (rotational speed, feed rate, drill diameter and ultrasonic amplitude), tools (solid tool, hollow tool and conventional twist drill bit) and techniques (conventional surgical drilling, rotary ultrasonic bone drilling and rotary bone drilling) on force, torque, temperature and microcracks produced in the drilled surface of the bone. The experimental investigations were conducted on porcine bone samples to perform the comparative study. Results revealed that increasing the diameter of drill tool and feed rate results in the increase in force, torque and temperature, while low rotational speed (500 r/min) generated a low temperature, high cutting force and torque for all types of drilling processes and tools evaluated in this study. Experimental results also revealed that rotary ultrasonic bone drilling with hollow tool generated the lowest cutting force, torque, temperature (<47 °C) and microcracks in the drilled surface of the bone as compared to the other four types of drilling techniques evaluated in this study. Influence of external irrigation technique on temperature was also studied with respect to the rotary ultrasonic bone drilling with a hollow tool, which could eliminate the problem of thermal necrosis. In conclusion, this study revealed that the rotary ultrasonic bone drilling process with hollow tool produced lesser cutting force as compared to rotary bone drilling and conventional surgical drilling for hollow and solid tools. The study also revealed that rotary ultrasonic bone drilling process has the potential to minimize the cutting force, torque and temperature as compared to the conventional surgical drilling for orthopedic surgery.

Experimental investigations and statistical modeling of cutting force and torque in rotary ultrasonic bone drilling of human cadaver bone.

Cutting force and torque are important factors in the success of the bone drilling process. In the recent past, many attempts have been made to reduce the cutting force and torque in the bone drilling process. In this work, drilling on human cadaver bones has been performed using rotary ultrasonic bone drilling process to investigate the effect of drilling parameters on cutting force and torque. The experimental work was carried on a recently developed rotary ultrasonic bone drilling machine for surgical operations. The experimental work was performed in two phases. The first phase includes a comparative study between rotary ultrasonic bone drilling and conventional surgical bone drilling, to study the influence of various drilling parameters (rotational speed, drill diameter, and drilling tool feed rate) on the cutting force and torque. The results revealed that the cutting force and torque produced during drilling operations in rotary ultrasonic bone drilling were lesser (30%-40%) than conventional surgical bone drilling. In the second phase, response surface methodology was used to perform the statistical modeling of cutting force and torque in rotary ultrasonic bone drilling process. Analysis of variance was performed at a confidence interval of 95% to analyze the significant contribution (p < 0.05) of process parameters (drilling speed, feed rate, drill diameter, and abrasive particle size) on the responses (cutting force and torque). The confirmatory experiments were performed to validate the developed statistical models. It was found that both cutting force and torque decrease with increase in drilling speed and increases with the increasing drill diameter, feed rate, and abrasive particle size.

Incidental detection of hepatitis B and C viruses and their coinfection in a hospital-based general population in tertiary care hospital of Uttar Pradesh.

INTRODUCTION: Substantial proportion of liver diseases worldwide is caused by hepatitis B virus (HBV) and hepatitis C virus (HCV) infections which manifest not only as an acute illness but also lead to chronic sequelae. Together HBV and HCV cause chronic infection in more than 500 million persons and about one million deaths annually. Most of the people with chronic infection are not aware of the infection thus enabling it to go unnoticed, and undiagnosed and act as a potential source of infection for the community at large. Therefore, we aimed to find the prevalence of HBV and HCV in Barabanki, Uttar Pradesh among individuals attending the tertiary care hospital. MATERIALS AND METHODS: From February 2015 to January 2016, 3750 patients attending the outdoor patient departments or admitted to the indoor patient departments of teaching hospital and advised to undergo HBV and HCV for screening before any invasive/surgical procedure were included in the study. Screening was done by rapid card test followed by the confirmation of all samples by enzyme immunoassay. RESULTS: Seroprevalence of HBV and HCV was found to be 3.9% and 1.76% respectively with higher seroprevalence among males and in married participants in both infections. Blood transfusion is statistically a significant risk factor for HCV infection (P < 0.05). Coinfection with HBV/HCV was seen in 0.16% of the individuals visiting the hospital. CONCLUSION: Higher seroprevalence of HBV and HCV among the hospital-based population mandates screening of high-risk individuals. Awareness by health education of safe sexual practices and improved safety of blood and its products are among the most important preventive measures to control HBV and HCV infection.

Prevalence of nasal colonization of methicillin-resistant Staphylococcus aureus among schoolchildren of Barabanki district, Uttar Pradesh, India.

INTRODUCTION: The study aimed to determine the prevalence of nasal colonization of methicillin-resistant Staphylococcus aureus (MRSA), the minimum inhibitory concentration (MIC) of oxacillin and vancomycin, inducible clindamycin resistance, and antimicrobial resistance pattern of S. aureus among children of Barabanki district, Uttar Pradesh, India. MATERIALS AND METHODS: School-going children of age group of 5-15 years were identified and selected according to the inclusion and exclusion criteria. Two nasal swabs were collected from each child as per the Centers for Disease Control and Prevention guidelines and transported to laboratory. Swabs were cultured on mannitol salt agar and 5% blood agar and incubated for 18-24 h at 37°C. Identification was done as per routine laboratory protocol. Detection of MRSA was done through cefoxitin 30 µg discs and D-zone test. Antibiotic susceptibility pattern of S. aureus by Kirby-Bauer disc diffusion method along with MIC for oxacillin and vancomycin was performed simultaneously according to Clinical Laboratory Standards Institute guidelines. RESULTS: Out of 300 children, 140 (46.67%) were found to be nasal carriage for S. aureus, among which MRSA was found to be 23 (7.67%). All S. aureus and MRSA isolates were sensitive to vancomycin with MIC <2 µg/ml, whereas 23 S. aureus were found resistant to oxacillin with MIC value >4 µg/ml. Resistance to penicillin and co-trimoxazole was highest, whereas all were sensitive to linezolid. MRSA showed 100% susceptibility to linezolid, followed by gentamicin (91.4%) and tetracycline (87%). CONCLUSION: With the risk involved in transmission of infection, steps for identifying the carriers and its eradication should be carried out. Rational use of antibiotics should be given preference too.

Management and Outcome of Patients with Pancreatic Trauma.

INTRODUCTION: Pancreatic trauma is a rare entity occurring in 0.2% of patients with blunt trauma abdomen. Once the diagnosis is made, the management of patients is dependent on multiple variables. Conservative management, suture repair, drainage, and resection have been utilized with varying degree of success. This study is aimed to evaluate the management of patients with pancreatic trauma. MATERIALS AND METHODS: This was a prospective study done in the Department of Surgery in Dayanand Medical College and Hospital where forty hemodynamically stable patients diagnosed to have pancreatic trauma on contrast-enhanced computed tomography abdomen were included in the study. RESULTS: Out of forty patients taken in this study, 38 were male and two were female with age ranging from 3 to 50 years. Road traffic accident was the most common cause of pancreatic injury. Pancreatic injuries were graded according to the American Association for Surgery in Trauma scale. Twelve patients had Grade I and II injuries. Grade III was the most common injury occurring in 14 patients. Twenty-four patients underwent surgical management. Mortality rate was 45% and it was in direct correlation with the severity of injury. CONCLUSION: Grade I and II pancreatic injury can be managed conservatively depending upon the hemodynamic status of the patient. Grade III and IV injuries have a better prognosis if managed surgically.

Role of Amylase and Lipase Levels in Diagnosis of Blunt Trauma Abdomen.

INTRODUCTION: Blunt Trauma Abdomen (BTA) is the leading cause of morbidity and mortality amongst all age groups. Spectrum of injury may vary from simple to life threatening multi organ involvement and therefore proper assessment and diagnosis becomes very important. AIM: To evaluate the role of serum amylase and lipase in diagnosis of blunt trauma abdomen. MATERIALS AND METHODS: This study was done on 50 patients with diagnosis of BTA admitted in Dayanand Medical College and Hospital, Ludhiana. Serum amylase and lipase levels were estimated on days 1, 3 and 5 of admission. RESULTS: Road side accident was the most common aetiology accounting for 40 patients. Thirty one patients were less than 35 years of age and 42 patients were males. Abdominal tenderness was the most common per abdomen finding, found in 31 patients, followed by distension, found in 21 patients. The most common organ injured was liver, seen in 27 patients. Fifteen patients underwent laparotomy while 35 patients were managed conservatively. There was statistically significant rise in serum amylase levels on days 1, 3 and 5 in patients with small and large intestinal injury. There was statistically significant rise in serum lipase levels on days 1, 3 and 5 in patients with stomach injury. Raised levels of serum amylase and lipase had a statistically significant prediction for the need of surgery in these patients. CONCLUSION: Serum amylase and lipase levels, when coupled with other laboratory tests and imaging modalities, may have significant role in predicting the site of injury as well as the surgical outcome in patients of BTA.

Detection of anti-filarial antibody among hydrocele patients living in an endemic area for filariasis.

BACKGROUND: The knowledge of the current prevalence of lymphatic filariasis and its transmission will be helpful in its elimination. Thus, the present study is aimed to determine its prevalence among hydrocele patients which is a common presentation in chronically infected cases. MATERIALS AND METHODS: One hundred patients suffering from hydrocele admitted to the surgical ward were included in the study. Blood samples were collected from the patients during the day hours for the detection of anti-filarial antibody and during night hours to detect the presence of microfilaria by smear examination. Blood samples were also collected from the family member attending the ward along with the patients to determine the presence of anti-filarial antibodies. Serum IgE level and eosinophil count were also determined in the patients showing a positive result for the anti-filarial antibody test. RESULTS: Out of 100 hydrocele patients, 21% patients showed anti-filarial antibody card test positive with maximum patients belonging to age group of 20-40 years. Microfilaria was detected in 5% of the hydrocele patients, whereas none of the family members showed positive anti-filarial antibody test. Serum IgE level and eosinophil count were more than 1000 ng/ml and 500/mm3, respectively. CONCLUSIONS: The study has found a high prevalence of filariasis among hydrocele patients. It is suggested that more studies are needed to know the real time prevalence of the cases showing manifestations of the filariasis in the acute stage which will help the eradication program to formulate new strategies.

Antimicrobial susceptibility pattern of extended-spectrum beta- lactamase producing Klebsiella pneumoniae clinical isolates in an Indian tertiary hospital.

OBJECTIVE: There is an increased prevalence of extended-spectrum beta-lactamase producing Klebsiella pneumoniae (ESBL-KP) worldwide including India, which is a major concern for the clinicians, especially in intensive care units and pediatric patients. This study aims to determine the prevalence of ESBL-KP and antimicrobial sensitivity profile to plan a proper hospital infection control program to prevent the spread of resistant strains. METHODS: KP isolates obtained from various clinical samples were evaluated to detect the production of ESBL by phenotypic methods. Antimicrobial susceptibility profile was also determined of all the isolates. FINDINGS: Of 223 nonduplicate isolates of K. pneumoniae, 114 (51.1%) were ESBL producer and antimicrobial susceptibility profile showed the isolates were uniformly sensitive to imipenem and highly susceptible to beta-lactamase inhibitor combination drugs (67-81%) and aminoglycosides (62-76%), but less susceptible to third generation cephalosporins (14-24%) and non-ß-lactam antibiotics such as nitrofurantoin (57%), fluoroquinolones (29-57%), piperacillin (19-23%), and aztreonam (15-24%). CONCLUSION: This study found that beta-lactamase inhibitor combinations are effective in treatment of such infections due to ESBL-KP thus these drugs should be a part of the empirical therapy and carbapenems should be used when the antimicrobial susceptibility tests report resistance against inhibitors combinations.