Identification of mutations in the GNPTA (MGC4170) gene coding for GlcNAc-phosphotransferase alpha/beta subunits in Korean patients with mucolipidosis type II or type IIIA.

Mucolipidosis types II and III are autosomal recessive inherited diseases caused by a deficiency in the lysosomal enzyme N-acetylglucosamine-1 phosphotransferase (GlcNAc-phosphotransferase), which adds phosphate to function as a recognition marker for the uptake and transport of lysosomal enzymes. We investigated mutations in the GNPTA (MGC4170) gene, which codes for the alpha/beta subunits of phosphotransferase, and in the GNPTAG gene, which codes for its gamma subunits in five Korean patients with mucolipidosis type II or IIIA. We identified seven mutations in the GNPTA gene, but none in GNPTAG. The mutations in type II patients included p.Q104X (c.310C>T), p.R1189X (c.3565C>T), p.S1058X (c.3173C>G), p.W894X (c.2681G>A), and p.H1158fsX15 (c.3474_3475delTA), all of which are nonsense or frameshift mutations. However, a splicing site mutation, IVS13+1G>A (c.2715+1G>A) was detected along with a nonsense or a frameshift mutation (p.R1189X or p.E858fsX3 (c.2574_2575delGA)) in two mucolipidosis type IIIA patients. This report shows that mutations in the GNPTA gene coding for the alpha/beta subunits of phosphotransferase, and not mutations in the GNPTAG gene, account for most of the genetic mutations found in Korean patients with mucolipidosis type II or IIIA.

Correlation between fasting plasma ghrelin levels and age, body mass index (BMI), BMI percentiles, and 24-hour plasma ghrelin profiles in Prader-Willi syndrome.

Ghrelin is a GH-releasing acylated peptide found in the stomach and a centrally acting food intake stimulator. Prader-Willi syndrome (PWS) is a genetic disorder characterized by a voracious appetite and increased fasting ghrelin levels. In this report we describe 24-h ghrelin profiles in PWS children (n = 5) and compare these with age, sex, and body mass index (BMI)-matched controls (n = 5). A 3- to 4-fold increase in ghrelin levels was found in PWS over a 24-h period, compared with controls (P < 0.001). Interestingly, there was a greater tendency for the up-regulation of ghrelin level in lean PWS than in obese PWS. To confirm this finding, we measured fasting ghrelin levels in 39 patients with PWS. Inverse correlations were found between plasma ghrelin levels and the following: age (r = -0.408, P = 0.005), BMI (r = -0.341, P = 0.017), percentage of the ideal weight for age (r = -0.382, P = 0.008), and BMI percentile (r = -0.311, P = 0.027). Our data show that there may be a suppressive (or up-regulating) controlling mechanism of ghrelin secretion in obese (or lean) PWS children. We hope that our data may further explain the mechanisms underlying the insatiable appetite and obesity characteristic of PWS.

Frequency analysis and clinical characterization of spinocerebellar ataxia types 1, 2, 3, 6, and 7 in Korean patients.

BACKGROUND: By genetic analysis, the CAG repeat expansion has been established in spinocerebellar ataxia (SCA) types 1, 2, 3, 6, and 7. Despite the genetic differentiation of SCA, the characterization of the phenotypes of various SCAs has been challenging for better clinical diagnosis. OBJECTIVE: To analyze the frequencies and the clinical manifestations of SCA1, SCA2, SCA3, SCA6, and SCA7 in Korean patients. PATIENTS AND METHODS: We performed genetic analysis in 253 unrelated Korean patients with progressive cerebellar ataxia. We compared the frequencies, inheritance patterns, and various clinical manifestations of patients with genetically confirmed SCA. RESULTS: Among the 52 patients with expanded CAG repeat, the most frequent SCA type was SCA2, followed by SCA3, SCA6, SCA1, and SCA7. Nine patients (17%) had a negative family history of ataxia, mostly in SCA6. There were characteristic clinical features such as hypotonia and optic atrophy for SCA1; hyporeflexia for SCA2; nystagmus, bulging eye, and dystonia for SCA3; and macular degeneration for SCA7. Interestingly, 4 patients (1 with SCA2, 1 with SCA3, and 2 with SCA6) were misdiagnosed as having multiple-system atrophy because of the absence of family history and the presence of parkinsonism and urinary incontinence. CONCLUSIONS: This study provides a detailed analysis of the clinical characteristics of the genetically defined CAG-repeat SCAs in Korean patients. Although phenotypes were heterogeneous, some clinical features may be helpful for clinical diagnosis. However, genetic studies for SCA are needed despite uncertain family history or the presence of atypical clinical features causing misdiagnosis as atypical parkinsonism.

Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: identification of 13 novel mutations.

Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs, we found three gene deletions. When the 20 mutations were depicted in a 3-dimensional model of IDS protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas. We hope that these findings will further the understanding of the underlying mechanisms associated with the disease.