Assessment of Prickly Sida as a Potential Inoculum Source for Sida Golden Mosaic Virus in Commercial Snap Bean Farms in Georgia, United States.

Sida golden mosaic virus (SiGMV), an obligate pathogen that infects snap beans (Phaseolus vulgaris), is known to infect prickly sida (Sida spinosa L.), which is a common weed in agricultural farms in Georgia. Prickly sida has also been reported as a suitable host of sweetpotato whitefly (Bemisia tabaci), the vector of SiGMV. Despite being a host for both SiGMV and its vector, the role of prickly sida as a reservoir and inoculum source for SiGMV in snap bean farms has not been evaluated. This study was conducted to document the occurrence of SiGMV-infected prickly sida plants and to assess its potential role as a source of SiGMV inoculum in snap bean farms. A survey of 17 commercial snap bean farms conducted in spring 2021 confirmed the presence of SiGMV-infected prickly sida in southern Georgia. In fall 2021 and 2022, on-farm field trials were conducted in four commercial farms where SiGMV-infected prickly sida plants were documented earlier as a part of survey in spring 2021. The spatial distribution and temporal patterns of adult whiteflies and SiGMV on snap bean were compared between macroplots (13.7 × 30.5 m) "with prickly sida" or "without prickly sida" that were at least 232 m apart from each other. We did not observe any consistent differences in counts of adult whiteflies between macroplots with or without prickly sida in the four commercial farms. SiGMV infection was detected earlier and with higher incidences in snap bean macroplots "with prickly sida" compared with macroplots "without prickly sida." An apparent disease gradient was observed in two of the four farms assessed. Higher SiGMV incidences were observed on the edges of macroplots "with prickly sida." These findings indicate prickly sida as a potential natural reservoir and a source for SiGMV spread in snap bean farms in southern Georgia.

Post-Application Field Persistence and Efficacy of Cordyceps javanica against Bemisia tabaci.

Previously, Cordyceps javanica Wf GA17, a causing agent of whitefly epizootics in southern Georgia, demonstrated superior temperature tolerance and higher virulence against the whitefly Bemisia tabaci than commercial strains in the laboratory. The post-application persistence and efficacy of this fungus against B. tabaci were compared with that of the commercially available C. javanica Apopka97 strain over a two-year field study in cotton and vegetable crops. When blastospores of both strains were applied alone, whitefly populations were not effectively suppressed. Thus, JMS stylet oil was added to fungal treatments for enhancing efficacy and persistence. For 0-day samples, all fungal treatments caused similar but significant levels of immature mortality regardless of fungal strain, propagule form (conidia vs. blastospores), and application method (alone or mixed with JMS). In follow-up samplings, Wf GA17 blastospores + JMS achieved higher control levels than other treatments in some trials, but the efficacy did not last long. The JMS oil alone caused significant mortality and suppressed whiteflies. Over 90% of spores lost viability 24 h after treatment in all fungal treatments. Across evaluation times, there was no difference between the two fungal strains (conidia or blastospores, alone or combined with JMS), but conidia persisted better than blastospores for both strains. Overall, the field persistence and efficacy of C. javanica did not last long; therefore, improved delivery methods and formulations are needed for enhancement.

High Throughput Sequencing-Aided Survey Reveals Widespread Mixed Infections of Whitefly-Transmitted Viruses in Cucurbits in Georgia, USA.

Viruses transmitted by the sweet potato whitefly (Bemisia tabaci) have been detrimental to the sustainable production of cucurbits in the southeastern USA. Surveys were conducted in the fall of 2019 and 2020 in Georgia, a major cucurbit-producing state of the USA, to identify the viruses infecting cucurbits and their distribution. Symptomatic samples were collected and small RNA libraries were prepared and sequenced from three cantaloupes, four cucumbers, and two yellow squash samples. An analysis of the sequences revealed the presence of the criniviruses cucurbit chlorotic yellows virus (CCYV), cucurbit yellow stunting disorder virus (CYSDV), and the begomovirus cucurbit leaf crumple virus (CuLCrV). CuLCrV was detected in 76%, CCYV in 60%, and CYSDV in 43% of the total samples (n = 820) tested. The level of mixed infections was high in all the cucurbits, with most plants tested being infected with at least two of these viruses. Near-complete genome sequences of two criniviruses, CCYV and CYSDV, were assembled from the small RNA sequences. An analysis of the coding regions showed low genetic variability among isolates from different hosts. In phylogenetic analysis, the CCYV isolates from Georgia clustered with Asian isolates, while CYSDV isolates clustered with European and USA isolates. This work enhances our understanding of the distribution of viruses on cucurbits in South Georgia and will be useful to develop strategies for managing the complex of whitefly-transmitted viruses in the region.

First report of cucurbit chlorotic yellows virus in association with other whitefly-transmitted viruses in squash (Cucurbita pepo) in Georgia.

Viruses transmitted by whiteflies (Bemisia tabaci) cause severe damage to cucurbits in the southern United States. In the fall of 2020, samples of squash plants (Cucurbita pepo) exhibiting symptoms of yellow mottle, interveinal yellowing, and leaf crumple were collected from an insecticide trial in Tifton, Georgia. Total nucleic acid was isolated using the MagMAX 96 Viral RNA Isolation Kit (ThermoFisher Scientific) following the manufacturer's instructions but without DNase treatment. Polymerase chain reaction (PCR) and reverse transcription (RT)-PCR were carried out to determine the presence of whitefly-transmitted viruses. We identified infection by cucurbit chlorotic yellows virus (CCYV) using primers targeting a 953 nt segment of CCYV RNA1 encoding the RNA dependent RNA polymerase gene (RdRp) (CCYV-RDRP-1515F-5'CTCCGAGTAGATCATCCCAAATC3' and CCYV-RDRP-1515R-5'TCACCAGAAACTCCACAATCTC 3') along with other whitefly-transmitted viruses previously reported in Georgia. CCYV was detected from 27 of the 28 samples tested, while cucurbit yellow stunting disorder virus (CYSDV; Polston et al., 2008) and cucurbit leaf crumple virus (CuLCrV; Gadhave et al., 2020) were detected from 23 and 28 squash samples, respectively, with all three viruses regularly occurring as mixed infections. The presence of CCYV was further confirmed by amplification of portions of two different genomic segments from RNA2, including a section of the heat-shock protein (HSP) homolog gene (Bananej et al. 2013) as well as a portion of the coat protein (CP) gene which was amplified using primers CCYV_CPF-5'TCCCGGTGCCAACT GAGACA3' and CCYV_CPR- 5' TACGCGCGGCAGAGGAATTT 3'. The respective 462 bp HSP and 375 bp CP amplicons were cloned and sequenced. The partial coat protein gene sequence (MW251342) was 97.86% identical to a CCYV isolate from Shanghai (KY400633). The partial HSP sequence (MW251341) shared 99.73% identity with the recently identified CCYV isolate from California (MH806868). Criniviruses are an emerging group of whitefly-transmitted viruses responsible for worldwide losses of billions of dollars annually (Tzanetakis et al., 2013). CCYV, a member of the genus Crinivirus, was believed to be restricted to Asia, Africa, and the Mediterranean regions of Europe (Bananej et al., 2013; Orfanidou et al., 2014) until it was recently identified in the Imperial Valley of California (Wintermantel et al., 2019). Southern Georgia has been experiencing high whitefly populations, resulting in the emergence of CuLCrV and CYSDV on vegetables in recent years. Because CCYV can produce symptoms virtually identical to those of CYSDV and occurs in mixed infections in cucurbits with other whitefly-transmitted viruses, its epidemiology, role in disease incidence, severity, and impact on economically important crops in the southeastern United States will require further investigation.

Reproductive Biology and Evidence of Diapause in the Cowpea Curculio (Coleoptera: Curculionidae).

Chalcodermus aeneus Boheman (Coleoptera: Curculionidae) has been the most destructive insect pest of black-eyed peas or cowpeas, Vigna unguiculata L. (Fabales: Fabaceae), over the last century in the southeastern United States. The historical distribution of this semitropical pest suggests the likelihood that diapause plays a key role in the overwintering success in parts of the United States. However, this report is the first to document biological evidence for diapause in C. aeneus. Our study assessed larval emergence from cowpea pods in the summer to fall growing seasons, egg development in female adults over the first (summer) and second (fall) generations, and adult emergence from infested soil after the first and second generations. There was a clear reduction in larval emergence from summer to fall. Egg and follicle development in female C. aeneus dropped off dramatically by September of each year. There was an extended emergence pattern of weevil adults from the soil in the fall as compared to the summer generation. Any future regional management of cowpea curculio will have to take into account the ability of this insect to diapause, thereby increasing its capacity to overwinter in regions where the cowpea crop, a warm-season, semitropical plant, is terminated with winter freezing temperatures.

Impact of applying edible oils to silk channels on ear pests of sweet corn.

The impact of applying edible oils to corn silks on ear-feeding insects in sweet corn, Zea mays L., production was evaluated in 2006 and 2007. Six edible oils used in this experiment were canola, corn, olive, peanut, sesame, and soybean. Water and two commercial insecticidal oils (Neemix neem oil and nC21 Sunspray Ultrafine, a horticultural mineral oil) were used as the controls for the experiment. Six parameters evaluated in this experiment were corn earworm [Helicoverpa zea (Boddie) (Lepidoptera: Noctuidae)] damage rating, the number of sap beetle [Carpophilus spp. (Coleoptera: Nitidulidae)] adults and larvae, the number of corn silk fly (or picture-winged fly) (Diptera: Ulidiidae) larvae, common smut [Ustilago maydis (D.C.) Corda] infection rate, and corn husk coverage. Among the two control treatments, neem oil reduced corn earworm damage at both pre- and postpollination applications in 2006, but not in 2007, whereas the mineral oil applied at postpollination treatments reduced corn earworm damage in both years. The mineral oil also reduced the number of sap beetle adults, whereas the neem oil applied at postpollination attracted the most sap beetle adults in 2007. Among the six edible oil treatments, the corn and sesame oils applied at postpollination reduced corn earworm damage only in 2007. The application of the peanut oil at postpollination attracted more sap beetle adults in 2006, and more sap beetle larvae in 2007. Olive and neem oils significantly reduced husk coverage compared with the water control in both years. The mineral oil application consistently increased smut infection rate in both 2006 and 2007. Ramifications of using oil treatments in ear pest management also are discussed.

Chemical cotton stalk destruction for maintenance of host-free periods for the control of overwintering boll weevil in tropical and subtropical climates.

In the Lower Rio Grande Valley (LRGV) of Texas, cotton regrows and produces fruit from undestroyed stalks throughout the winter, and in spring weevils from such locations become a serious threat. The success of the boll weevil eradication program, which was reintroduced in the LRGV in 2005, will be dependent on thorough stalk destruction following harvest. However, adverse weather conditions and conservation tillage often impede immediate and complete stalk destruction using typical tool implements, and alternative stalk control methods are needed. This study provides an examination of the efficacy for cotton stalk destruction of different herbicides (thifensulfuron-methyl + tribenuron-methyl, dicamba-diolamine, 2,4-D-dimethylammonium, flumioxazin, 2,4-DB-dimethylammonium and carfentrazone-ethyl) and their rates, spray volumes and application timings on shredded or standing cotton stalks after stripper or picker harvest. None of the tested herbicides, except 2,4-D-dimethylammonium, stopped post-harvest cotton regrowth and fruiting. 2,4-D-dimethylammonium sprayed once (0 or 7 days) after cotton was harvested at 1 lb AE acre(-1) (1.12 kg ha(-1)), in a spray volume of 10 gal water acre(-1) (93.5 L ha(-1)) with 5 mL L(-1) surfactant, was highly effective in stalk destruction (72-90%). The best results were achieved when the herbicide was applied immediately after the cotton was shredded, followed by standing stripper-harvested and standing picker-harvested cotton. 2,4-D-dimethylammonium applied twice, 0 and 14 (or 21) days after cotton harvest, was 100% effective in killing stalks, regardless of whether they were shredded or standing, or whether harvest was by stripper or picker. These findings showed that 2,4-D-dimethylammonium cotton stalk destruction eliminated food and reproductive opportunities for managing overwintering boll weevils [Anthonomus grandis grandis Boheman (Coleoptera: Curculionidae)].

Effects of insecticides and defoliants applied alone and in combination for control of overwintering boll weevil (Anthonomus grandis; Coleoptera: Curculionidae)--laboratory and field studies.

In laboratory, greenhouse and field tests, we determined the effects of combining full rates of the defoliants tribufos and thidiazuron and the herbicide thifensulfuron-methyl with half rates of the insecticides lambda-cyhalothrin or azinphos-methyl, and the combination of tribufos and thidiazuron, both in half rates, on mortality of the boll weevil, Anthonomus grandis grandis Boheman and on the quality of defoliation. Tribufos, 0.47 kg ha(-1) and tribufos, 0.235 kg ha(-1) + thidiazuron, 0.125 kg ha(-1) exhibited a slightly toxic effect to boll weevil, while tribufos, 0.47 kg ha(-1) + lambda-cyhalothrin, 0.019 kg ha(-1), tribufos, 0.47 kg ha(-1) + azinphos-methyl, 0.14 kg ha(-1), and tribufos, 0.235 kg ha(-1) + thidiazuron, 0.125 kg ha(-1) + azinphos-methyl, 0.14 kg ha(-l), provided control of boll weevil as good as or better than full-rate azinphos-methyl or lambda-cyhalothrin alone owing to synergistic effects. Thidiazuron or thifensulfuron-methyl alone or in combination with insecticides did not affect boll weevil mortality. Treatment with tribufos + thidiazuron, both at half rate, significantly increased defoliation compared to full rates of tribufos or thidiazuron alone, and provided adequate defoliation for approximately the same cost per hectare.

Toxicity, persistence, and efficacy of indoxacarb on cabbage looper (Lepidoptera: Noctuidae) on cabbage.

Toxicity of indoxacarb was bioassayed against eggs and young (first and second instars) and older larvae (third and fourth instars) of cabbage looper, Trichoplusia ni (Hübner), on cabbage (Brassicae oleracea variety capitata L.), and persistence of field-aged leaf residues of indoxacarb was bioassayed with second and third instars of T. ni on cabbage. Efficacies of indoxacarb and several other newer insecticides to T. ni were tested under field conditions for two seasons in south Texas. LC50 and LC90 values for T. ni eggs were relatively high, indicating that indoxacarb has little ovicidal effects on T. ni eggs. Indoxacarb was highly toxic to T. ni larvae, having low LC50 and LC90 values. Bioassays of field-aged leaf residues of indoxacarb tested in the spring of 1998 (0-, 3-, 5-, and 12-d-old residues) and the fall of 2000 (0-, 3-, 5-, 7-, 9-, and 13-d-old residues) indicated that ingesting indoxacarb was highly toxic to the second and third instars of T. ni, giving 100% mortality for the second instars at 2 d after exposure, and 100% mortality for third instars at 5 d after exposure. Two trials conducted under field conditions show that indoxacarb at 0.072 g (AI) /ha rate was effective against T. ni in cabbage, providing marketable cabbage with three applications per season. In addition, indoxacarb was as effective as spinosad and chlorfenapyr and significantly more effective than tebufenozide and emamectin benzoate.