A Taxonomic Review of the Buccal-attaching Fish Parasite genus Lobothorax Bleeker, 1857 (Crustacea: Isopoda: Cymothoidae) with Description of a New Species from Southwestern India.

The genus Lobothorax Bleeker, 1857 is revised with the description of a new species collected from the gempylidaen fish Promethichthys prometheus (Cuvier, 1832) from the southwestern coast of India. A revised generic diagnosis is provided based on the redescription of the type species. Lobothorax aurita (Schioedte and Meinert, 1883) is here synonymised with Lobothorax typus Bleeker, 1857 based on the original description. Lobothorax nicosmiti Aneesh, Bruce and Kumar sp. nov. is described from the female stage and it is characterized by: pereonite 1 anterolateral expansion not extending to the anterior margin of cephalon; coarsely pitted pereonites dorsal surfaces; pereonites without dorsal median longitudinal ridges; anteriorly truncate cephalon; pleotelson about 0.6 times as long as wide, posterior margin weakly emarginate, broadly sub-truncate, lateral margins convex; maxilliped palp article 3 with three RS; pereopods basis much wider with prominent carina. A key to the species of Lobothorax Bleeker, 1857 is presented.

ERG oncoprotein expression in prostate cancer: clonal progression of ERG-positive tumor cells and potential for ERG-based stratification.

Gene fusions prevalent in prostate cancer (CaP) lead to the elevated expression of the ERG proto-oncogene. ERG activation present in 50-70% of prostate tumors underscores one of the most common oncogenic alterations in CaP. Despite numerous reports of gene fusions and mRNA expression, ERG oncoprotein status in CaP still remains to be defined. Furthermore, development of ERG protein-based assays may provide a new dimension to evaluation of gene fusions involving diverse androgen-regulated promoters and the ERG protein-coding sequence. Through exhaustive evaluations of 132 whole-mount prostates (261 tumor foci and over 200 000 benign glands) for the ERG oncoprotein nuclear expression, we demonstrated 99.9% specificity for detecting prostate tumor cells using a highly specific anti-ERG monoclonal antibody. The ERG oncoprotein expression correlated well with fusion transcript or gene fusion in randomly selected specimens. Strong concordance of ERG-positive foci of prostatic intraepithelial neoplasia (PIN) with ERG-positive carcinoma (82 out of 85 sections with PIN, 96.5%) affirms the biological role of ERG in clonal selection of prostate tumors in 65% (86 out of 132) of patients. Conversely, ERG negative PINs were associated with ERG-negative carcinoma. Taken together, the homogeneous and strong ERG expression detected in individual tumors establishes the potential for ERG oncoprotein-based stratification of CaP.

Lorazepam versus diazepam-phenytoin combination in the treatment of convulsive status epilepticus in children: a randomized controlled trial.

BACKGROUND: Convulsive status epilepticus demands urgent and appropriate management with anticonvulsants. Intravenous diazepam is an established drug in the management of convulsive status epilepticus in adults as well as in children. The efficacy of intravenous lorazepam has not been well established in children. OBJECTIVE: To determine whether intravenous lorazepam is as efficacious as diazepam-phenytoin combination in the treatment of convulsive status epilepticus in children. STUDY DESIGN: Randomized controlled trial. METHODS: A total of 178 children were enrolled in the study; 90 in the lorazepam group and 88 in the diazepam-phenytoin combination group. Enrolled subjects were between 1 and 12 years with a clinical diagnosis of convulsive status epilepticus, presenting in pediatric emergency of a tertiary care hospital. They were randomized to receive either intravenous lorazepam (0.1 mg/kg) or intravenous diazepam (0.2 mg/kg)-phenytoin (18 mg/kg) combination at admission and were followed up for subsequent 18 h. RESULTS: The overall success rate of therapy was 100% in both the groups. There was no statistically significant difference in the two groups (lorazepam versus diazepam-phenytoin combination) in the median time taken to stop the seizure [20s in both groups], the number of subjects requiring more than one dose of the study drug to stop the presenting seizure [lorazepam 6(6.7%) versus diazepam-phenytoin combination: 14 (15.9%); adjusted RR (95% CI)=0.377 (0.377, 1.046); P=0.061] and the number (%) of patients having respiratory depression [lorazepam 4(4.4%) versus diazepam-phenytoin combination 5 (5.6%)]. None of the patients in the two groups required additional anticonvulsant drug to stop the presenting seizure. No patient required mechanical ventilation and none of the patients in the two groups required cross-over to the alternative regimen. CONCLUSION: Lorazepam is as efficacious and safe as diazepam-phenytoin combination. We recommend use of lorazepam as a single drug to replace the two drug combination of diazepam-phenytoin combination to control the initial seizure in pediatric convulsive status epilepticus.

TMPRSS2-ERG fusion, a common genomic alteration in prostate cancer activates C-MYC and abrogates prostate epithelial differentiation.

The high prevalence of TMPRSS2-ERG rearrangements ( approximately 60%) in prostate cancer (CaP) leads to androgenic induction of the ETS-related gene (ERG) expression. However, the biological functions of ERG overexpression in CaP remain to be understood. ERG knockdown in TMPRSS2-ERG expressing CaP cells induced striking morphological changes and inhibited cell growth both in cell culture and SCID mice. Evaluation of the transcriptome and specific gene promoters in ERG siRNA-treated cells and investigation of gene expression signatures of human prostate tumors revealed ERG-mediated activation of C-MYC oncogene and the repression of prostate epithelial differentiation genes (PSA and SLC45A3/Prostein). Taken together, these data combining cell culture and animal models and human prostate tumors reveal that ERG overexpression in prostate tumor cells may contribute to the neoplastic process by activating C-MYC and by abrogating prostate epithelial differentiation as indicated by prostate epithelial specific markers.

Amelogenin-mediated regulation of osteoclastogenesis, and periodontal cell proliferation and migration.

We previously reported that amelogenin isoforms M180 and leucine-rich amelogenin peptide (LRAP) are expressed in the periodontal region, and that their absence is associated with increased cementum defects in amelogenin-knockout (KO) mice. The aim of the present study was to characterize the functions of these isoforms in osteoclastogenesis and in the proliferation and migration of cementoblast/periodontal ligament cells. The co-cultures of wild-type (WT) osteoclast progenitor and KO cementoblast/periodontal ligament cells displayed more tartrate-resistant acid phosphatase (TRAP)-positive cells than the co-cultures of WT cells. The addition of LRAP to both co-cultures significantly reduced RANKL expression and the TRAP-positive cells. Proliferation and migration rates of the KO cementoblast/periodontal ligament cells were lower than those of WT cells and increased with the addition of either LRAP or P172 (a porcine homolog of mouse M180). Thus, we demonstrate the regulation of osteoclastogenesis by LRAP, and the proliferation and migration of cementoblast/periodontal ligament cells by LRAP and P172.

Is the lingual forming part of the incisor a structural entity? Evidences from the fragilitas ossium (fro/fro) mouse mutation and the TGFbeta1 overexpressing transgenic strain.

Our objective was to study the teeth of a mutant mice fro/fro that display severe forms of osteogenesis imperfecta. One day and 8 week-old fro/fro and +/fro heterozygote mice (wild type, WT) were processed for light and scanning electron microscopy. The genetic defect, shown to be located on chromosome 8, induced alveolar bone and teeth hypomineralisation. Due to defective cell proliferation in the fro/fro, the distal growth of the mandibular incisors was impaired. Immunolabelling revealed an increase of chondroitin/dermatan sulphate, whereas no difference was detected in dental tissues for decorin and biglycan. Amelogenin expression was decreased in the incisor and enhanced in the molar. Dentin sialoprotein was below the level of detection in the fro/fro, whereas osteonectin and osteopontin were unchanged. The main target of the mutation was seen in the lingual part of the incisor near the apex where dentine formation was delayed. In the molars, bulbous roots with obliteration of the pulp chamber were seen. In the TGFbeta1 overexpressing mice, the lingual root-analogue part of the incisor was missing. In the molar, short roots, circumpulpal dentine of the osteodentine type and pulp obliteration were seen. It may be noted that, although the mutant and transgenic strains mutations are two different genetic alterations not related to the same defective gene, in both cases the expression of the dentin sialoprotein is altered. Altogether, the present data suggest that the lingual forming part of the incisor seems to be an anatomical entity bearing its own biological specificities.

Transgenic mouse model of early-onset DYT1 dystonia.

Early-onset dystonia is an autosomal dominant movement disorder associated with deletion of a glutamic acid residue in torsinA. We generated four independent lines of transgenic mice by overexpressing human DeltaE-torsinA using a neuron specific enolase promoter. The transgenic mice developed abnormal involuntary movements with dystonic-appearing, self-clasping of limbs, as early as 3 weeks after birth. Animals also showed hyperkinesia and rapid bi-directional circling. Approximately 40% of transgenic mice from each line demonstrated these severe behavioral abnormalities. Neurochemical analyses revealed decreases in striatal dopamine in affected transgenic mice, although levels were increased in those that had no behavioral changes. Immunohistochemistry demonstrated perinuclear inclusions and aggregates that stained positively for ubiquitin, torsinA and lamin, a marker of the nuclear envelope. Inclusions were detected in neurons of the pedunculopontine nucleus and in other brain stem regions in a pattern similar to what has been described in DYT1 patients. This transgenic mouse model demonstrates behavioral and pathologic features similar to patients with early-onset dystonia and may help to better understand the pathophysiology of this disorder and to develop more effective therapies.

Odontoblast-specific expression of cre recombinase successfully deletes gene segments flanked by loxP sites in mouse teeth.

Embryonic or neonatal lethality of mice with targeted disruption of critical genes preclude them from further characterization of specific roles of these genes during postnatal development and aging. In order to study the molecular roles of such genes in teeth, we generated transgenic mouse lines expressing bacteriophage Cre recombinase under the control of the mouse dentin sialophosphoprotein (dspp) gene promoter. The expression of Cre recombinase protein was mainly detected in the nucleus of the odontoblasts. The efficiency of Cre activity was analyzed by crossing the Dspp-Cre mice with ROSA26 reporter (R26R) mice. The offspring with both genotypes have shown specific deletion of intervening sequences flanked by loxP sites upstream of the reporter gene, thereby facilitating the expression of the beta-galactosidase (beta-gal) gene in the teeth. The activity of beta-gal was initially observed in the odontoblasts of 1-day-old mice and increased with tooth development. Almost all of the odontoblasts have shown lacZ activity by 3 weeks of age. We could not detect Cre recombinase activity in any other cells, including ameloblasts. These studies indicate that the Dspp-Cre transgenic mice will be valuable to generate odontoblast-specific gene knockout mice so as to gain insight into the molecular roles of critical genes in the odontoblasts during dentinogenesis.

Amelogenin-deficient mice display an amelogenesis imperfecta phenotype.

Dental enamel is the hardest tissue in the body and cannot be replaced or repaired, because the enamel secreting cells are lost at tooth eruption. X-linked amelogenesis imperfecta (MIM 301200), a phenotypically diverse hereditary disorder affecting enamel development, is caused by deletions or point mutations in the human X-chromosomal amelogenin gene. Although the precise functions of the amelogenin proteins in enamel formation are not well defined, these proteins constitute 90% of the enamel organic matrix. We have disrupted the amelogenin locus to generate amelogenin null mice, which display distinctly abnormal teeth as early as 2 weeks of age with chalky-white discoloration. Microradiography revealed broken tips of incisors and molars and scanning electron microscopy analysis indicated disorganized hypoplastic enamel. The amelogenin null phenotype reveals that the amelogenins are apparently not required for initiation of mineral crystal formation but rather for the organization of crystal pattern and regulation of enamel thickness. These null mice will be useful for understanding the functions of amelogenin proteins during enamel formation and for developing therapeutic approaches for treating this developmental defect that affects the enamel.

Neuron-specific expression of Cre recombinase during the late phase of brain development.

Gene targeting to disrupt gene expression in a temporal and spatial manner in a specific tissue using Cre recombinase-mediated gene inactivation has been proven to be useful to study in vivo gene function. To delete genes specifically in neurons during the late phase of brain development, we have generated transgenic mouse lines that express Cre recombinase under the control of the murine neurofilament-H (mNF-H) gene promoter. In this study, we report that one of these mouse lines expresses Cre recombinase specifically in the neurons of the brain and spinal cord during the late stage of their development. The transgenic line displays specific excision of the loxP-flanked gene in the neurons just after embryonic day 18.5 (E.18.5), which coincides with the later phase of brain maturation including spinal cord and olfactory bulb area. This mNF-H-cre transgenic mouse line will be valuable for studying in vivo functions of neuron-specific genes, particularly, defining their precise roles in the mature nervous system using conditional gene targeting strategies.

Neuronal cyclin-dependent kinase 5 activity is critical for survival.

Cyclin-dependent kinase 5 (Cdk5) null mice exhibit a unique phenotype characterized by perinatal mortality, disrupted cerebral cortical layering attributable to abnormal neuronal migration, lack of cerebellar foliation, and chromatolytic changes of neurons in the brainstem and the spinal cord. Because Cdk5 is expressed in both neurons and astrocytes, it has been unclear whether this phenotype is primarily attributable to defects in neurons or in astrocytes. Herein we report reconstitution of Cdk5 expression in neurons in Cdk5 null mice and its effect on the null phenotype. Unlike the Cdk5 null mice, the reconstituted Cdk5 null mice that express the Cdk5 transgene under the p35 promoter (TgKO mice) were viable and fertile. Because Cdk5 expression is mainly limited to neurons in these mice and rescues the defects in the nervous system of the Cdk5 null phenotype, it clearly demonstrates that Cdk5 activity is necessary for normal development and survival of p35-expressing neurons.

Reduced expression of dentin sialophosphoprotein is associated with dysplastic dentin in mice overexpressing transforming growth factor-beta 1 in teeth.

Transforming growth factor (TGF)-beta1 is expressed in developing tooth from the initiation stage through adulthood. Odontoblast-specific expression of TGF-beta1 in the tooth continues throughout life; however, the precise biological functions of this growth factor in the odontoblasts are not clearly understood. Herein, we describe the generation of transgenic mice that overexpress active TGF-beta1 predominantly in the odontoblasts. Teeth of these mice show a significant reduction in the tooth mineralization, defective dentin formation, and a relatively high branching of dentinal tubules. Dentin extracellular matrix components such as type I and III collagens are increased and deposited abnormally in the dental pulp, similar to the hereditary human tooth disorders such as dentin dysplasia and dentinogenesis imperfecta. Calcium, one of the crucial inorganic components of mineralization, is also apparently increased in the transgenic mouse teeth. Most importantly, the expression of dentin sialophosphoprotein (dspp), a candidate gene implicated in dentinogenesis imperfecta II (MIM 125420), is significantly down-regulated in the transgenic teeth. Our results provide in vivo evidence suggesting that TGF-beta1 mediated expression of dspp is crucial for dentin mineralization. These findings also provide for the first time a direct experimental evidence indicating that decreased dspp gene expression along with the other cellular changes in odontoblasts may result in human hereditary dental disorders like dentinogenesis imperfecta II (MIM 125420) and dentin dysplasia (MIM 125400 and 125420).

Spatial and temporal activity of the dentin sialophosphoprotein gene promoter: differential regulation in odontoblasts and ameloblasts.

Dentin sialoprotein and dentin phosphoprotein are non-collagenous proteins that are cleavage products of dentin sialophosphoprotein (DSPP). Although these two protein products are believed to have a crucial role in the process of tooth mineralization, their precise biological functions and the molecular mechanisms of gene regulation are not clearly understood. To understand such functions, we have developed a transgenic mouse model expressing a reporter gene (lacZ) under the control of approximately 6 kb upstream sequences of Dspp. The transgenic fusion protein was designed to reside within the cells to facilitate the precise identification of cell type and developmental stages at which the Dspp-lacZ gene is expressed. The results presented in this report demonstrate: (a) the 6 kb upstream sequences of Dspp have the necessary regulatory elements to direct the tissue specific expression of the transgene similar to endogenous Dspp, (b) both odontoblasts and ameloblasts exhibit transgene expression in a differentiation dependent manner, and (c) a differential regulation of the transgene in odontoblasts and ameloblasts occurs during tooth development and mineralization.

Androgen-independent expression of hoxb-13 in the mouse prostate.

BACKGROUND: Hox genes encode transcriptional regulatory proteins that are largely responsible for establishing the body plan of all metazoan organisms. A subset of Hox genes is expressed during the period of organogenesis and into adulthood. hoxb-13 is a recently-described member of the Hox gene family that is expressed in the spinal cord, hindgut, and urogenital sinus during embryogenesis. METHODS: Northern blot and in situ hybridization analyses of hoxb-13 expression in adult mouse tissues were performed. RESULTS: hoxb-13 mRNA is restricted to the prostate gland and distal colon in adult animals. In situ hybridization of mouse prostate tissue demonstrated that hoxb-13 is expressed in the epithelial cells of the ventral, dorsal, lateral, and anterior prostate lobes. Accumulation of hoxb-13 mRNA is not diminished following castration. CONCLUSIONS: These data demonstrate that hoxb-13 expression is androgen-independent in mouse prostate glands. The identification of hoxb-13 as an androgen-independent gene expressed in adult mouse prostate epithelial cells provides a new potential target for developing therapeutics to treat advanced prostate cancer.

Expression pattern of macrophage migration inhibitory factor during embryogenesis.

Although macrophage migration inhibitory factor (MIF) was originally identified as a lymphokine that inhibits the migration of macrophages, its ubiquitous expression suggests it may have a role beyond the immune system. Here we report a detailed characterization of MIF expression during mouse embryogenesis. The MIF expression pattern was found to parallel tissues specification and organogenesis.

Functional specificity of Hoxa-4 in vertebral patterning lies outside of the homeodomain.

The Hox family of proteins plays a central role in establishing the body plan of a wide range of metazoan organisms. Each member of this family of transcriptional regulators has a distinct functional specificity, yet they bind to similar DNA target sequences through their conserved homeodomain. The mechanisms whereby Hox proteins achieve their diverse specificities in vivo remain undefined. Using the opposing effects of Hoxa-4 and Hoxc-8 in vertebral patterning, we demonstrate by replacing the homeodomain of Hoxa-4 with that of Hoxc-8 that the functional specificity of Hoxa-4 does not track with the homeodomain. These observations provide evidence that other regions of Hox proteins play an important role in mediating functional specificity during mammalian embryogenesis.

Gain of function mutations for paralogous Hox genes: implications for the evolution of Hox gene function.

To investigate the functions of paralogous Hox genes, we compared the phenotypic consequences of altering the embryonic patterns of expression of Hoxb-8 and Hoxc-8 in transgenic mice. A comparison of the phenotypic consequences of altered expression of the two paralogs in the axial skeletons of newborns revealed an array of common transformations as well as morphological changes unique to each gene. Divergence of function of the two paralogs was clearly evident in costal derivatives, where increased expression of the two genes affected opposite ends of the ribs. Many of the morphological consequences of expanding the mesodermal domain and magnitude of expression of either gene were atavistic, inducing the transformation of axial skeletal structures from a modern to an earlier evolutionary form. We propose that regional specialization of the vertebral column has been driven by regionalization of Hox gene function and that a major aspect of this evolutionary progression may have been restriction of Hox gene expression.

Expression of matrix metalloproteinase genes in transformed rat cell lines of high and low metastatic potential.

The enzymes that comprise the family of matrix metalloproteinases (MMPs) share the capacity to degrade extracellular matrix components. A large body of evidence indicates that certain members of this metalloproteinase gene family play critical roles in determining the malignant phenotype of solid tumors. We previously have derived transformed cell lines with vastly different metastatic potentials by transfecting different combinations of oncogenes into primary rat embryo cells. Conditioned medium from those cell lines was assayed by Western blot analysis for the production of four separate matrix metalloproteinases to see whether a correlation could be found between protease expression and the metastatic phenotype. The transformed rat embryo cell lines with high metastatic potential were found to produce high levels of the stromelysin 1 (MMP-3) and stromelysin 2 (MMP-10) proteases, while the nonmetastatic lines produced low or undetectable levels of these two enzymes. No correlation was seen between the metastatic phenotype of the cell lines and the level of expression of two other matrix metalloproteinases, the M(r) 72,000 type IV collagenase (MMP-2) and the M(r) 92,000 gelatinase (MMP-9). These data suggest that the differential regulation of the stromelysin proteases may contribute to the difference seen in the metastatic potential of these cell lines.

Transcriptional regulatory elements of the RAS2 gene of Saccharomyces cerevisiae.

We have analyzed a series of 5' deletions of the RAS2 gene to investigate its complex transcriptional regulation in the yeast Saccharomyces cerevisiae. Two positive transcriptional regulatory elements were identified. Element A regulates two of the three clusters of RAS2 transcripts. This element is capable of activating a heterologous promoter and contains two copies of the sequence CCTCGCCCC. Although one copy is sufficient for partial transcriptional activation, both copies are required for maximal RAS2 induction. Deletion of one copy resulted in a reduced level of RAS2 mRNA, selective loss of cluster II transcripts and reduced ability to activate the heterologous CYC1 promoter. Each of the 9 bp C rich repeats of element A is part of a sequence with extensive homology to a transcriptional regulatory element upstream of the human epidermal growth factor receptor (EGFR) gene. Element B contains a tandem duplication of a 21 nucleotide sequence TACATATATATATATCTTAG and activates cluster I RAS2 transcripts in the absence of Element A. The physiological role of these deletions was determined by assaying their ability to support growth on a nonfermentable carbon source. RAS2 promoter deletions containing either element A or B were able to overcome this growth defect characteristic of ras2 mutants cells. Deletion of both elements resulted in an insufficient amount of RAS2 protein for growth on a non-fermentable carbon source.

Two different protein kinase activities phosphorylate Ras2 protein in Saccharomyces cerevisiae.

In this report, we show that Ras2 protein in the yeast Saccharomyces cerevisiae is phosphorylated in vivo by protein kinase(s) and the phosphorylation is stable. Ras2 protein is phosphorylated by cAMP dependent protein kinase and by an additional protein kinase activity which is independent of cAMP levels.