Biophysical and molecular modeling evidences for the binding of sulfa molecules with hemoglobin.

The molecular mechanism of the heme protein, hemoglobin (Hb) interaction with sulfa molecule, sulfadiazine (SDZ) has been investigated through spectroscopic, neutron scattering and molecular modeling techniques. Absorption and emission spectroscopic studies showed that SDZ molecules were bound to Hb protein, non-cooperatively. The binding affinityof SDZ-Hb complex at standard experimental condition was evaluated to be around (4.2 ± 0.07) ×104, M-1with 1:1 stoichiometry. Drug induced structural perturbation of the 3 D protein moiety was confirmed through circular dichroism (CD), synchronous fluorescence and small angle neutron scattering methods. From the temperature dependent spectrofluorometric studies, the negative standard molar Gibbs energy change suggested the spontaneity of the reaction. The negative enthalpy and positive entropy change(s) indicated towards the involvement of both electrostatic and hydrophobic forces during the association process. Salt dependent fluorescence study revealed major contributions from non-poly-electrolytic forces. Molecular modeling studies determined the probable binding sites, types of interaction involved and the conformational alteration of the compactness of the Hb structure upon interaction with SDZ molecule. Overall, the study provides detailed insights into the binding mechanism of SDZ antibiotics to Hb protein.Communicated by Ramaswamy H. Sarma.

Heme Protein Binding of Sulfonamide Compounds: A Correlation Study by Spectroscopic, Calorimetric, and Computational Methods.

Protein-ligand interaction studies are useful to determine the molecular mechanism of the binding phenomenon, leading to the establishment of the structure-function relationship. Here, we report the binding of well-known antibiotic sulfonamide drugs (sulfamethazine, SMZ; and sulfadiazine, SDZ) with heme protein myoglobin (Mb) using spectroscopic, calorimetric, ζ potential, and computational methods. Formation of a 1:1 complex between the ligand and Mb through well-defined equilibrium was observed. The binding constants obtained between Mb and SMZ/SDZ drugs were on the order of 104 M-1. SMZ with two additional methyl (-CH3) substitutions has higher affinity than SDZ. Upon drug binding, a notable loss in the helicity (via circular dichroism) and perturbation of the three-dimensional (3D) protein structure (via infrared and synchronous fluorescence experiments) were observed. The binding also indicated the dominance of non-polyelectrolytic forces between the amino acid residues of the protein and the drugs. The ligand-protein binding distance signified high probability of energy transfer between them. Destabilization of the protein structure upon binding was evident from differential scanning calorimetry results and ζ potential analyses. Molecular docking presented the best probable binding sites of the drugs inside protein pockets. Thus, the present study explores the potential binding characteristics of two sulfonamide drugs (with different substitutions) with myoglobin, correlating the structural and energetic aspects.

Adaptable DNA-Interactive Probe Proficient at Selective Turn-On Sensing for Al3+: Insight from the Crystal Structure, Photophysical Studies, and Molecular Logic Gate.

The synthesized Schiff base ligand 3-hydroxy-N'-(2-hydroxy-3-methoxybenzylidene)-2-naphthohydrazide (H2NPV) is structurally characterized by single-crystal X-ray diffraction (XRD) and exhibits weak fluorescence in the excited state owing to the effect of excited-state-induced proton transfer (ESIPT). However, in the presence of Al3+, the ESIPT is blocked and chelation-enhanced fluorescence (CHEF) is induced because of complexation with the cations, resulting in turn-on emission for Al3+. The probe H2NPV selectively detects Al3+ among the various metal ions, and the detection limit is found to be 1.70 µM. The composition and modes of complex coordination were determined by spectroscopic, theoretical studies and molecular logic gate applications. Finally, DNA binding studies were performed by spectroscopic and calorimetric methods to elucidate possible bioactivity of H2NPV.

Biophysical and Thermodynamic Investigations on the Differentiation of Fluorescence Response towards Interaction of DNA: A Pyrene-Based Receptor versus Its Fe(III) Complex.

The Fe(III) complex [Fe(L)(NO3)(H2O)]+ (1) was prepared using a structurally characterized Schiff base ligand, 1-((pyren-1-ylimino) methyl) naphthalen-2-ol (HL), to develop an optical probe for fluorimetric recognition of DNA. An electrospray ionization-mass spectrometry (ESI-MS) study was carried out to ascertain the composition of 1 and the geometry of 1 was optimized by density functional theory (DFT) calculations. Compared to the strong intrinsic fluorescence of the ligand (HL), 1 was only weakly fluorescent. The interaction of 1 with DNA was investigated through different biophysical techniques. The fluorescence emission of 1 appeared to increase progressively in the presence of calf thymus (CT) DNA and this was utilized for the fluorimetric recognition of DNA. In comparison with 1, in the presence of DNA, the ligand HL showed quenching in its emission. The selectivity of 1 towards DNA was also confirmed in the presence of a large number of environmentally pertinent anions (NO3-, SO42-, Cl-, Br-, I-, OAC-, PO43-, ClO4-, HCO3-, H2PO4-, HPO42-, CO32-). Comprehensive DNA-binding experiments also showed that complex (1) and HL interacted with CT-DNA with different efficacies; the affinity of 1 was about six times higher than that of HL. Calorimetric studies showed that the 1-DNA association progressed with large positive entropy changes. In contrast, the association of HL with DNA was an enthalpy-driven process. Molecular docking results confirmed that the binding of 1 with CT-DNA progressed by intercalation and other noncovalent interactions.

Interaction of proflavine with the RNA polynucleotide polyriboadenylic acid-polyribouridylic acid: photophysical and calorimetric studies.

The binding of proflavine, an acriflavine derivative, with the RNA polynucletodide polyadenylic acid-polyuridylic acid is investigated here to understand the structural and thermodynamic basis of the binding process. Such binding data are crucial for designing viable theraperutic agents. Spectroscopic studies clearly suggest a strong binding interaction between proflavine and polyadenylic acid-polyuridylic acid leading to efficient energy transfer between the poly AU base pairs and proflavine. The stoichiometry of proflavine polyadenylic acid-polyuridylic acid binding was independently estimated by continuous variation analysis of Job. An intercalative binding model is envisaged for the binding from hydrodynamic studies. Circular dichroism experiments revealed that the binding induced conformational changes in the RNA, and also led to induction of optical activity in the bound dye molecules. The binding affinity of the complex was deduced to be (6.57 ± 0.75) 105 M-1 at (298.15 ± 0.10) K from isothermal titration calorimetry experiment. Positive entropy and negative enthalpy changes characterized the complexation. The binding was observed to be weaker both at higher temperatures and increased [Na+]. The affinity of binding decreased with increasing [Na+]. When the Gibbs energy was parsed between polyelectrolytic and nonpolyelectropytic components, it surprisingly revealed a higher role for the non-polyelectrolytic forces. These results present new data for developing RNA targeted ligands.Communicated by Ramaswamy H. Sarma.

Interaction of aloe active compounds with calf thymus DNA.

Natural anthraquinone compounds have emerged as potent anticancer chemotherapeutic agents because of their promising DNA-binding properties. Aloe vera is among one of the very well-known medicinal plants, and the anthraquinone derivatives like aloe emodin (ALM), aloins (ALN), and aloe emodin-8-glucoside (ALMG) are known to have immense biological activities. Here, we have used biophysical methods to elucidate the comparative DNA-binding abilities of these three molecules. Steady-state fluorescence study indicated complexation between calf thymus DNA (ctDNA) and both the molecules ALM and ALMG whereas ALN showed very weak interaction with DNA. Displacement assays with ctDNA-bound intercalator (ethidium bromide) and a groove binder (Hoechst 33258) indicated preferential binding of both ALM and ALMG to minor groove of DNA. Isothermal titration calorimetric (ITC) data suggested spontaneous exothermic single binding mode of both the molecules: ALM and ALMG. Entropy is the most important factor which contributed to the standard molar Gibbs energy associated with relatively small favorable enthalpic contribution. The equilibrium constants of binding to ctDNA were (6.02 ± 0.10) × 104  M-1 and (4.90 ± 0.11) × 104  M-1 at 298.15 K, for ALM and ALMG, respectively. The enthalpy vs temperature plot yielded negative standard molar heat capacity value, and a strong negative correlation between enthalpy and entropy terms was observed which indicates the enthalpy entropy compensation behavior in both systems. All these thermodynamic phenomena indicate that hydrophobic force is the key factor which is involved in the binding process. Moreover, the enhancement of thermal stability of DNA helix by ALM and ALMG fully agreed to the complexation of these molecules with DNA.

Effect of bovine serum albumin on tartrate-modified manganese ferrite nano hollow spheres: spectroscopic and toxicity study.

The emerging category of magneto-fluorescent tartrate-modified MnFe2O4 nano hollow spheres (T-MnFe2O4 NHSs) can be considered as promising candidates for biomedical applications. The interaction of bovine serum albumin (BSA) with T-MnFe2O4 NHSs has been studied using several spectroscopic techniques, which suggest that the interaction occurs by an electrostatic mechanism. Furthermore, BSA enhances the charge transfer transition from the tartrate ligand to the metal ions along with the d-d transition of Fe3+ ions on NHSs surfaces at different pH. Very strong salt bridge formation occurs between the lysine of the BSA surface and the tartrate in basic medium (pH 10), followed by the acidic (pH 3) and neutral medium (pH 7), respectively. Systematic fluorescence microscopic analysis reveals that BSA significantly enhances the contrast of T-MnFe2O4 NHSs in UV and blue light excitation because of the extended charge transfer from BSA to T-MnFe2O4 NHSs. Our report demonstrates great potential in the field of nanotechnology and biomedical applications. In vitro toxicity analysis using RAW 264.7 celline and in vivo studies on Wister rats revealed that the T-MnFe2O4 NHSs are benign. Furthermore, T-MnFe2O4 NHSs also appear to be an antimicrobial agent. Therefore, T-MnFe2O4 NHSs can be explored for future therapeutic applications.

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies.

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV-vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5'-(GGGTTAGGGTTAGGGTTAGGG)-3' was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 105 M-1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 105 M-1, and that of BER was (0.98 ± 0.03) × 105 M-1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex-berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.

Fluorescent ZnO-Au Nanocomposite as a Probe for Elucidating Specificity in DNA Interaction.

In this work, we report the interaction of a fluorescent ZnO-Au nanocomposite with deoxyribonucleic acid (DNA), leading to AT-specific DNA interaction, which is hitherto not known. For this study, three natural double-stranded (ds) DNAs having different AT:GC compositions were chosen and a ZnO-Au nanocomposite has been synthesized by anchoring a glutathione-protected gold nanocluster on the surface of egg-shell-membrane (ESM)-based ZnO nanoparticles. The ESM-based bare ZnO nanoparticles did not show any selective interaction toward DNA, whereas intrinsic fluorescence of the ZnO-Au nanocomposite shows an appreciable blue shift (Δλmax = 18 nm) in the luminescence wavelength of 520 nm in the presence of ds calf thymus (CT) DNA over other studied DNAs. In addition, the interaction of the nanocomposite through fluorescence studies with single-stranded (ss) CT DNA, synthetic polynucleotides, and nucleobases/nucleotides (adenine, thymine, deoxythymidine monophosphate, deoxyadenosine monophosphate) was also undertaken to delineate the specificity in interaction. A minor blue shift (Δλmax = 5 nm) in the emission wavelength at 520 nm was observed for single-stranded CT DNA, suggesting the proficiency of the nanocomposite for discriminating ss and ds CT DNA. More importantly, fluorescence signals from the nano-bio-interaction could be measured directly without any modification of the target, which is the foremost advantage emanated from this study compared with other previous reports. The AT base-pair-induced enhancement was also found to be highest for the melting temperature of CT DNA (ΔTmCT = 6.7 °C). Furthermore, spectropolarimetric experiments followed by calorimetric analysis provided evidence for specificity in AT-rich DNA interaction. This study would lead to establish the fluorescent ZnO-Au nanocomposite as a probe for nanomaterial-based DNA-binding study, featuring its specific interaction toward AT-rich DNA.

Comparative Study of Toluidine Blue O and Methylene Blue Binding to Lysozyme and Their Inhibitory Effects on Protein Aggregation.

A comparative binding interaction of toluidine blue O (TBO) and methylene blue (MB) with lysozyme was investigated by multifaceted biophysical approaches as well as from the aspects of in silico biophysics. The bindings were static, and it occurred via ground-state complex formation as confirmed from time-resolved fluorescence experiments. From steady-state fluorescence and anisotropy, binding constants were calculated, and it was found that TBO binds more effectively than MB. Synchronous fluorescence spectra revealed that binding of dyes to lysozyme causes polarity changes around the tryptophan (Trp) moiety, most likely at Trp 62 and 63. Calorimetric titration also depicts the higher binding affinity of TBO over MB, and the interactions were exothermic and entropy-driven. In silico studies revealed the potential binding pockets in lysozyme and the participation of residues Trp 62 and 63 in ligand binding. Furthermore, calculations of thermodynamic parameters from the theoretical docking studies were in compliance with experimental observations. Moreover, an inhibitory effect of these dyes to lysozyme fibrillogenesis was examined, and the morphology of the formed fibril was scanned by atomic force microscopy imaging. TBO was observed to exhibit higher potential in inhibiting the fibrillogenesis than MB, and this phenomenon stands out as a promising antiamyloid therapeutic strategy.

Effect of Zwitterionic Phospholipid on the Interaction of Cationic Membranes with Monovalent Sodium Salts.

Cationic lipids have attracted much attention because of their potential for biomedical applications, such as gene delivery. The gene transfection efficiency of cationic lipids is greatly influenced by the counterions as well as salt ions. We have systematically investigated the interaction of different monovalent sodium salts with positively charged membrane, composed of 1,2-dioleoyl- sn-glycero-3-phosphocholine (DOPC)/1,2-dioleoyl-3-trimethylammonium-propane (DOTAP) and DOTAP, using dynamic light scattering, zeta potential, isothermal titration calorimetry (ITC), and fluorescence spectroscopy techniques. Our results reveal that the affinity of anions with cationic membranes follows the sequence I- ≫ Br- > Cl- according to descending order of their sizes and is consistent with the Hofmeister series. Interestingly, the electrostatic behavior of the DOTAP membrane in the presence of monovalent anions differs significantly from the DOPC/DOTAP membrane. This difference is due to the strong interplay between phosphocholine and trimethylammonium-propane (TAP) headgroups leading to the reorientation of the TAP group in the membrane. The binding constant of anions, derived from zeta potential and ITC is in agreement with the affinity of anions mentioned above. Among all anions, I- shows strongest affinity, as evidenced from the rapid increase in hydrodynamic radius which eventually leads to the formation of large aggregates. The fluorescence spectroscopy of a lypophilic probe Nile red in the presence of cationic vesicles containing ions complements the I- adsorption onto the membrane. Nonlinear Stern-Volmer plot, consisting of accessible and inaccessible Nile red to I- is consistent with the zeta potential as well as ITC results.

Egg-shell derived carbon dots for base pair selective DNA binding and recognition.

The development of base pair selective fluorescent binding probes and their interaction mode with nucleic acids have created great interest for sensing and biomedical applications. Herein, we have used chicken egg shell membrane (ESM) as a cost effective easily available protein source for the synthesis of highly fluorescent carbon dots. The detailed characterizations have confirmed the in situ formation of heteroatom doped graphitic carbon nanodots (CDs) from ESM. The intrinsic fluorescence property of the material has been utilized for the label free binding of duplex deoxyribonucleic acid (DNA). The interaction of different natural and synthetic DNAs with carbon dots resulted in the enhancement of fluorescence characteristics of the latter. Analysis of the binding data obtained from steady state fluorescence studies revealed a selective and stronger affinity of CDs to the adenine-thymine (AT) base pair rich double stranded DNA (ds DNA) than that of the guanine-cytosine (GC) pair rich ds DNA. Base pair specific binding was further validated from isothermal titration calorimetry (ITC) and melting temperature data. The thermodynamic profile revealed endothermic binding that was driven by the hydrophobic interaction at the nano-bio interfaces. The results reveal the potential of carbon dots as a new and promising fluorescent probe for base pair selective and sequence specific DNA recognition.

Exploring the binding interaction of potent anticancer drug topotecan with human serum albumin: spectroscopic, calorimetric and fibrillation study.

This manuscript describes the interaction of the topoisomerase I inhibitor anticancer drug topotecan with human serum albumin using microcalorimetry, circular dichroism, and atomic force microscopy imaging techniques. Conformational change in albumin was ascertained from circular dichroism and synchronous fluorescence study that revealed a small but definitive partial unfolding of the protein structure upon drug binding. Isothermal titration calorimetry study indicated a favorable exothermic interaction with a binding affinity of the order of ~105 M-1 at 293.15 K. A 1:1 binding stoichiometry was established. The binding reaction was largely enthalpy dominated with negative standard molar Gibbs energy change. Ionic strength variation study revealed that non-polyelectrolytic forces played dominant role in the interaction and remained almost invariant at all salt concentrations. Upon complex formation, the stabilization of the protein structure against thermal denaturation occurred. Atomic force microscopy study enabled imaging of fibrils of the protein and its complex with topotecan.

Small molecule-RNA recognition: Binding of the benzophenanthridine alkaloids sanguinarine and chelerythrine to single stranded polyribonucleotides.

Single stranded RNAs are biologically potent as they participate in various key cellular processes. The binding efficacy of two potent anticancer alkaloids, sanguinarine (here after SANG) and chelerythrine (here after CHEL), with single-stranded ribonucleic acids poly(rI), poly(rG), and poly(rC) were studied using spectroscopic and thermodynamic tools. Results reveal that both SANG and CHEL binds well with single stranded RNAs with affinity in the order poly(rI)>poly(rG)>poly(rC). CHEL showed slightly higher affinity compared to SANG with all the single stranded RNAs. Both SANG and CHEL showed association affinity of the lower 106 order with poly(rI), higher 105 order binding with poly(rG) and lower 105 order with poly(rC). The binding mode was partial intercalation due to the staking interaction between the bases and the alkaloids. The complexation of both the SANG and CHEL to the RNAs were mainly enthalpy driven and also favoured by entropy changes. Perturbation was observed in the RNA conformation due to binding of the alkaloids. In this present study we have deciphered the fundamental structural and calorimetric aspects of the interaction of the natural benzophenanthridine alkaloids with single stranded RNAs and these results may help to develop new generation alkaloid based therapeutics targeting single stranded RNAs.

Interaction and inhibitory influence of the azo dye carmoisine on lysozyme amyloid fibrillogenesis.

The binding of the common food colorant carmoisine and its inhibitory effect on amyloid fibrillation in lysozyme have been investigated. Since humans are increasingly exposed to various food colorants like carmoisine, such studies are highly relevant. In the presence of lysozyme, the carmoisine absorption spectrum exhibited hypochromic changes. The intrinsic fluorescence of lysozyme was also quenched on interaction. Time-resolved fluorescence results suggested that the binding mechanism involved ground state complexation. The binding was predominantly dominated by non-polyelectrolytic forces. The molecular distance between the donor (lysozyme) and the acceptor (carmoisine), calculated from FRET theory, was found to be 3.37 nm, indicating that carmoisine binds close to Trp-62/63 residues in the ß-domain of the protein. Information on alterations in the microenvironment surrounding the Trp-residues was also obtained from synchronous fluorescence data. Carmoisine binding induced significant loss in the alpha helical organization of lysozyme. The binding, nevertheless, did not influence the thermal stability of lysozyme significantly. The binding reaction was exothermic and driven by large negative enthalpy and small but favourable entropic contributions. Thioflavin T assay, far-UV circular dichroism studies and AFM imaging profiles testified that carmoisine had a significant inhibitory effect on amyloid fibrillogenesis in lysozyme. Carmoisine also had a definitive defibrillating effect on existing fibrils. The results may provide new insights for designing new small molecule inhibitors for amyloid related diseases.

Targeting human telomeric G-quadruplex DNA with antitumour natural alkaloid aristololactam-ß-D-glucoside and its comparison with daunomycin.

Study on anticancer agents that act via stabilization of telomeric G-quadruplex DNA has emerged as novel and exciting field for anticancer drug discovery. The interaction of carbohydrate containing anticancer alkaloid aristololactam-ß-D-glucoside (ADG) with human telomeric G-quadruplex DNA sequence was characterized by different biophysical techniques. The binding parameters were compared with daunomycin (DAN), a well-known chemotherapeutic drug. The Scatchard binding isotherms revealed noncooperative binding for both with the binding affinity values of (1.01 ± 0.05) × 106 and (1.78 ± 0.18) × 106 M-1 for ADG and DAN, respectively. Circular dichroism, ferrocyanide quenching study, anisotropy study, thiazole orange displacement, optical melting, differential scanning calorimetry study, and molecular docking study suggest significant stacking and stabilizing efficiency of ADG with comparison to DAN. The energetics of the interaction for ADG and DAN revealed that both reactions were predominantly entropy driven. Negative heat capacity values were obtained from the temperature dependence of the enthalpy change. The standard molar Gibbs energy change exhibited only marginal alterations with temperature suggesting the occurrence of enthalpy-entropy compensation. These findings indicate that ADG can act as a stabilizer of telomeric G-quadruplex DNA and thereby can be considered as a potential telomerase inhibitor.

Small molecule induced poly(A) single strand to self-structure conformational switching: evidence for the prominent role of H-bonding interactions.

All messenger RNAs (mRNAs) have a polyadenylic acid tail that is added during post transcriptional RNA processing. Investigation of the structure-function and interactions of polyadenylic acid is an important area to target for cancer and related diseases. Jatrorrhizine and coptisine are two important isoquinoline alkaloids that are structurally very similar, differing only in the substituents on the isoquinoline chromophore. Here we demonstrate that these alkaloids differentially induce a self-structure in single stranded poly(A) using absorbance, thermal melting and differential scanning calorimetry experiments. Jatrorrhizine was found to be more effective than coptisine in binding to poly(A) from spectroscopy and calorimetry data. Molecular modeling results suggested the involvement of more H-bonds in the complexation of the former with poly(A). It appears that the presence of substituents on the alkaloid that can form H-bonding interactions with the adenine nucleotides may play a critical role in the binding and structural rearrangement of poly(A) into the self-structure. The atomic force microscopy data directly visualized the poly(A) self-structured network. We propose a plausible mechanism of the small molecule induced self-structure formation in poly(A). The results presented here may help in the design of effective poly(A) targeted molecules for therapeutic use.

Binding and Inhibitory Effect of the Dyes Amaranth and Tartrazine on Amyloid Fibrillation in Lysozyme.

Interaction of two food colorant dyes, amaranth and tartrazine, with lysozyme was studied employing multiple biophysical techniques. The dyes exhibited hypochromic changes in the presence of lysozyme. The intrinsic fluorescence of lysozyme was quenched by both dyes; amaranth was a more efficient quencher than tartrazine. The equilibrium constant of amaranth was higher than that of tartarzine. From FRET analysis, the binding distances for amaranth and tartrazine were calculated to be 4.51 and 3.93 nm, respectively. The binding was found to be dominated by non-polyelectrolytic forces. Both dyes induced alterations in the microenvironment surrounding the tryptophan and tyrosine residues of the protein, with the alterations being comparatively higher for the tryptophans than the tyrosines. The interaction caused significant loss in the helicity of lysozyme, the change being higher with amaranth. The binding of both dyes was exothermic. The binding of amaranth was enthalpy driven, while that of tartrazine was predominantly entropy driven. Amaranth delayed lysozyme fibrillation at 25 µM, while tartrazine had no effect even at 100 µM. Nevertheless, both dyes had a significant inhibitory effect on fibrillogenesis. The present study explores the potential antiamyloidogenic property of these azo dyes used as food colorants.

Naphthalenediimide-Linked Bisbenzimidazole Derivatives as Telomeric G-Quadruplex-Stabilizing Ligands with Improved Anticancer Activity.

Human telomeric G-quadruplex DNA stabilization has emerged as an exciting novel approach for anticancer drug development. In the present study, we have designed and synthesized three C2-symmetric bisubstituted bisbenzimidazole naphthalenediimide (NDI) ligands, ALI-C3 , BBZ-ARO, and BBZ-AROCH2 , which stabilize human telomeric G-quadruplex DNA with high affinity. Herein, we have studied the binding affinities and thermodynamic contributions of each of these molecules with G-quadruplex DNA and compared the same to those of the parent NDI analogue, BMSG-SH-3. Results of fluorescence resonance energy transfer and surface plasmon resonance demonstrate that these ligands have a higher affinity for G4-DNA over duplex DNA and induce the formation of a G-quadruplex. The binding equilibrium constants obtained from the microcalorimetry studies of BBZ-ARO, ALI-C3 , and BBZ-AROCH2 were 8.47, 6.35, and 3.41 µM, respectively, with h-telo 22-mer quadruplex. These showed 10 and 100 times lower binding affinity with h-telo 12-mer and duplex DNA quadruplexes, respectively. Analysis of the thermodynamic parameters obtained from the microcalorimetry study suggests that interactions were most favorable for BBZ-ARO among all of the synthesized compounds. The ΔGfree obtained from molecular mechanics Poisson-Boltzmann surface area calculations of molecular dynamics (MD) simulation studies suggest that BBZ-ARO interacted strongly with G4-DNA. MD simulation results showed the highest hydrogen bond occupancy and van der Waals interactions were between the side chains of BBZ-ARO and the DNA grooves. A significant inhibition of telomerase activity (IC50 = 4.56 µM) and induced apoptosis in cancer cell lines by BBZ-ARO suggest that this molecule has the potential to be developed as an anticancer agent.

Selective Binding of Genomic Escherichia coli DNA with ZnO Leads to White Light Emission: A New Aspect of Nano-Bio Interaction and Interface.

Here, we report for the first time, a novel and intriguing application of deoxyribonucleic acid (DNA) in the area of optics by demonstrating white light emission by tuning the emission of a nanomaterial, ZnO rods, exhibiting surface defects, in the presence of genomic Escherichia coli DNA with a comparatively high quantum efficiency. In order to understand the DNA specificity, we have also studied the interaction of ZnO with CT, and ML DNA, ss EC DNA, synthetic polynucleotides and different mononucleosides and bases. Further, in order to understand the effect of particle shape and defects present in ZnO, we have also extended our study with ZnO rods prepared at higher temperature exhibiting red emission and ZnO particles exhibiting yellow emission. Interestingly, none of the above studies resulted in white light emission from ZnO-DNA complex. Our studies unequivocally confirmed that the concentration and the nature of DNA and ZnO together plays a crucial role in obtaining CIE coordinates (0.33, 0.33) close to white light. The much enhanced melting temperature (Tm) of EC DNA and the energetics factors confirm enhanced hydrogen bonding of ZnO with EC DNA leading to a new emission band. Our experimental observations not only confirm the selective binding of ZnO to EC DNA but also open a new perspective for developing energy saving light emitting materials through nano-bio interactions.