Vascular Damage and Repair - Are Small-Diameter Vascular Grafts Still the "Holy Grail" of Tissue Engineering?

Cardiovascular diseases are the most important cause of morbidity and mortality in the civilized world. Stenosis or occlusion of blood vessels leads not only to events that are directly life-threatening, such as myocardial infarction or stroke, but also to a significant reduction in quality of life, for example in lower limb ischemia as a consequence of metabolic diseases. The first synthetic polymeric vascular replacements were used clinically in the early 1950s. However, they proved to be suitable only for larger-diameter vessels, where the blood flow prevents the attachment of platelets, pro-inflammatory cells and smooth muscle cells on their inner surface, whereas in smaller-diameter grafts (6 mm or less), these phenomena lead to stenosis and failure of the graft. Moreover, these polymeric vascular replacements, like biological grafts (decellularized or devitalized), are cell-free, i.e. there are no reconstructed physiological layers of the blood vessel wall, i.e. an inner layer of endothelial cells to prevent thrombosis, a middle layer of smooth muscle cells to perform the contractile function, and an outer layer to provide innervation and vascularization of the vessel wall. Vascular substitutes with these cellular components can be constructed by tissue engineering methods. However, it has to be admitted that even about 70 years after the first polymeric vascular prostheses were implanted into human patients, there are still no functional small-diameter vascular grafts on the market. The damage to small-diameter blood vessels has to be addressed by endovascular approaches or by autologous vascular substitutes, which leads to some skepticism about the potential of tissue engineering. However, new possibilities of this approach lie in the use of modern technologies such as 3D bioprinting and/or electrospinning in combination with stem cells and pre-vascularization of tissue-engineered vascular grafts. In this endeavor, sex-related differences in the removal of degradable biomaterials by the cells and in the behavior of stem cells and pre-differentiated vascular cells need to be taken into account. Key words: Blood vessel prosthesis, Regenerative medicine, Stem cells, Footprint-free iPSCs, sr-RNA, Dynamic bioreactor, Sex-related differences.

Health safety of parabens evaluated by selected in vitro methods.

Seven selected parabens (4 allowed, 3 banned in cosmetics) were tested in order to confirm and expand historical data on their toxicological properties and safety. The aim was to apply novel in vitro methods, which have been sufficiently technically and scientifically validated for the purposes of toxicological testing of chemicals. The study included several toxicological endpoints such as skin/eye irritation, skin sensitization, endocrine disruption and genotoxicity. The battery of selected methods comprised regulatory accepted EpiDerm™ skin model (OECD TG 439); EpiOcular™ corneal model (OECD TG 492) and scientifically valid test method HET-CAM (DB-ALM Protocol No. 47); in chemico test DPRA (OECD TG 442C); in vitro test LuSens (OECD TG 442D) and in vitro test h-CLAT (OECD TG 442E); Ames MPF™ (Xenometrix) and XenoScreen YES/YAS (Xenometrix). Overall, none of the 4 allowed parabens exhibited skin/eye irritation or genotoxicity. However, all allowed parabens in cosmetics were predicted as samples with potentially sensitizing properties in the LuSens and h-CLAT test methods, but not confirmed by DPRA. Endocrine disruption was recorded only at high concentrations, whereas methyl paraben and ethyl paraben exhibited the lowest activity. This study confirmed the safety of use of the allowed parabens in the highest recommended concentrations in cosmetics or pharmaceuticals.

Safety testing of adult novelties using in vitro methods.

Despite widespread and prolonged use of adult novelties, their health safety is not regularly tested or legally regulated. In the EU, adult novelties are subjected to the General Product Safety Directive, placing the burden of proof regarding safe products onto the manufacturers. The aim of our pilot study was to expand knowledge on potential application of in vitro methods for hazard prediction of extracts from final products. We subjected extracts of 20 adult novelties, purchased on the Czech market to toxicological tests including NRU cytotoxicity assay, sensitization tests DPRA and LuSens and the YES/YAS endocrine assay. Four samples produced cytotoxicity. Sensitization potential was recorded by DPRA (three samples) while the LuSens reported ten samples. Regarding endocrine disruption, three samples produced antiestrogen and antiandrogen effects. Six samples exhibited androgenic potential and one sample showed estrogenic potential. Positive results with possible health effects were recorded repeatedly for samples made of ABS, PVC and latex. The study has confirmed promising usefulness of our test methods combination with regard to safety testing of this type of consumer products. The results should be evaluated with care, however, the data bring added-value to the limited knowledge of mixture toxicology and are indicative for further testing.

Comparison of methods used for evaluation of mutagenicity/genotoxicity of model chemicals - parabens.

Growing worldwide efforts to replace (reduce) animal testing and to improve alternative in vitro tests which may be more efficient in terms of both time, cost and scientific validity include also genotoxicity/mutagenicity endpoints. The aim of the review article was to summarize currently available in vitro testing approaches in this field, their regulatory acceptance and recommended combinations for classification of chemicals. A study using the combination of Comet Assay performed on two cell lines and the Chromosomal Aberration test on human peripheral lymphocytes was performed with the aim to predict the genotoxic potential of selected paraben esters, serving as a model chemical group. Parabens are widely used in consumer products as preservatives and have been reported to exhibit inconclusive results in numerous genotoxicity studies. The Comet Assay identified Ethylparaben and Benzylparaben as potentially genotoxic. The Chromosomal Aberration test revealed weak genotoxic potential in case of Ethylparaben and positive genotoxicity in case of Butylparaben, Propylparaben and Isopropylparaben. The main reasons for variability seem to be limited water solubility of parabens, determining their bioavailability at the cellular level, and absence of metabolic activation in the Comet Assay. The results confirmed that the Comet Assay should serve as a screening test and should not be used as a stand-alone method for classification of genotoxicity. The weight of evidence approach in risk assessment should be supported with data generated with the use of human relevant in vitro methods based on cells / tissues of human origin.

Advanced characterization of natural biofilm on nanofiber scaffold.

Nanofiber scaffolds provide numerous advantages over common carriers engineered for microorganisms. The most important advantage is an increased speed of primary surface colonization (up to four times faster), which shortens the time required for the areal biofilm formation and optimum performance of attached microorganisms (higher efficiency of biological activity of up to twice as fast). Image analysis predicts early formation of biofilm even in beginning stages; analysis of biofilm reveals the different structures of bacterial colonies on both scaffolds (higher porosity, size, and number of bacterial colonies on nanofiber's surface). The image analysis correlates well with determinations of dry matter (linear correlation of 0.96) and proteins (linear correlation of 0.89).

Nosocomial candidemia in the Czech Republic in 2012-2015: results of a microbiological multicentre study.

  Background: Candidemia is a severe and often life-threatening infection frequently occurring in critically ill patients. During the last decade, new therapeutic and prophylactic strategies influenced (at least in some patient subgroups) the epidemiological situation and the spectrum of causative Candida strains. The present multicentre study aimed to assess the current epidemiological situation of Candida strains causing invasive candidiasis (IC) in patients of tertiary care hospitals in the Czech Republic. MATERIAL AND METHODS: Clinical and microbiological data on patients with bloodstream yeast isolates collected in 11 tertiary care hospitals in the Czech Republic between 2012 and 2015 were analysed. The incidence of cases and species distribution were assessed by study year, age, and specialty. Moreover, an association with the Candida colonization and presence of toxigenic strains of Clostridium difficile in stool prior to blood culture positivity was analysed. For some of the strains, minimum inhibitory concentrations (MICs) of systemic antifungals were determined using standard methods. RESULTS: A total of 886 episodes of candidemia (921 yeast strains) were identified during the study period. The overall incidence per 1000 admissions was 0.40 (range 0.21-1.22 depending on the hospital). Almost half of the isolates belonged to the species Candida albicans (49.7 %), followed by Candida glabrata (15.3 %) and Candida parapsilosis (11.2 %). Non-albicans species of Candida significantly predominated in oncology wards (71.6 %) as compared to surgery (40.4 %) or internal medicine (52.0 %) departments. More than 70.0 % of patients stayed in intensive care units at the time of positive culture; in 65.0 % of patients, colonization with the same yeast species preceded blood culture positivity. In only 5.1 % of all patients, the previous presence of toxigenic strains of Clostridium difficile in stool was found. Fifty-six of the 921 yeast strains were tested for antifungal susceptibility, with an increase in MICs to azoles being observed for C. glabrata. CONCLUSION: The incidence of candidemia in the Czech Republic did not vary significantly between 2012 and 2015, and C. glabrata was the second most common yeast species after C. albicans isolated from blood.

Diagnostic value of serum galactomannan, (1,3)-ß-d-glucan, and Aspergillus fumigatus-specific IgA and IgG assays for invasive pulmonary aspergillosis in non-neutropenic patients.

Detection of serum galactomannan (GM) and (1,3)-ß-d-glucan (BG) is considered useful for non-culture diagnosis of invasive pulmonary aspergillosis (IPA) in neutropenic patients. Only few studies evaluated these seromarkers in non-neutropenic patients suspected of having IPA. The aim of this study was to evaluate both tests together with the Aspergillus fumigatus-specific serum IgG and IgA (IgAG) test for serological IPA diagnosis in non-neutropenic patients. Sera from 87 patients suspected of having IPA were retrospectively analysed. Patients were categorised into groups of proven IPA (n = 10), putative IPA (n = 31) and non-IPA colonisation (n = 46). When the GM, BG and IgAG assays were used for patients included in the study, the sensitivity/specificity/positive predictive value (PPV)/negative predictive value (NPV) were 48.8%/91.3%/83.3%/66.7%, 82.9%/73.9%/73.9%/82.9% and 75.6%/95.7%/93.9%/81.5%, respectively. Thus, the highest specificity and PPV were confirmed for the IgAG assay. Improvements in the sensitivity and NPV were achieved by "at least one positive" analysis with the GM and BG assays, with the sensitivity/specificity/PPV/NPV values being 85.0%/69.6%/71.4%/84.2%. Nevertheless, the highest sensitivity and NPV were achieved by the "at least one positive" analysis combining the GM, BG and IgAG tests (97.6% and 96.8%, respectively). The involvement of the IgAG assay could improve IPA diagnosis in non-neutropenic patients by increasing the sensitivity and NPV when combined with the GM or BG assays. Furthermore, improvement was achieved by combining the GM, BG and IgAG assays using the "at least one positive test" strategy, especially if doubt exists.

[The prevalence of Candida pelliculosa, Candida utilis, and Candida fabianii in the Olomouc University Hospital: epidemiological study]. / Prevalence Candida pelliculosa, Candida utilis a Candida fabianii ve Fakultní nemocnici Olomouc - epidemiologická studie.

BACKGROUND: The aims of this study were to determine the prevalence of C. pelliculosa, C. utilis, and C. fabianii in clinical samples collected from patients hospitalized in the Olomouc University Hospital and compare their minimum inhibitory concentrations (MICs ) to nine systemic antifungals with respect to yeast species, patient age, gender, and site of infection. MATERIAL AND METHODS: Identification was performed biochemically and using mass spectrometry (MALDI-TOF MS). MICs were determined by the broth dilution method. RESULTS: Of a total of 163 clinical isolates, 119 were biochemically identified as C. pelliculosa and 44 as C. utilis. Using MALDI-TOF MS, 152 isolates were identified as C. fabianii, six as C. pelliculosa, three as C. utilis, and one as Ogataea polymorpha. The highest mean MICs were found in C. fabianii and in yeasts isolated from blood cultures and central venous catheters. CONCLUSIONS: The MALDI-TOF MS found C. fabianii to be most prevalent in clinical samples as compared with the other studied species. The probable cause of discordant results between the two methods was the absence of C. fabianii in the database of the biochemical test kit which led to misidentification of this species. Higher MIC values in C. fabianii demonstrate the importance of the precise identification of this species.

High frequency of Candida fabianii among clinical isolates biochemically identified as Candida pelliculosa and Candida utilis.

Clinical yeast isolates belonging to Candida pelliculosa, Candida utilis and Candida fabianii are difficult to distinguish in a routine mycology laboratory using common biochemical tests. The aims of this study were to determine the prevalence of C. pelliculosa, C. utilis and C. fabianii in clinical samples and to compare their minimum inhibitory concentrations (MICs) to systemic antifungals. Two hundred and forty-eight clinical yeast isolates obtained from eight large hospitals in the Czech Republic were included in this study. Identification was performed biochemically using ID 32C kit and by MALDI-TOF MS. MICs were determined using colorimetric broth dilution Sensititre YeastOne panels. From a total number of 248 isolates, 175 were identified as C. pelliculosa and 73 as C. utilis using the biochemical kit. In contrast, MALDI-TOF MS identified 222 isolates as C. fabianii, 20 as C. pelliculosa and 6 as C. utilis. The highest mean MICs were found in C. fabianii and, regardless of the studied species, in isolates from blood cultures and central venous catheters. MALDI-TOF MS revealed C. fabianii to be most prevalent in clinical samples as compared with the other studied species. Higher MIC values in C. fabianii support the importance of correct identification of this species.

First Report of Broad bean wilt virus-2 in Pepper in the Czech Republic.

In August 2012, field-grown pepper (Capsicum annuum) plants were inspected for the presence of viral diseases in Moravia, Czech Republic. Leaves taken from plants showing virus-like symptoms were examined for the presence of pepper viruses by double antibody sandwich (DAS)-ELISA. Of the 80 collected samples, 22 were infected with Cucumber mosaic virus, 17 with Potato virus Y, 13 with Broad bean wilt virus-1, and 11 with Broad bean wilt virus-2 (BBWV-2). The BBWV-2 positive samples were collected near the villages of Hrádek and Tasovice in Znojmo District and Lodenice in Brno-Country District. Six samples positive for BBWV-2 were also infected with one or two other viruses. BBWV-2 was mechanically transmitted from the field-collected samples where it was present alone onto Chenopodium quinoa plants. After systemic mottling emerged on indicator plants, symptomatic leaves were collected and the presence of BBWV-2 was confirmed by electron microscopy and reverse transcriptase (RT)-PCR. Isometric particles of about 25 nm corresponding in size and shape to the BBWV-2 virions (2) were observed. Total RNA was extracted from infected C. quinoa leaves, and RT-PCRs with primer pairs specific to four BBWV-2 genome regions (1) were carried out using oligo-dT and random hexamer mixtures for the cDNA synthesis. Amplicons of expected sizes, ~400 bp for Fab5'R1, ~460 bp for Pol2, ~500 bp for MP4, and ~250 bp for SCP were obtained for all samples. To the best of our knowledge, this is the first report of a natural occurrence of BBWV-2 in the Czech Republic. References: (1) R. M. Ferrer et al. Arch. Virol. 156:1445, 2011. (2) V. Lisa and G. Boccardo. The Plant Viruses 5:229. Plenum Press, New York, 1996.

Evaluation of Selected Cucurbitaceous Vegetables for Resistance to Zucchini yellow mosaic virus.

Zucchini yellow mosaic virus (ZYMV) causes considerable losses of cucurbitaceous vegetables grown nearly all over the world; indeed, the commonly planted cultivars are highly susceptible to ZYMV. In all, 3 cultivars of American and 8 of European summer squash (Cucurbita pepo), and 6 Japanese and 21 European cucumber lines (Cucumis sativus), including both slicing and pickling species, were selected for the evaluation of their resistance to the most virulent Czech strain, ZYMV-H (GenBank accession number DQ144054). Butternut squash (Cucurbita moschata) 'Menina 15', Chinese slicing cucumber 'Taichung Mou Gua-1' (TMG-1), and watermelon (Citrullus lanatus) accession PI 595203 were included in the experiment, because they were reported to be resistant to ZYMV. The tested plants were mechanically inoculated by ZYMV-H and their resistance was assessed through a comparison of the relative virus protein concentrations and visual symptoms. Butternut squash Menina 15, Chinese slicing cucumber TMG-1, Japanese slicing cucumber breeds 'G22' and 'A192-18', and watermelon PI 595203 were evaluated as immune: the virus concentration in their leaves was zero, as verified by polymerase chain reaction. American summer squash 'Cougar' and Japanese slicing cucumber breeds 'A202-18', 'R10', and 'S93-18' were clearly resistant, because the virus multiplied at a low rate in these plants. The remaining tested cultivars were tolerant or susceptible to ZYMV.

First Report of Cucurbit aphid-borne yellows virus in Squash in the Czech Republic.

A yellowing of buttercup squash (Cucurbita pepo L. var. oleifera Pietsch) leaves was observed on plants in southern Moravia, the main squash-growing area of the Czech Republic. Forty leaf samples were collected in September 2009 and examined for the presence of possible cucurbit viruses by double-antibody sandwich-ELISA. Thirty-three samples were infected with Zucchini yellow mosaic virus and five with Cucurbit aphid-borne yellows virus (CABYV). The positive samples of CABYV originated near the villages of Josefov and Prusánky (one per sample) and Rakvice (three samples), and the virus isolates were named Jos-5, Pr-15, Rak-1, Rak-4, and Rak-5, respectively. CABYV was immediately transmitted from leaves collected in the field to summer squash (Cucurbita pepo L. convar. giromontiina Grebenscikov) plants by aphids in a persistent manner. Green peach aphids, Myzus persicae (Sulzer), were used to inoculate squash plants with acquisition and inoculation feeding times of 2 and 5 days, respectively. Twenty-one plants were inoculated with 20 aphids per plant. Transmission was successful in 25% of the plants as assessed by ELISA. Infected plants showed very mild yellowing 2 weeks after transmission and were shorter compared with noninoculated controls. Leaf samples of newly infected plants were examined by electron microscopy and isometric particles of approximately 25 nm in diameter, corresponding in size and shape to described particles of CABYV (3), were observed. The presence of CABYV was verified by reverse transcription (RT)-PCR using a primer pair specific to the CABYV coat protein gene (2). The amplicons were sequenced (GenBank Accession Nos. HM771269-HM771273) and 100% sequence identity was found between isolates Jos-5 and Pr-15 and among the isolates Rak-1, Rak-2, and Rak-3. Sequence identity between these two groups was 99.3%. Blast analysis (4) showed that the Czech CABYV isolates are closely related to the Slovak isolates SK-1 (Accession No. FJ428797) and IR-3 (Accession No. FJ428800) with nucleotide sequence identities of 99.6 and 99.1%, respectively. These results indicate a similar origin between the Czech and Slovak isolates. To our knowledge, this is the first report of the natural occurrence of CABYV in the Czech Republic. CABYV is a widespread virus that reduces the yield of cucurbit vegetables (1). Protection against epidemics should be based on the control of aphid vectors, protecting plants with very fine mesh netting, keeping the cultivation area free of weeds, or planting cultivars resistant to CABYV. References: (1) Anonymous. Research Report 1995-1996, 117. Vegetable Breeding Station, INRA, Montfavet, France, 1998. (2) M. Juarez at al., Plant Dis. 88:907, 2004. (3) H. Lecoq et al. Plant Pathol. 41:749, 1992. (4) Z. Zhang Z. et al. J. Comput. Biol. 7:203, 2000.

First Report of Squash Mosaic Virus in Ornamental Pumpkin in the Czech Republic.

In August 2010, yellow mosaic and leaf deformation were observed on leaves of field planted ornamental pumpkin (Cucurbita pepo L. convar. microcarpina Grebenscikov) plants near Tasovice Village in the Znojmo District of the Czech Republic. These symptoms were typical of a virus infection. Nine leaf samples were collected and examined for the presence of commonly occurring cucurbit viruses by double-antibody sandwich (DAS)-ELISA. Eight samples were infected with Zucchini yellow mosaic virus (ZYMV), seven with Watermelon mosaic virus-2 (WMV-2), five with Cucumber mosaic virus (CMV), and two with Squash mosaic virus (SqMV). Some aphid species were observed on inspected plants but we did not carried out a search for vectors. SqMV isolates, Tas-1 and Tas-5, were also infected with ZYMV and WMV-2. SqMV was separated from the other viruses by mechanical inoculation onto the resistant plant species Cucumis sativus L. 'Taichung Mou Gua-1', which is resistant to ZYMV and WMV-2 (3). The virus was transmitted back to C. pepo plants, and DAS-ELISA used for testing for multiple viruses proved the presence of SqMV alone. A C. pepo leaf sample was examined by electron microscopy to validate the presence of the virus. Isometric particles of approximately 30 nm in diameter, corresponding in size and shape to the described particles of SqMV (2), were observed. The presence of SqMV was verified by reverse transcription (RT)-PCR using specific primers designed on the sequence for coat proteins of SqMV found in NCBI and EMBL databases (SqMV-F: TGTGTACAAGATTGGTGGAGATGC; SqMV-R: AGGCTTCTAAAGCGAACTGGG). The obtained amplicons of approximately 1,900 bp were sequenced (GenBank Accession No. JF922966), and by using nucleotide blast analysis (4), identified as a part of RNA-2 genome. Blast analysis showed that the Czech SqMV isolates, Tas-1 and Tas-5, were identical and similar to published SqMV sequences from the United States, Japan, and China. The highest similarity was found between the Czech isolates and one isolate from the United States (Accession No. M96148; E = 0, nucleotide sequence identity = 90%) and one from China (Accession No. AF059533; E = 0, nucleotide sequence identity = 90%). To our knowledge, this is the first report of a natural occurrence of SqMV in the Czech Republic. SqMV can be transmitted via infected seeds by as much as 35% (1); therefore, protection against epidemics should be based on clean seed programs. References: (1) M. Alvarez et al. Phytopathology 68:257, 1978. (2) H. M. Mazzone et al. Biochim. Biophys. Acta 55:164, 1962. (3) T. Wai et al. J. Hered. 88:454, 1997. (4) Z. Zhang et al. J. Comput. Biol. 7:203, 2000.

The study of surface properties of an IgE-sensitive aptasensor using an acoustic method.

We applied the acoustic transverse shear mode (TSM) method for study of the surface properties of a DNA aptasensor that specifically binds human immunoglobulin E (IgE). The biotinylated 45-mer DNA aptamers were immobilized on the surface of a self-assembled layer composed of a mixture of polyamidoamine dendrimers of the fourth generation with 1-hexadecanetiol covered by neutravidin. Using the TSM method, we studied the kinetics of changes of the series resonant frequency, f(s), and the motional resistance, R(m), of a quartz crystal transducer, used as a support for formation of the sensing layer. We have shown that attachment of the biotinylated DNA aptamers onto the surface covered by neutravidin results in a decrease of f(s), but in an increase of R(m). Similar changes of f(s) and R(m) were observed following addition of IgE. This suggests the contribution of friction forces to the crystal oscillation, which was taken into account in the calculation of the mass changes at the sensor surface following binding processes.

[Tuberculosis in the Czech Republic]. / Tuberkulóza v Ceské republice a ve svete.

Tuberculosis is a general infectious inflammatory disease caused by the bacillus (mycobacterium) tuberculosis. The disease originated when the bacillus was transmitted from affected cattle herds to humans. Genetic methods proved the existence of tuberculosis in mummies of the ancient Egypt. In the 19th and 20th century socio-economic conditions enabled pandemics of tuberculosis. The essential element for spreading of tuberculosis is the tuberculous patient. The disease develops in 10% of those who were infected. Tuberculosis manifests by long-lasting coughing, night sweating, tiredness, growing slim, febriles and loss of appetite. Diagnosis can be established on the basis of thoracic sciagram, confirmed by microscopic and cultivation examination of sputum. In the Czech Republic, an effective surveillance of tuberculosis was established with resulting good epidemiological situation.

[Cryptogenic fibrotizing alveolitis]. / Kryptogenní fibrotizující alveolitida.

Presented article deals with the pathogenesis of cryptogenic fibrotizing alveolitis (CFA), gives distinct histological types according ATS and ERS, considers clinical CFA picture and recommends examination program for this disease. The anti-inflammatory and immunosuppressive treatment is discussed together with other therapeutic approaches (long-lasting oxygenotherapy at home, transplantation and treatment of pulmonary hypertension). Final part deals with less frequent clinical manifestations.

Activation and modulation of ligand-gated ion channels.

Ligand-gated ionic channels are integral membrane proteins that enable rapid and selective ion fluxes across biological membranes. In excitable cells, their role is crucial for generation and propagation of electrical signals. This survey describes recent results from studies performed in the Department of Cellular Neurophysiology, Institute of Physiology ASCR, aimed at exploring the conformational dynamics of the acetylcholine, glutamate and vanilloid receptors during their activation, inactivation and desensitization. Distinct families of ion channels were selected to illustrate a rich complexity of the functional states and conformational transitions these proteins undergo. Particular attention is focused on structure-function studies and allosteric modulation of their activity. Comprehension of the fundamental principles of mechanisms involved in the operation of ligand-gated ion channels at the cellular and molecular level is an essential prerequisite for gaining an insight into the pathogenesis of many psychiatric and neurological disorders and for efficient development of novel specifically targeted drugs.

Properties of mixed alkanethiol-dendrimer layers and their applications in biosensing.

We studied the properties of mixed alkanethiol-dendrimer layers on a gold support and their application in biosensing. We showed that properties of glucose sensor can be modified using a different ratio of 1-hexadecanethiol (HDT) and poly(amidoamine) dendrimer of first generation (G1). The cyclic voltammetry in the presence of the redox couple, Fe(CN)(6)(3-)/Fe(CN)(6)(4-), was used for estimating how effectively the layer blocks the redox probe's access to the electrode surface. A scanning electrochemical microscope (SECM) was used to image the resulting distribution of the organic compounds. We found that with increasing content of dendrimers, the integrity of the layers was improved.

[Lymphangioleiomyomatosis in a menopausal woman]. / Lymfangioleiomyomatóza u zeny v menopauze.

Lymphagioleiomyomatosis is a rare pulmonary disease which affects mainly women of childbearing age. An observation of lymphangiomyomatosis in a menopausal woman or in men is considered very unusual. We report a case of lymphagioleiomyomatosis in a 60-year-old woman.

Effects of oxidation on changes of compressibility of bovine serum albumin.

The methods of ultrasound velocity and density measurements were used to study the adiabatic compressibility of bovine serum albumin (BSA) during its oxidation by the prooxidants Cu2+ and 2,2'-azobis(2-amidinopropane) hydrochloride (AAPH). We did not find changes of compressibility of BSA in the presence of copper ions at rather high molar ratio Cu2+/BSA = 0.66 mol/mol. This can be explained by binding of the Cu2+ to the binding site of BSA and thus protecting the prooxidant action of the copper. However, AAPH-mediated oxidation of BSA resulted in an increase of its apparent specific compressibility (psik/beta0). These changes could be caused by the fragmentation of the protein.