Combined Effects of Pressure and Ionic Strength on Protein-Protein Interactions: An Empirical Approach.

Proteins are exposed to hydrostatic pressure (HP) in a variety of ecosystems as well as in processing steps such as freeze-thaw, cell disruption, sterilization, and homogenization, yet pressure effects on protein-protein interactions (PPIs) remain underexplored. With the goal of contributing toward the expanded use of HP as a fundamental control parameter in protein research, processing, and engineering, small-angle X-ray scattering was used to examine the effects of HP and ionic strength on ovalbumin, a model protein. Based on an extensive data set, we develop an empirical method for scaling PPIs to a master curve by combining HP and osmotic effects. We define an effective pressure parameter that has been shown to successfully apply to other model protein data available in the literature, with deviations evident for proteins that do not follow the apparent Hofmeister series. The limitations of the empirical scaling are discussed in the context of the hypothesized underlying mechanisms.

Neutron Scattering Analysis of Cryptococcus neoformans Polysaccharide Reveals Solution Rigidity and Repeating Fractal-like Structural Patterns.

Cryptococcus neoformans is a fungal pathogen that can cause life-threatening brain infections in immunocompromised individuals. Unlike other fungal pathogens, it possesses a protective polysaccharide capsule that is crucial for its virulence. During infections, Cryptococcus cells release copious amounts of extracellular polysaccharides (exo-PS) that interfere with host immune responses. Both exo-PS and capsular-PS play pivotal roles in Cryptococcus infections and serve as essential targets for disease diagnosis and vaccine development strategies. However, understanding their structure is complicated by their polydispersity, complexity, sensitivity to sample isolation and processing, and scarcity of methods capable of isolating and analyzing them while preserving their native structure. In this study, we employ small-angle neutron scattering (SANS) and ultra-small-angle neutron scattering (USANS) for the first time to investigate both fungal cell suspensions and extracellular polysaccharides in solution. Our data suggests that exo-PS in solution exhibits collapsed chain-like behavior and demonstrates mass fractal properties that indicate a relatively condensed pore structure in aqueous environments. This observation is also supported by scanning electron microscopy (SEM). The local structure of the polysaccharide is characterized as a rigid rod, with a length scale corresponding to 3-4 repeating units. This research not only unveils insights into exo-PS and capsular-PS structures but also demonstrates the potential of USANS for studying changes in cell dimensions and the promise of contrast variation in future neutron scattering studies.

Neutron Scattering Analysis of Cryptococcus neoformans Polysaccharide Reveals Solution Rigidity and Repeating Fractal-like Structural Patterns.

Cryptococcus neoformans is a fungal pathogen that can cause life-threatening brain infections in immunocompromised individuals. Unlike other fungal pathogens, it possesses a protective polysaccharide capsule that is crucial for its virulence. During infections, Cryptococcus cells release copious amounts of extracellular polysaccharides (exo-PS) that interfere with host immune responses. Both exo-PS and capsular-PS play pivotal roles in Cryptococcus infections and serve as essential targets for disease diagnosis and vaccine development strategies. However, understanding their structure is complicated by their polydispersity, complexity, sensitivity to sample isolation and processing, and scarcity of methods capable of isolating and analyzing them while preserving their native structure. In this study, we employ small-angle neutron scattering (SANS) and ultra-small angle neutron scattering (USANS) for the first time to investigate both fungal cell suspensions and extracellular polysaccharides in solution. Our data suggests that exo-PS in solution exhibits collapsed chain-like behavior and demonstrates mass fractal properties that indicate a relatively condensed pore structure in aqueous environments. This observation is also supported by scanning electron microscopy (SEM). The local structure of the polysaccharide is characterized as a rigid rod, with a length-scale corresponding to 3 to 4 repeating units. This research not only unveils insights into exo-PS and capsular-PS structures but also demonstrates the potential of USANS for studying changes in cell dimensions and the promise of contrast variation in future neutron scattering studies.

High Pressure Light Scattering of Therapeutic Proteins To Probe Aggregation and Protein-Protein Interactions.

There is interest in the direct in situ measurement of protein aggregation and reversible protein-protein interactions at high pressure as a means to assess protein stability. This is currently limited by the availability of in-house analytical methods. High-pressure (HP) scattering instrumentation (using either neutrons, X-rays, or light sources) are relatively rare, due to extensive development hurdles and lack of standardization. This report focuses on design, operation, and application of a new HP light scattering apparatus based on commercially available equipment with a view to wider applications. HP static light scattering results were obtained for two monoclonal antibodies (MAbs) that exhibit different extents of unfolding and aggregation at these conditions. Aggregation that was observed during in situ pressure incubations varied by MAb and total ionic strength of solution. This was conducted in tandem with ex situ measurements on MAb solutions that were incubated under pressure, where monomer loss was measured with size exclusion chromatography. Pressure cycling was also used to assess the extent of pressure-induced reversible and irreversible aggregation. Finally, the ability of the HP light scattering apparatus to assess the influence of pressure on reversible protein-protein interactions in the canonical sense of second osmotic virial coefficients was assessed using lysozyme, a relatively well-characterized protein under hydrostatic pressure. The method offers a convenient and reproducible capability that complements current small angle neutron/X-ray instrumentation, providing measurements that can be used to optimize the planning and interpretation of scattering data from synchrotron or neutron research facilities. Our results address a growing demand to characterize protein aggregates and aggregation-prone partially unfolded intermediates.

High-Pressure, Low-Temperature Induced Unfolding and Aggregation of Monoclonal Antibodies: Role of the Fc and Fab Fragments.

The effects of high pressure and low temperature on the stability of two different monoclonal antibodies (MAbs) were examined in this work. Fluorescence and small-angle neutron scattering were used to monitor the in situ effects of pressure to infer shifts in tertiary structure and characterize aggregation prone intermediates. Partial unfolding was observed for both MAbs, to different extents, under a range of pressure/temperature conditions. Fourier transform infrared spectroscopy was also used to monitor ex situ changes in secondary structure. Preservation of native secondary structure after incubation at elevated pressures and subzero ° C temperatures was independent of the extent of tertiary unfolding and reversibility. Several combinations of pressure and temperature were also used to discern the respective contributions of the isolated Ab fragments (Fab and Fc) to unfolding and aggregation. The fragments for each antibody showed significantly different partial unfolding profiles and reversibility. There was not a simple correlation between stability of the full MAb and either the Fc or Fab fragment stabilities across all cases, demonstrating a complex relationship to full MAb unfolding and aggregation behavior. That notwithstanding, the combined use of spectroscopic and scattering techniques provides insights into MAb conformational stability and hysteresis in high-pressure, low-temperature environments.

Drug-Dependent Morphological Transitions in Spherical and Worm-Like Polymeric Micelles Define Stability and Pharmacological Performance of Micellar Drugs.

Significant advances in physicochemical properties of polymeric micelles enable optimization of therapeutic drug efficacy, supporting nanomedicine manufacturing and clinical translation. Yet, the effect of micelle morphology on pharmacological efficacy is not adequately addressed. This work addresses this gap by assessing pharmacological efficacy of polymeric micelles with spherical and worm-like morphologies. It is observed that poly(2-oxazoline)-based polymeric micelles can be elongated over time from a spherical structure to worm-like structure, with elongation influenced by several conditions, including the amount and type of drug loaded into the micelles. The role of different morphologies on pharmacological performance of drug loaded micelles against triple-negative breast cancer and pancreatic cancer tumor models is further evaluated. Spherical micelles accumulate rapidly in the tumor tissue while retaining large amounts of drug; worm-like micelles accumulate more slowly and only upon releasing significant amounts of drug. These findings suggest that the dynamic character of the drug-micelle structure and the micelle morphology play a critical role in pharmacological performance, and that spherical micelles are better suited for systemic delivery of anticancer drugs to tumors when drugs are loosely associated with the polymeric micelles.

In Situ Monitoring of Protein Unfolding/Structural States under Cold High-Pressure Stress.

Biopharmaceutical formulations may be compromised by freezing, which has been attributed to protein conformational changes at a low temperature, and adsorption to ice-liquid interfaces. However, direct measurements of unfolding/conformational changes in sub-0 °C environments are limited because at ambient pressure, freezing of water can occur, which limits the applicability of otherwise commonly used analytical techniques without specifically tailored instrumentation. In this report, small-angle neutron scattering (SANS) and intrinsic fluorescence (FL) were used to provide in situ analysis of protein tertiary structure/folding at temperatures as low as -15 °C utilizing a high-pressure (HP) environment (up to 3 kbar) that prevents water from freezing. The results show that the α-chymotrypsinogen A (aCgn) structure is reasonably maintained under acidic pH (and corresponding pD) for all conditions of pressure and temperature tested. On the other hand, reversible structural changes and formation of oligomeric species were detected near -10 °C via HP-SANS for ovalbumin under neutral pD conditions. This was found to be related to the proximity of the temperature of cold denaturation of ovalbumin (TCD ∼ -17 °C; calculated via isothermal chemical denaturation and Gibbs-Helmholtz extrapolation) rather than a pressure effect. Significant structural changes were also observed for a monoclonal antibody, anti-streptavidin IgG1 (AS-IgG1), under acidic conditions near -5 °C and a pressure of ∼2 kbar. The conformational perturbation detected for AS-IgG1 is proposed to be consistent with the formation of unfolding intermediates such as molten globule states. Overall, the in situ approaches described here offer a means to characterize the conformational stability of biopharmaceuticals and proteins more generally under cold-temperature stress by the assessment of structural alteration, self-association, and reversibility of each process. This offers an alternative to current ex situ methods that are based on higher temperatures and subsequent extrapolation of the data and interpretations to the cold-temperature regime.

Miscible Polyether/Poly(ether-acetal) Electrolyte Blends.

This study shows that it is possible to obtain homogeneous mixtures of two chemically distinct polymers with a lithium salt for electrolytic applications. This approach is motivated by the success of using mixtures of organic solvents in modern lithium-ion batteries. The properties of mixtures of a polyether, poly(ethylene oxide) (PEO), a poly(ether-acetal), poly(1,3,6-trioxocane) (P(2EO-MO)), and lithium bis(trifluoromethanesulfonyl)imide (LiTFSI) salt were studied by small-angle neutron scattering (SANS) and electrochemical characterization in symmetric cells. The SANS data are used to determine the miscibility window and quantify the effect of added salt on the thermodynamic interactions between the polymers. In the absence of salt, PEO/P(2EO-MO) blends are homogeneous and characterized by attractive interactions, i.e., a negative Flory-Huggins interaction parameter, χ. The addition of small amounts of salt results in a positive effective Flory-Huggins interaction parameter, χ eff, and macrophase separation. Surprisingly, miscible blends and negative χ eff parameters are obtained when the salt concentration is increased beyond a critical value. The electrochemical properties of PEO/P(2EO-MO)/LiTFSI blends at a given salt concentration were close to those obtained in PEO/LiTFSI electrolytes at the same salt concentration. This suggests that in the presence of PEO the electrochemical properties exhibited by P(2EO-MO) chains are similar to those of PEO chains. This work opens the door to a new direction for creating new and improved polymer electrolytes either by combining existing polymers and salt or by synthesizing new polymers with the specific aim of including them in miscible polymer blend electrolytes.

Structural studies of hydrated samples of amorphous calcium phosphate and phosphoprotein nanoclusters.

There are abundant examples of nanoclusters and inorganic microcrystals in biology. Their study under physiologically relevant conditions remains challenging due to their heterogeneity, instability, and the requirements of sample preparation. Advantages of using neutron diffraction and contrast matching to characterize biomaterials are highlighted in this article. We have applied these and complementary techniques to search for nanocrystals within clusters of calcium phosphate sequestered by bovine phosphopeptides, derived from osteopontin or casein. The neutron diffraction patterns show broad features that could be consistent with hexagonal hydroxyapatite crystallites smaller than 18.9 Å. Such nanocrystallites are, however, undetected by the complementary X-ray and FTIR data, collected on the same samples. The absence of a distinct diffraction pattern from the nanoclusters supports the generally accepted amorphous calcium phosphate structure of the mineral core.

A review of the biology of calcium phosphate sequestration with special reference to milk.

In milk, a stable fluid is formed in which sequestered nanoclusters of calcium phosphate are substructures in casein micelles. As a result, calcium and phosphate concentrations in milk can be far in excess of their solubility. Variations of calcium, phosphate and casein concentrations in milks, both within and among species, are mainly due to the formation of the nanocluster complexes. Caseins evolved from tooth and bone proteins well before the evolution of lactation. It has therefore been suggested that the role of caseins in milk is an adaptation of an antecedent function in the control of some aspect of biomineralisation. There is new evidence that nanocluster-type complexes are also present in blood serum and, by implication, in many other closely related biofluids. Because such fluids are stable but nevertheless supersaturated with respect to the bone and tooth mineral hydroxyapatite, they allow soft and mineralised tissues to co-exist in the same organism with relative ease. An appreciable concentration of nanocluster complexes exists in fresh saliva. Such saliva may stabilise tooth mineral and help to repair demineralised lesions. In the extracellular matrix of bone, nanocluster complexes may be involved in directing the amorphous calcium phosphate to intrafibrillar spaces in collagen where they can mature into oriented apatite crystals. Thus, evidence is accumulating that calcium phosphate sequestration by phosphopeptides to form equilibrium complexes, first observed in milk, is more generally important in the control of physiological calcification.

Heme enzymes. Neutron cryo-crystallography captures the protonation state of ferryl heme in a peroxidase.

Heme enzymes activate oxygen through formation of transient iron-oxo (ferryl) intermediates of the heme iron. A long-standing question has been the nature of the iron-oxygen bond and, in particular, the protonation state. We present neutron structures of the ferric derivative of cytochrome c peroxidase and its ferryl intermediate; these allow direct visualization of protonation states. We demonstrate that the ferryl heme is an Fe(IV)=O species and is not protonated. Comparison of the structures shows that the distal histidine becomes protonated on formation of the ferryl intermediate, which has implications for the understanding of O-O bond cleavage in heme enzymes. The structures highlight the advantages of neutron cryo-crystallography in probing reaction mechanisms and visualizing protonation states in enzyme intermediates.

The self-assembling zwitterionic form of L-phenylalanine at neutral pH.

The title zwitterion (2S)-2-azaniumyl-1-hydroxy-3-phenylpropan-1-olate, C9H11NO2, also known as L-phenylalanine, was characterized using synchrotron X-rays. It crystallized in the monoclinic space group P21 with four molecules in the asymmetric unit. The 0.62 Šresolution structure is assumed to be closely related to the fibrillar form of phenylalanine, as observed by electron microscopy and electron diffraction. The structure exists in a zwitterionic form in which π-π stacking and hydrogen-bonding interactions are believed to form the basis of the self-assembling properties.

Mineralisation of soft and hard tissues and the stability of biofluids.

Evidence is provided from studies on natural and artificial biofluids that the sequestration of amorphous calcium phosphate by peptides or proteins to form nanocluster complexes is of general importance in the control of physiological calcification. A naturally occurring mixture of osteopontin peptides was shown, by light and neutron scattering, to form calcium phosphate nanoclusters with a core-shell structure. In blood serum and stimulated saliva, an invariant calcium phosphate ion activity product was found which corresponds closely in form and magnitude to the ion activity product observed in solutions of these osteopontin nanoclusters. This suggests that types of nanocluster complexes are present in these biofluids as well as in milk. Precipitation of amorphous calcium phosphate from artificial blood serum, urine and saliva was determined as a function of pH and the concentration of osteopontin or casein phosphopeptides. The position of the boundary between stability and precipitation was found to agree quantitatively with the theory of nanocluster formation. Artificial biofluids were prepared that closely matched their natural counterparts in calcium and phosphate concentrations, pH, saturation, ionic strength and osmolality. Such fluids, stabilised by a low concentration of sequestering phosphopeptides, were found to be highly stable and may have a number of beneficial applications in medicine.

Preliminary neutron crystallographic study of human transthyretin.

Preliminary studies of perdeuterated crystals of human transthyretin (TTR) have been carried out using the LADI-III and D19 diffractometers at the Institut Laue-Langevin in Grenoble. The results demonstrate the feasibility of a full crystallographic analysis to a resolution of 2.0 Å using Laue diffraction and also illustrate the potential of using monochromatic instruments such as D19 for higher resolution studies where larger crystals having smaller unit cells are available. This study will yield important information on hydrogen bonding, amino-acid protonation states and hydration in the protein. Such information will be of general interest for an understanding of the factors that stabilize/destabilize TTR and for the design of ligands that may be used to counter TTR amyloid fibrillogenesis.

Neutron fibre diffraction studies of amyloid using H2O/D2O isotopic replacement.

The first neutron fibre diffraction studies of an amyloid system are presented. The techniques used to prepare the large samples needed are described, as well as the procedures used to isotopically replace H2O in the sample by D2O. The results demonstrate the feasibility of this type of approach for the pursuit of novel structural analyses that will strongly complement X-ray fibre diffraction studies and probe aspects of amyloid structure that to date have remained obscure. The approach is demonstrated using an amyloid form of the peptide NSGAITIG, but is equally applicable for the study of other systems such as Alzheimer's Aß peptide.

Neutron macromolecular crystallography with LADI-III.

At the Institut Laue-Langevin, a new neutron Laue diffractometer LADI-III has been fully operational since March 2007. LADI-III is dedicated to neutron macromolecular crystallography at medium to high resolution (2.5-1.5 Å) and is used to study key H atoms and water structure in macromolecular structures. An improved detector design and readout system has been incorporated so that a miniaturized reading head located inside the drum scans the image plate. From comparisons of neutron detection efficiency (DQE) with the original LADI-I instrument, the internal transfer of the image plates and readout system provides an approximately threefold gain in neutron detection. The improved performance of LADI-III, coupled with the use of perdeuterated biological samples, now allows the study of biological systems with crystal volumes of 0.1-0.2 mm(3), as illustrated here by the recent studies of type III antifreeze protein (AFP; 7 kDa). As the major bottleneck for neutron macromolecular studies has been the large crystal volumes required, these recent developments have led to an expansion of the field, extending the size and the complexity of the systems that can be studied and reducing the data-collection times required.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions.

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)(2), showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Crystallization and preliminary X-ray diffraction analysis of human cytosolic seryl-tRNA synthetase.

Human cytosolic seryl-tRNA synthetase (hsSerRS) is responsible for the covalent attachment of serine to its cognate tRNA(Ser). Significant differences between the amino-acid sequences of eukaryotic, prokaryotic and archaebacterial SerRSs indicate that the domain composition of hsSerRS differs from that of its eubacterial and archaebacterial analogues. As a consequence of an N-terminal insertion and a C-terminal extra-sequence, the binding mode of tRNA(Ser) to hsSerRS is expected to differ from that in prokaryotes. Recombinant hsSerRS protein was purified to homogeneity and crystallized. Diffraction data were collected to 3.13 Šresolution. The structure of hsSerRS has been solved by the molecular-replacement method.

A preliminary neutron crystallographic study of an A-DNA crystal.

The LADI-III diffractometer at the Institut Laue-Langevin has been used to carry out a preliminary neutron crystallographic study of the self-complementary DNA oligonucleotide d(AGGGGCCCCT)(2) in the A conformation. The results demonstrate the viability of a full neutron crystallographic analysis with the aim of providing enhanced information on the ion-water networks that are known to be important in stabilizing A-DNA. This is the first account of a single-crystal neutron diffraction study of A-DNA. The study was carried out with the smallest crystal used to date for a neutron crystallographic study of a biological macromolecule.

A preliminary neutron crystallographic study of thaumatin.

A preliminary neutron crystallographic study of the sweet protein thaumatin is presented. Large hydrogenated crystals were prepared in deuterated crystallization buffer using the gel-acupuncture method. Data were collected to a resolution of 2 A on the LADI-III diffractometer at the Institut Laue Langevin (ILL). The results demonstrate the feasibility of a full neutron crystallographic analysis of this structure aimed at providing relevant information on the location of H atoms, the distribution of charge on the protein surface and localized water in the structure. This information will be of interest for understanding the specificity of thaumatin-receptor interactions and will contribute to further understanding of the molecular mechanisms underlying the perception of taste.