First report of barley yellow dwarf virus PAS (Luteovirus pashordei) in oat in Australia.

Luteoviruses (family Tombusviridae) and poleroviruses (family Solemoviridae) are economically important pathogens of cereals such as wheat (Triticum aestivum), barley (Hordeum vulgare) and oat (Avena sativa). In Australia, the luteoviruses barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV), along with the poleroviruses cereal yellow dwarf virus RPV (CYDV RPV) and maize yellow dwarf virus RMV (MYDV RMV), were distinguished from each other and reported in the 1980s (Sward and Lister 1988; Waterhouse and Helms 1985). The poleroviruses barley virus G (BVG) and cereal yellow dwarf virus RPS (CYDV RPS) were reported in Australia more recently (Nancarrow et al. 2019; Nancarrow et al. 2023), while the luteovirus barley yellow dwarf virus PAS (BYDV PAS) has not previously been reported in Australia. During 2010, an oat plant exhibiting yellow/ red leaf discoloration and stunted growth was collected from a roadside in Horsham, Victoria, Australia. The plant tested positive for BYDV PAV and negative for BYDV MAV, CYDV RPV and MYDV RMV by tissue blot immunoassay (TBIA) as described by Trebicki et al (2017). The virus isolate has since been continuously maintained in a glasshouse in live wheat plants using aphids (Rhopalosiphum padi). In 2021, total RNA extracted from a wheat plant infected with this isolate (Nancarrow et al. 2023) tested positive for BYDV PAV by RT-PCR using the primers BYDV-1/BYDV-2 (Rastgou et al. 2005), but negative for BYDV PAV, CYDV RPV and MYDV RMV using other published primers (Deb and Anderson 2008). A high-throughput sequencing (HTS) library was prepared from the total RNA with the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB) without ribosomal RNA depletion and sequenced on a NovaSeq 6000 (Illumina). Raw reads were trimmed and filtered using fastp v0.20.0 (Chen et al. 2018) while de novo assembly of all of the resulting 5,049,052 reads was done using SPAdes v3.15.3 (Nurk et al. 2017). BLASTn analysis of the resulting 4,067 contigs (128- 12,457 bp in length) revealed only one large virus-like contig (5,649 bp) which was most similar to BYDV PAS isolates on NCBI GenBank, sharing 87% nucleotide (nt) identity with BYDV PAS isolate OH2 (MN128939), 86% nt identity with the BYDV PAS reference sequence (NC_002160) and 82% nt identity with the BYDV PAV reference sequence (NC_004750). Additionally, 4,008 HTS reads were mapped to the assembled genome sequence with Bowtie2 v2.4.5. (Langmead and Salzberg 2012) with 100% genome coverage and an average coverage depth of 101X. Primers were designed to the assembled genome sequence to generate overlapping amplicons across the genome, and the resulting amplicons were Sanger sequenced. This confirmed the genome sequence of BYDV PAS isolate PT from Australia (5649 bp, GC content 47.9%), which was deposited in GenBank (LC782749). Ten additional plant samples collected from western Victoria, Australia, all tested positive for BYDV PAS by RT-PCR using the primers PASF and PASR (Laney et al. 2018). The additional samples consisted of one oat sample collected in 2005, one barley sample collected in 2007, three wheat samples collected in 2016 and one barley, one brome grass (Bromus sp.) and three wheat samples collected in 2020. BYDV PAS is also efficiently transmitted by R. padi but is often more prevalent and severe than BYDV PAV; it can also overcome some sources of virus resistance that are effective against BYDV PAV (Chay et al. 1996, Robertson and French 2007). To our knowledge, this is the first report of BYDV PAS in Australia. Further work is needed to determine the extent of its distribution, incidence, impacts and epidemiology in Australia, along with its relationship to other BYDV PAS isolates.

Evaluation of Resistance of Oilseed Rape Genotypes to Turnip Yellows Virus.

Turnip yellows virus (TuYV), is one of the most important pathogens of oilseed rape, which has caused enormous yield losses in all growing regions of the world in recent years. Therefore, there is a need for resistant varieties for sustainable crop protection. We have investigated the resistance of known varieties and newly developed advanced-breeding lines of oilseed rape to TuYV in greenhouse and field trials. We have analysed the TuYV titre of individual genotypes inoculated with the virus using viruliferous aphids Myzus persicae. The genotypes 'DK Temptation' and 'Rescator' had the lowest and highest virus titres, respectively, and were used as resistant and susceptible models for comparative analyses with other genotypes. In the greenhouse, the best results were obtained with the genotypes 'OP-8143 DH' (2.94 × 105 copies), OP-BN-72 (3.29 × 105 copies), 'Navajo' (3.58 × 105 copies) and 'SG-C 21215' (4.09 × 105 copies), which reached virus titres about 2 times higher than the minimum virus concentration measured in 'DK Temptation' (1.80 × 105 copies). In the field trials, the genotypes 'Navajo' (3.39 × 105 copies), 'OP-8148 DH' (4.44 × 105 copies), 'SG-C 21215' (6.80 × 105 copies) and OP-8480 (7.19 × 105 copies) had the lowest virus titres and reached about 3 times the virus titre of DK Temptation (2.54 × 105 copies). Both trials showed that at least two commercial varieties (e.g., DK Temptation, Navajo) and three advanced breeding lines (e.g., OP-8143 DH, OP-BN-72, SG-C 21215) had low titres of the virus after TuYV infection. This indicates a high level of resistance to TuYV in 'Navajo' or the newly developed breeding lines and the basis of resistance is probably different from R54 (as in 'DK Temptation'). Furthermore, the greenhouse trials together with RT -qPCR-based virus titre analysis could be a cost-effective and efficient method to assess the level of resistance of a given genotype to TuYV infection compared to the field trials. However, further research is needed to identify the underlying mechanisms causing this difference in susceptibility.

First report of cereal yellow dwarf virus RPS infecting wheat in Australia.

Yellow dwarf viruses (YDVs) reduce grain yield in a wide range of cereal hosts worldwide. Cereal yellow dwarf virus RPV (CYDV RPV) and cereal yellow dwarf virus RPS (CYDV RPS) are members of the Polerovirus genus within the Solemoviridae family (Scheets et al. 2020; Sõmera et al. 2021). Along with barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV) (genus Luteovirus, family Tombusviridae), CYDV RPV is found worldwide and has mostly been identified as being present in Australia based on serological detection (Waterhouse and Helms 1985; Sward and Lister 1988). However, CYDV RPS has not previously been reported in Australia. In October 2020, a plant sample (226W) was collected from a volunteer wheat (Triticum aestivum) plant located near Douglas, Victoria, Australia that displayed yellow-reddish leaf symptoms typical of YDV infection. The sample tested positive for CYDV RPV and negative for BYDV PAV and BYDV MAV by tissue blot immunoassay (TBIA) (Trebicki et al. 2017). Given that CYDV RPV and CYDV RPS can both be detected using serological tests for CYDV RPV (Miller et al. 2002), total RNA was extracted from stored leaf tissue of plant sample 226W for further testing using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) with modified lysis buffer (Constable et al. 2007; MacKenzie et al. 1997). The sample was then tested by RT-PCR using three sets of primers that were designed to detect CYDV RPS, targeting three distinct overlapping regions (each approximately 750 bp in length) of the 5' end of the genome where CYDV RPV and CYDV RPS differ most (Miller et al. 2002). The primers CYDV RPS1L (GAGGAATCCAGATTCGCAGCTT)/ CYDV RPS1R (GCGTACCAAAAGTCCACCTCAA) targeted the P0 gene, while CYDV RPS2L (TTCGAACTGCGCGTATTGTTTG)/ CYDV RPS2R (TACTTGGGAGAGGTTAGTCCGG) and CYDV RPS3L (GGTAAGACTCTGCTTGGCGTAC)/ CYDV RPS3R (TGAGGGGAGAGTTTTCCAACCT) targeted two different regions of the RdRp gene. Sample 226W tested positive using all three sets of primers and the amplicons were directly sequenced. NCBI BLASTn and BLASTx analyses showed that the CYDV RPS1 amplicon (Accession No. OQ417707) shared 97% nucleotide (nt) identity and 98% amino acid (aa) identity similarity with the CYDV RPS isolate SW (Accession No. LC589964) from South Korea, while the CYDV RPS2 amplicon (Accession No. OQ417708) shared 96% nt identity and 98% aa identity similarity with the same CYDV RPS isolate SW. The CYDV RPS3 amplicon (Accession No. OQ417709) shared 96% nt identity and 97% aa identity similarity with the CYDV RPS isolate Olustvere1-O (Accession No. MK012664) from Estonia, confirming that isolate 226W is CYDV RPS. In addition, total RNA extracted from 13 plant samples that had previously tested positive for CYDV RPV by TBIA were tested for CYDV RPS using the primers CYDV RPS1 L/R and CYDV RPS3 L/R. The additional samples, consisting of wheat (n=8), wild oat (Avena fatua, n=3) and brome grass (Bromus sp., n=2), were collected at the same time as sample 226W from seven fields within the same region. Five of the wheat samples were collected from the same field as sample 226W, one of which tested positive for CYDV RPS while the remaining 12 samples were negative. To the best of our knowledge, this is the first report of CYDV RPS in Australia. It is not known if CYDV RPS is a recent introduction to Australia, and its incidence and distribution in cereals and grasses in Australia, while currently unknown, is being investigated.

Symptomless turnip yellows virus infection causes grain yield loss in lentil and field pea: A three-year field study in south-eastern Australia.

Turnip yellows virus (TuYV) is a damaging virus that is persistently transmitted by aphids and infects a wide range of grain hosts including lentil (Lens culinaris Medik), field pea (Pisum sativum L.) and canola (Brassica napus L., oilseed rape). Although information is available about the effects of TuYV infection on grain yield in canola, data about its impact on yield in pulses is lacking. In this study, field experiments quantifying the effects of TuYV infection on the grain yield of lentil and field pea were conducted over three consecutive years (2018-2020) with varying weather conditions. Plants artificially inoculated with TuYV using viruliferous green peach aphid (Myzus persicae, Sulzer) were grown under typical field conditions in south-eastern Australia. At maturity, grain yield, along with associated grain and plant growth parameters, were measured. Compared to the non-inoculated control treatment, early TuYV infection reduced grain yield by up to 36% in lentil and 45% in field pea, while late TuYV infection had no significant impact on yield. Despite a high incidence of TuYV infection and significant yield losses recorded in inoculated plots, no obvious symptoms of virus infection were observed in the inoculated plots in any of the six experiments; this lack of visible symptoms in lentil and field pea has significant implications for crop health assessments, demonstrating the importance of testing for virus instead of relying solely on the presence of visual symptoms, and may also be leading to an underestimation of the importance of TuYV in pulses in Australia.

Virus Diseases of Cereal and Oilseed Crops in Australia: Current Position and Future Challenges.

This review summarizes research on virus diseases of cereals and oilseeds in Australia since the 1950s. All viruses known to infect the diverse range of cereal and oilseed crops grown in the continent's temperate, Mediterranean, subtropical and tropical cropping regions are included. Viruses that occur commonly and have potential to cause the greatest seed yield and quality losses are described in detail, focusing on their biology, epidemiology and management. These are: barley yellow dwarf virus, cereal yellow dwarf virus and wheat streak mosaic virus in wheat, barley, oats, triticale and rye; Johnsongrass mosaic virus in sorghum, maize, sweet corn and pearl millet; turnip yellows virus and turnip mosaic virus in canola and Indian mustard; tobacco streak virus in sunflower; and cotton bunchy top virus in cotton. The currently less important viruses covered number nine infecting nine cereal crops and 14 infecting eight oilseed crops (none recorded for rice or linseed). Brief background information on the scope of the Australian cereal and oilseed industries, virus epidemiology and management and yield loss quantification is provided. Major future threats to managing virus diseases effectively include damaging viruses and virus vector species spreading from elsewhere, the increasing spectrum of insecticide resistance in insect and mite vectors, resistance-breaking virus strains, changes in epidemiology, virus and vectors impacts arising from climate instability and extreme weather events, and insufficient industry awareness of virus diseases. The pressing need for more resources to focus on addressing these threats is emphasized and recommendations over future research priorities provided.

Yield Losses Caused by Barley Yellow Dwarf Virus-PAV Infection in Wheat and Barley: A Three-Year Field Study in South-Eastern Australia.

Barley yellow dwarf virus (BYDV) is transmitted by aphids and significantly reduces the yield and quality of cereals worldwide. Four experiments investigating the effects of barley yellow dwarf virus-PAV (BYDV-PAV) infection on either wheat or barley were conducted over three years (2015, 2017, and 2018) under typical field conditions in South-Eastern Australia. Plants inoculated with BYDV-PAV using viruliferous aphids (Rhopalosiphum padi) were harvested at maturity then grain yield and yield components were measured. Compared to the non-inoculated control, virus infection severely reduced grain yield by up to 84% (1358 kg/ha) in wheat and 64% (1456 kg/ha) in barley. The yield component most affected by virus infection was grain number, which accounted for a large proportion of the yield loss. There were no significant differences between early (seedling stage) and later (early-tillering stage) infection for any of the parameters measured (plant height, biomass, yield, grain number, 1000-grain weight or grain size) for either wheat or barley. Additionally, this study provides an estimated yield loss value, or impact factor, of 0.91% (72 kg/ha) for each one percent increase in natural BYDV-PAV background infection. Yield losses varied considerably between experiments, demonstrating the important role of cultivar and environmental factors in BYDV epidemiology and highlighting the importance of conducting these experiments under varying conditions for specific cultivar-vector-virus combinations.

Genetic diversity and recombination between turnip yellows virus strains in Australia.

Disease outbreaks caused by turnip yellows virus (TuYV), a member of the genus Polerovirus, family Luteoviridae, regularly occur in canola and pulse crops throughout Australia. To understand the genetic diversity of TuYV for resistance breeding and management, genome sequences of 28 TuYV isolates from different hosts and locations were determined using high-throughput sequencing (HTS). We aimed to identify the parts of the genome that were most variable and clarify the taxonomy of viruses related to TuYV. Poleroviruses contain seven open reading frames (ORFs): ORF 0-2, 3a, and 3-5. Phylogenetic analysis based on the genome sequences, including isolates of TuYV and brassica yellows virus (BrYV) from the GenBank database, showed that most genetic variation among isolates occurred in ORF 5, followed by ORF 0 and ORF 3a. Phylogenetic analysis of ORF 5 revealed three TuYV groups; P5 group 1 and group 3 shared 45-49% amino acid sequence identity, and group 2 is a recombinant between the other two. Phylogenomic analysis of the concatenated ORFs showed that TuYV is paraphyletic with respect to BrYV, and together these taxa form a well-supported monophyletic group. Our results support the hypothesis that TuYV and BrYV belong to the same species and that the phylogenetic topologies of ORF 0, 3a and 5 are incongruent and may not be informative for species demarcation. A number of beet western yellow virus (BWYV)- and TuYV-associated RNAs (aRNA) were also identified by HTS for the first time in Australia.

Elevated Carbon Dioxide and Nitrogen Impact Wheat and Its Aphid Pest.

The rise in atmospheric carbon dioxide (CO2) generally increases wheat biomass and grain yield but decreases its nutritional value. This, in turn, can alter the metabolic rates, development, and performance of insect pests feeding on the crop. However, it is unclear how elevated CO2 (eCO2) and nitrogen (N) input affect insect pest biology through changes in wheat growth and tissue N content. We investigated the effect of three different N application rates (low, medium, and high) and two CO2 levels (ambient and elevated) on wheat growth and quality and the development and performance of the bird cherry-oat aphid, a major cereal pest worldwide, under controlled environmental conditions. We found that eCO2 significantly decreased total aphid fecundity and wheat N content by 22 and 39%, respectively, when compared to ambient CO2 (aCO2). Greater N application significantly increased total aphid fecundity and plant N content but did not offset the effects of eCO2. Our findings provide important information on aphid threats under future CO2 conditions, as the heavy infestation of the bird cherry-oat aphid is detrimental to wheat grain yield and quality.

Simultaneous Increase in CO2 and Temperature Alters Wheat Growth and Aphid Performance Differently Depending on Virus Infection.

Climate change impacts crop production, pest and disease pressure, yield stability, and, therefore, food security. In order to understand how climate and atmospheric change factors affect trophic interactions in agriculture, we evaluated the combined effect of elevated carbon dioxide (CO2) and temperature on the interactions among wheat (Triticum aestivum L.), Barley yellow dwarf virus species PAV (BYDV-PAV) and its vector, the bird cherry-oat aphid (Rhopalosiphum padi L.). Plant traits and aphid biological parameters were examined under two climate and atmospheric scenarios, current (ambient CO2 and temperature = 400 ppm and 20 °C), and future predicted (elevated CO2 and temperature = 800 ppm and 22 °C), on non-infected and BYDV-PAV-infected plants. Our results show that combined elevated CO2 and temperature increased plant growth, biomass, and carbon to nitrogen (C:N) ratio, which in turn significantly decreased aphid fecundity and development time. However, virus infection reduced chlorophyll content, biomass, wheat growth and C:N ratio, significantly increased R. padi fecundity and development time. Regardless of virus infection, aphid growth rates remained unchanged under simulated future conditions. Therefore, as R. padi is currently a principal pest in temperate cereal crops worldwide, mainly due to its role as a plant virus vector, it will likely continue to have significant economic importance. Furthermore, an earlier and more distinct virus symptomatology was highlighted under the future predicted scenario, with consequences on virus transmission, disease epidemiology and, thus, wheat yield and quality. These research findings emphasize the complexity of plant-vector-virus interactions expected under future climate and their implications for plant disease and pest incidence in food crops.

Climate change and plant virus epidemiology.

Changes in global climate driven by anthropogenic activities, especially the burning of fossil fuels and deforestation, have been progressively increasing and are projected to intensify. Increasing concentrations of atmospheric carbon dioxide and temperature will have significant consequences for future food production, quality, distribution and security. The epidemiology of plant viruses will be altered in the future as a result of climate change. Elevated atmospheric carbon dioxide, increased temperature, changes to water availability and more frequent extreme weather events will have direct and indirect effects on plant viruses through changes in hosts and vectors. Predicted climatic changes will affect the distribution and survival of plant viruses and their vectors, which are expected to increase in many geographic regions. Furthermore, climate change can affect the virulence and pathogenicity of plant viruses, consequently increasing the frequency and scale of disease outbreaks. Thus, greater understanding of plant virus epidemiology is needed to better anticipate challenges ahead and to develop effective and robust control strategies that will aid in securing global food production for the future.

Prevalence and Incidence of Yellow Dwarf Viruses Across a Climatic Gradient: A Four-Year Field Study in Southeastern Australia.

Yellow dwarf viruses (YDVs) form a complex of economically important pathogens that affect cereal production worldwide, reducing yield and quality. The prevalence and incidence of YDVs including barley yellow dwarf viruses (BYDV-PAV and BYDV-MAV) and cereal yellow dwarf virus (CYDV-RPV) in cereal fields in Victoria, Australia were measured. As temperature decreases and rainfall increases from north to south in Victoria, fields in three geographical regions were evaluated to determine potential differences in virus prevalence and incidence across the weather gradient. Cereal samples randomly collected from each field during spring for four consecutive years (2014-2017) were tested for BYDV-PAV, BYDV-MAV, and CYDV-RPV using tissue blot immunoassay. BYDV-PAV was the most prevalent YDV species overall and had the highest overall mean incidence. Higher temperature and lower rainfall were associated with reduced prevalence and incidence of YDVs as the northern region, which is hotter and drier, had a 17-fold decrease in virus incidence compared with the cooler and wetter regions. Considerable year-to-year variation in virus prevalence and incidence was observed. This study improves our understanding of virus epidemiology, which will aid the development of more targeted control measures and predictive models. It also highlights the need to monitor for YDVs and their vectors over multiple years to assess the level of risk and to make more informed and appropriate disease management decisions.

Insect-plant-pathogen interactions as shaped by future climate: effects on biology, distribution, and implications for agriculture.

Carbon dioxide (CO2 ) is the main anthropogenic gas which has drastically increased since the industrial revolution, and current concentrations are projected to double by the end of this century. As a consequence, elevated CO2 is expected to alter the earths' climate, increase global temperatures and change weather patterns. This is likely to have both direct and indirect impacts on plants, insect pests, plant pathogens and their distribution, and is therefore problematic for the security of future food production. This review summarizes the latest findings and highlights current knowledge gaps regarding the influence of climate change on insect, plant and pathogen interactions with an emphasis on agriculture and food production. Direct effects of climate change, including increased CO2 concentration, temperature, patterns of rainfall and severe weather events that impact insects (namely vectors of plant pathogens) are discussed. Elevated CO2 and temperature, together with plant pathogen infection, can considerably change plant biochemistry and therefore plant defense responses. This can have substantial consequences on insect fecundity, feeding rates, survival, population size, and dispersal. Generally, changes in host plant quality due to elevated CO2 (e.g., carbon to nitrogen ratios in C3 plants) negatively affect insect pests. However, compensatory feeding, increased population size and distribution have also been reported for some agricultural insect pests. This underlines the importance of additional research on more targeted, individual insect-plant scenarios at specific locations to fully understand the impact of a changing climate on insect-plant-pathogen interactions.

Crop-associated virus reduces the rooting depth of non-crop perennial native grass more than non-crop-associated virus with known viral suppressor of RNA silencing (VSR).

As agricultural acreage expanded and came to dominate landscapes across the world, viruses gained opportunities to move between crop and wild native plants. In the Midwestern USA, virus exchange currently occurs between widespread annual Poaceae crops and remnant native perennial prairie grasses now under consideration as bioenergy feedstocks. In this region, the common aphid species Rhopalosiphum padi L. (the bird cherry-oat aphid) transmits several virus species in the family Luteoviridae, including Barley yellow dwarf virus (BYDV-PAV, genus Luteovirus) and Cereal yellow dwarf virus (CYDV-RPV and -RPS, genus Polerovirus). The yellow dwarf virus (YDV) species in these two genera share genetic similarities in their 3'-ends, but diverge in the 5'-regions. Most notably, CYDVs encode a P0 viral suppressor of RNA silencing (VSR) absent in BYDV-PAV. Because BYDV-PAV has been reported more frequently in annual cereals and CYDVs in perennial non-crop grasses, we examine the hypothesis that the viruses' genetic differences reflect different affinities for crop and non-crop hosts. Specifically, we ask (i) whether CYDVs might persist within and affect a native non-crop grass more strongly than BYDV-PAV, on the grounds that the polerovirus VSR could better moderate the defenses of a well-defended perennial, and (ii) whether the opposite pattern of effects might occur in a less defended annual crop. Because previous work found that the VSR of CYDV-RPS possessed greater silencing suppressor efficiency than that of CYDV-RPV, we further explored (iii) whether a novel grass-associated CYDV-RPS isolate would influence a native non-crop grass more strongly than a comparable CYDV-RPV isolate. In growth chamber studies, we found support for this hypothesis: only grass-associated CYDV-RPS stunted the shoots and crowns of Panicum virgatum L. (switchgrass), a perennial native North American prairie grass, whereas crop-associated BYDV-PAV (and coinfection with BYDV-PAV and CYDV-RPS) most stunted annual Avena sativa L. (oats). These findings suggest that some of the diversity in grass-infecting Luteoviridae reflects viral capacity to modulate defenses in different host types. Intriguingly, while all virus treatments also reduced root production in both host species, only crop-associated BYDV-PAV (or co-infection) reduced rooting depths. Such root effects may increase host susceptibility to drought, and indicate that BYDV-PAV pathogenicity is determined by something other than a P0 VSR. These findings contribute to growing evidence that pathogenic crop-associated viruses may harm native species as well as crops. Critical next questions include the extent to which crop-associated selection pressures drive viral pathogenesis.

Virus incidence in wheat increases under elevated CO2: A 4-year study of yellow dwarf viruses from a free air carbon dioxide facility.

The complexities behind the mechanisms associated with virus-host-vector interactions of vector-transmitted viruses, and their consequences for disease development need to be understood to reduce virus spread and disease severity. Climate has a substantial effect on viruses, vectors, host plants and their interactions. Increased atmospheric carbon dioxide (CO2) is predicted to impact the interactions between them. This study, conducted under ambient and elevated CO2 (550µmolmol-1), in the Australian Grains Free Air Carbon Enrichment facility reports on natural yellow dwarf virus incidence on wheat (including Barley/Cereal yellow dwarf viruses (B/CYDV)). A range of wheat cultivars was tested using tissue blot immunoassay to determine the incidence of four yellow dwarf virus species from 2013 to 2016. In 2013, 2014 and 2016, virus incidence was high, reaching upwards of 50%, while in 2015 it was relatively low, with a maximum incidence of 3%. Across all years and most cultivars, BYDV-PAV was the most prevalent virus species. In the years with high virus incidence, a majority plots with the elevated levels of CO2 (eCO2) were associated with increased levels of virus relative to the plots with ambient CO2. In 2013, 2014 and 2016 the recorded mean percent virus incidence was higher under elevated CO2 when compared to ambient CO2 by 33%, 14% and 34%, respectively. The mechanism behind increased yellow dwarf virus incidence under elevated CO2 is not well understood. Potential factors involved in the higher virus incidence under elevated CO2 conditions are discussed.

Acizzia solanicola (Hemiptera: Psyllidae) probing behaviour on two Solanum spp. and implications for possible pathogen spread.

Piercing-sucking insects are vectors of plant pathogens, and an understanding of their feeding behaviour is crucial for studies on insect population dynamics and pathogen spread. This study examines probing behaviour of the eggplant psyllid, Acizzia solanicola (Hemiptera: Psyllidae), using the electrical penetration graph (EPG) technique, on two widespread and common hosts: eggplant (Solanum melongena) and tobacco bush (S. mauritianum). Six EPG waveforms were observed: waveform NP (non-probing phase), waveform C (pathway phase), G (feeding activities in xylem tissues), D (first contact with phloem tissues), E1 (salivation in the sieve elements) and E2 (ingestion from phloem tissues). Results showed that A. solanicola is predominantly a phloem feeder and time spent in salivation and ingestion phases (E1 and E2) differed between hosts. Feeding was enhanced on eggplant compared to tobacco bush which showed some degree of resistance, as evidenced by shorter periods of phloem ingestion, a higher propensity to return to the pathway phase once in the sieve elements and higher number of salivation events on tobacco bush. We discuss how prolonged phloem feeding could indicate the potential for A. solanicola to become an important pest of eggplant and potential pathogen vector.

Virus infection mediates the effects of elevated CO2 on plants and vectors.

Atmospheric carbon dioxide (CO2) concentration has increased significantly and is projected to double by 2100. To increase current food production levels, understanding how pests and diseases respond to future climate driven by increasing CO2 is imperative. We investigated the effects of elevated CO2 (eCO2) on the interactions among wheat (cv. Yitpi), Barley yellow dwarf virus and an important pest and virus vector, the bird cherry-oat aphid (Rhopalosiphum padi), by examining aphid life history, feeding behavior and plant physiology and biochemistry. Our results showed for the first time that virus infection can mediate effects of eCO2 on plants and pathogen vectors. Changes in plant N concentration influenced aphid life history and behavior, and N concentration was affected by virus infection under eCO2. We observed a reduction in aphid population size and increased feeding damage on noninfected plants under eCO2 but no changes to population and feeding on virus-infected plants irrespective of CO2 treatment. We expect potentially lower future aphid populations on noninfected plants but no change or increased aphid populations on virus-infected plants therefore subsequent virus spread. Our findings underscore the complexity of interactions between plants, insects and viruses under future climate with implications for plant disease epidemiology and crop production.

Elevated CO2 impacts bell pepper growth with consequences to Myzus persicae life history, feeding behaviour and virus transmission ability.

Increasing atmospheric carbon dioxide (CO2) impacts plant growth and metabolism. Indirectly, the performance and feeding of insects is affected by plant nutritional quality and resistance traits. Life history and feeding behaviour of Myzus persicae were studied on pepper plants under ambient (aCO2, 400 ppm) or elevated CO2 (eCO2, 650 ppm), as well as the direct impact on plant growth and leaf chemistry. Plant parameters were significantly altered by eCO2 with a negative impact on aphid's life history. Their pre-reproductive period was 11% longer and fecundity decreased by 37%. Peppers fixed significantly less nitrogen, which explains the poor aphid performance. Plants were taller and had higher biomass and canopy temperature. There was decreased aphid salivation into sieve elements, but no differences in phloem ingestion, indicating that the diminished fitness could be due to poorer tissue quality and unfavourable C:N balance, and that eCO2 was not a factor impeding feeding. Aphid ability to transmit Cucumber mosaic virus (CMV) was studied by exposing source and receptor plants to ambient (427 ppm) or elevated (612 ppm) CO2 before or after virus inoculation. A two-fold decrease on transmission was observed when receptor plants were exposed to eCO2 before aphid inoculation when compared to aCO2.

Virus disease in wheat predicted to increase with a changing climate.

Current atmospheric CO2 levels are about 400 µmol mol(-1) and are predicted to rise to 650 µmol mol(-1) later this century. Although the positive and negative impacts of CO2 on plants are well documented, little is known about interactions with pests and diseases. If disease severity increases under future environmental conditions, then it becomes imperative to understand the impacts of pathogens on crop production in order to minimize crop losses and maximize food production. Barley yellow dwarf virus (BYDV) adversely affects the yield and quality of economically important crops including wheat, barley and oats. It is transmitted by numerous aphid species and causes a serious disease of cereal crops worldwide. This study examined the effects of ambient (aCO2 ; 400 µmol mol(-1) ) and elevated CO2 (eCO2 ; 650 µmol mol(-1) ) on noninfected and BYDV-infected wheat. Using a RT-qPCR technique, we measured virus titre from aCO2 and eCO2 treatments. BYDV titre increased significantly by 36.8% in leaves of wheat grown under eCO2 conditions compared to aCO2 . Plant growth parameters including height, tiller number, leaf area and biomass were generally higher in plants exposed to higher CO2 levels but increased growth did not explain the increase in BYDV titre in these plants. High virus titre in plants has been shown to have a significant negative effect on plant yield and causes earlier and more pronounced symptom expression increasing the probability of virus spread by insects. The combination of these factors could negatively impact food production in Australia and worldwide under future climate conditions. This is the first quantitative evidence that BYDV titre increases in plants grown under elevated CO2 levels.

The effect of elevated temperature on Barley yellow dwarf virus-PAV in wheat.

Barley yellow dwarf virus-PAV (BYDV-PAV) is associated with yellow dwarf disease, one of the most economically important diseases of cereals worldwide. In this study, the impact of current and future predicted temperatures for the Wimmera wheat growing district in Victoria, Australia on the titre of BYDV-PAV in wheat was investigated. Ten-day old wheat (Triticum aestivum, cv. Yitpi) seedlings were inoculated with BYDV-PAV and grown at ambient (5.0-16.1°C, night-day) or elevated (10.0-21.1°C, night-day) temperature treatments, simulating the current Wimmera average and future daily temperature cycles, respectively, during the wheat-growing season. Whole above-ground plant samples were collected from each temperature treatment at 0 (day of inoculation), 3, 6, 9, 12, 15, 18, 21 and 24 days after inoculation and the titre of BYDV-PAV was measured in each sample using a specific one-step multiplex normalised reverse transcription quantitative PCR (RT-qPCR) assay. Physical measurements, including plant height, dry weight and tiller number, were also taken at each sampling point. The titre of BYDV-PAV was significantly greater in plants grown in the elevated temperature treatment than in plants grown in the ambient treatment on days 6, 9 and 12. Plants grown at elevated temperature were significantly bigger and symptoms associated with BYDV-PAV were visible earlier than in plants grown at ambient temperature. These results may have important implications for the epidemiology of yellow dwarf disease under future climates in Australia.