Gene expression-based classifications of fibroadenomas and phyllodes tumours of the breast.

Fibroepithelial tumors (FTs) of the breast are a heterogeneous group of lesions ranging from fibroadenomas (FAD) to phyllodes tumors (PT) (benign, borderline, malignant). Further understanding of their molecular features and classification might be of clinical value. In this study, we analysed the expression of 105 breast cancer-related genes, including the 50 genes of the PAM50 intrinsic subtype predictor and 12 genes of the Claudin-low subtype predictor, in a panel of 75 FTs (34 FADs, 5 juvenile FADs, 20 benign PTs, 5 borderline PTs and 11 malignant PTs) with clinical follow-up. In addition, we compared the expression profiles of FTs with those of 14 normal breast tissues and 49 primary invasive ductal carcinomas (IDCs). Our results revealed that the levels of expression of all breast cancer-related genes can discriminate the various groups of FTs, together with normal breast tissues and IDCs (False Discovery Rate < 5%). Among FTs, the levels expression of proliferation-related genes (e.g. CCNB1 and MKI67) and mesenchymal/epithelial-related (e.g. CLDN3 and EPCAM) genes were found to be most discriminative. As expected, FADs showed the highest and lowest expression of epithelial- and proliferation-related genes, respectively, whereas malignant PTs showed the opposite expression pattern. Interestingly, the overall profile of benign PTs was found more similar to FADs and normal breast tissues than the rest of tumours, including juvenile FADs. Within the dataset of IDCs and normal breast tissues, the vast majority of FADs, juvenile FADs, benign PTs and borderline PTs were identified as Normal-like by intrinsic breast cancer subtyping, whereas 7 (63.6%) and 3 (27.3%) malignant PTs were identified as Claudin-low and Basal-like, respectively. Finally, we observed that the previously described PAM50 risk of relapse prognostic score better predicted outcome in FTs than the morphological classification, even within PTs-only. Our results suggest that classification of FTs using gene expression-based data is feasible and might provide clinically useful biological and prognostic information.

Protective effects of melatonin in reducing oxidative stress and in preserving the fluidity of biological membranes: a review.

Free radicals generated within subcellular compartments damage macromolecules which lead to severe structural changes and functional alterations of cellular organelles. A manifestation of free radical injury to biological membranes is the process of lipid peroxidation, an autooxidative chain reaction in which polyunsaturated fatty acids in the membrane are the substrate. There is considerable evidence that damage to polyunsaturated fatty acids tends to reduce membrane fluidity. However, adequate levels of fluidity are essential for the proper functioning of biological membranes. Thus, there is considerable interest in antioxidant molecules which are able to stabilize membranes because of their protective effects against lipid peroxidation. Melatonin is an indoleamine that modulates a wide variety of endocrine, neural and immune functions. Over the last two decades, intensive research has proven this molecule, as well as its metabolites, to possess substantial antioxidant activity. In addition to their ability to scavenge several reactive oxygen and nitrogen species, melatonin increases the activity of the glutathione redox enzymes, that is, glutathione peroxidase and reductase, as well as other antioxidant enzymes. These beneficial effects of melatonin are more significant because of its small molecular size and its amphipathic behaviour, which facilitates ease of melatonin penetration into every subcellular compartment. In the present work, we review the current information related to the beneficial effects of melatonin in maintaining the fluidity of biological membranes against free radical attack, and further, we discuss its implications for ageing and disease.

Randomized, phase III trial of sequential epirubicin and docetaxel versus epirubicin alone in postmenopausal patients with node-positive breast cancer.

PURPOSE: The Docetaxel Epirubicin Adjuvant (DEVA) trial evaluated the efficacy and toxicity of incorporating docetaxel after epirubicin to create a sequential anthracycline-taxane regimen in early breast cancer. PATIENTS AND METHODS: After complete tumor excision, postmenopausal women with node-positive early breast cancer were randomly assigned to either epirubicin 50 mg/m(2) on days 1 and 8 every 4 weeks for six cycles (EPI × 6) or three cycles of epirubicin 50 mg/m(2) on days 1 and 8 every 4 weeks followed by three cycles of docetaxel 100 mg/m(2) on day 1 every 3 weeks (EPI-DOC). A subset of patients also participated in a quality of life (QOL) study. The primary end point was disease-free survival (DFS). RESULTS: From 1997 to 2005, 803 patients entered DEVA (EPI × 6, n = 397; EPI-DOC, n = 406). At a median follow-up of 64.7 months (interquartile range, 45.2 to 84.4 months), 198 DFS events had been reported (EPI × 6, n = 114; EPI-DOC, n = 84). The 5-year DFS rates were 72.7% (95% CI, 68.0% to 77.3%) for epirubicin alone and 79.5% (95% CI, 75.2% to 83.8%) for epirubicin followed by docetaxel; evidence of improvement in DFS was observed with EPI-DOC (hazard ratio [HR], 0.68; 95% CI, 0.52 to 0.91; P = .008). One hundred twenty-seven patients have died (EPI × 6, n = 75; EPI-DOC, n = 52); a reduction in deaths was observed with EPI-DOC (HR, 0.66; 95% CI, 0.46 to 0.94; P = .02). The 5-year overall survival rates were 81.8% (95% CI, 77.7% to 85.9%) for epirubicin and 88.9% (95% CI, 85.5% to 92.2%) for epirubicin followed by docetaxel. Assessment of toxicity and QOL showed that EPI-DOC was associated with greater toxicity but with no difference in QOL between arms during follow-up. CONCLUSION: These results suggest, within a relatively small trial, that substitution of docetaxel for epirubicin for the last three cycles of chemotherapy results in improved outcome in postmenopausal women with node-positive, early breast cancer compared with six cycles of epirubicin monotherapy.

Phase III multicenter clinical trial of the sialyl-TN (STn)-keyhole limpet hemocyanin (KLH) vaccine for metastatic breast cancer.

PURPOSE: This double-blind, randomized, phase III clinical trial evaluated time to progression (TTP) and overall survival in women with metastatic breast cancer (MBC) who received sialyl-TN (STn) keyhole limpet hemocyanin (KLH) vaccine. Secondary endpoints included vaccine safety and immune response. EXPERIMENTAL DESIGN: The study population consisted of 1,028 women with MBC across 126 centers who had previously received chemotherapy and had had either a complete or a partial response or no disease progression. All women received one-time i.v. cyclophosphamide (300 mg/m(2)) 3 days before s.c. injection of 100 µg STn-KLH plus adjuvant (treatment group) or 100 µg KLH plus adjuvant (control group) at weeks 0, 2, 5, and 9. Subsequently, STn-KLH without adjuvant or KLH without adjuvant was then administered monthly for 4 months, and then quarterly until disease progression, without cyclophosphamide. RESULTS: STn-KLH vaccine was well tolerated; patients had mild to moderate injection-site reactions and reversible flu-like symptoms. Week-12 antibody testing revealed high specific IgG titers and a high rate of IgM-to-IgG seroconversion; the median IgG titers in STn-KLH recipients were 320 (anti-ovine submaxillary mucin) and 20,480 (anti-STn), with no detectable antimucin antibodies in the control group. The TTP was 3.4 months in the treatment group and 3.0 months in the control group. The median survival times were 23.1 months and 22.3 months, respectively. CONCLUSIONS: Although STn-KLH was well tolerated in this largest to date metastatic breast cancer vaccine trial, no overall benefit in TTP or survival was observed. Lessons were learned for future vaccine study designs.

Assessment of the evolution of cancer treatment therapies.

Cancer therapy has been characterized throughout history by ups and downs, not only due to the ineffectiveness of treatments and side effects, but also by hope and the reality of complete remission and cure in many cases. Within the therapeutic arsenal, alongside surgery in the case of solid tumors, are the antitumor drugs and radiation that have been the treatment of choice in some instances. In recent years, immunotherapy has become an important therapeutic alternative, and is now the first choice in many cases. Nanotechnology has recently arrived on the scene, offering nanostructures as new therapeutic alternatives for controlled drug delivery, for combining imaging and treatment, applying hyperthermia, and providing directed target therapy, among others. These therapies can be applied either alone or in combination with other components (antibodies, peptides, folic acid, etc.). In addition, gene therapy is also offering promising new methods for treatment. Here, we present a review of the evolution of cancer treatments, starting with chemotherapy, surgery, radiation and immunotherapy, and moving on to the most promising cutting-edge therapies (gene therapy and nanomedicine). We offer an historical point of view that covers the arrival of these therapies to clinical practice and the market, and the promises and challenges they present.

[Effects of an exercise training program on the quality of life of women with breast cancer on chemotherapy]. / Ejercicio físico en mujeres con cáncer de mama.

BACKGROUND: Exercise may reduce anxiety and depression associated to the diagnosis and treatment of cancer. AIM: To assess the effects of a physical training program during chemotherapy among women with breast cancer. PATIENTS AND METHODS: Twenty two women aged 49 +/- 7 years with breast cancer voluntarily agreed to take part in the study, after surgical treatment. Functional capacity (Karnofsky Performance Status), psychological status (General Health Questionnaire, GHQ) and quality of life (EORTC QLQ-C30) were evaluated at baseline and at the end of the study. Before beginning with adjuvant chemotherapy, ten women were randomly assigned to a program of physical exercise and seven to a control group. The program lasted 18 to 22 weeks, depending on the duration of chemotherapy. RESULTS: Five women were lost from follow up. Before starting chemotherapy, 41% of women were working and all had to kit. At baseline all had a normal Karnofski score and quality of life was compromised. At the end of the study, the intervention group had an improvement of their quality of life, compared to the control group that did not experience significant changes. CONCLUSIONS: An exercise training program improves quality of life of women with breast cancer on chemotherapy.

Ejercicio físico en mujeres con cáncer de mama / Effects of an exercise training program on the quality of life of women with breast cancer on chemotherapy

Background: Exercise may reduce anxiety and depression associated to the diagnosis and treatment of cancer. Aim: To assess the effects of a physical training program during chemotherapy among women with breast cancer. Patients and Methods: Twenty two women aged 49 ± 7 years with breast cancer voluntarily agreed to take part in the study, after surgical treatment. Functional capacity (Karnofsky Performance Status), psychological status (General Health Questionnaire, GHQ) and quality of life (EORTC QLQ-C30) were evaluated at baseline and at the end of the study. Before beginning with adjuvant chemotherapy, ten women were randomly assigned to a program of physical exercise and seven to a control group. The program lasted 18 to 22 weeks, depending on the duration of chemotherapy. Results: Five women were lost from follow up. Before starting chemotherapy, 41 percent of women were working and all had to kit. At baseline all had a normal Karnofski score and quality of life was compromised. At the end of the study, the intervention group had an improvement of their quality of life, compared to the control group that did not experience significant changes. Conclusions: An exercise training program improves quality of life of women with breast cancer on chemotherapy.

Sequence variants at the TERT-CLPTM1L locus associate with many cancer types.

The common sequence variants that have recently been associated with cancer risk are particular to a single cancer type or at most two. Following up on our genome-wide scan of basal cell carcinoma, we found that rs401681[C] on chromosome 5p15.33 satisfied our threshold for genome-wide significance (OR = 1.25, P = 3.7 x 10(-12)). We tested rs401681 for association with 16 additional cancer types in over 30,000 cancer cases and 45,000 controls and found association with lung cancer (OR = 1.15, P = 7.2 x 10(-8)) and urinary bladder, prostate and cervix cancer (ORs = 1.07-1.31, all P < 4 x 10(-4)). However, rs401681[C] seems to confer protection against cutaneous melanoma (OR = 0.88, P = 8.0 x 10(-4)). Notably, most of these cancer types have a strong environmental component to their risk. Investigation of the region led us to rs2736098[A], which showed stronger association with some cancer types. However, neither variant could fully account for the association of the other. rs2736098 corresponds to A305A in the telomerase reverse transcriptase (TERT) protein and rs401681 is in an intron of the CLPTM1L gene.

[Detection of specific T cells for 264-272 and 149-157 peptides of p53 protein in peripheral blood of patients with breast cancer]. / Detección de linfocitos T citotóxicos contra los epítopos 264-272 y 149-157 de la proteína p53 en sangre periférica de pacientes con cáncer de mama.

BACKGROUND AND OBJECTIVE: p53 protein is overexpressed in nearly half of all human tumours. An HLA-A2.1-restricted immunological response mediated by anti-p53 CD8+ T cells directed against the wild type p53 264-272 epitope has been demonstrated in patients with head and neck squamous carcinomas. The existence of such a response in patients with other cancer types could be determinant for the development of specific antitumour vaccines targeting the p53 protein. We aimed to determine the presence of anti-p53 specific CD8+ T cells in peripheral blood of breast cancer patients in vivo. PATIENTS AND METHOD: p53 264-272-specific CD8+ T cells were directly enumerated in the peripheral circulation of patients with breast cancer using tetrameric p53 264-272/HLA-A2.1 complexes by multicolor flow cytometry. The same procedure was used to enumerate T cells specific for another HLA-A2.1 restricted wild type p53 epitope, p53 (149-157). RESULTS: The 99th percentile of the concentration of anti-p53 cells in 6 HLA A2- breast cancer patients was 1/5634 (cut-off point). The median counts of anti-p53264-272 and anti-p53149-157 lymphocytes in 14 HLA A2.1+ patients were 1/2383 and 1/2335 respectively. All of the HLA A2+ patients had concentrations of anti-p53 lymphocytes above the cut-off point for at least one of the epitopes: 13/14 (93%) for p53(264-272) and 11/12 (92%) for p53(149-157). CONCLUSIONS: A specific immunological response mediated by anti-p53 CD8+ T cells has been detected in patients with breast carcinoma. More studies are needed to confirm these results and to determine its usefulness for the development of p53-based vaccines.

Detección de linfocitos T citotóxicos contra los epítopos 264-272 y 149-157 de la proteína p53 en sangre periférica de pacientes con cáncer de mama / Detection of specific T cells for 264-272 and 149-157 peptides of p53 protein in peripheral blood of patients with breast cancer

FUNDAMENTO Y OBJETIVO: La proteína p53 está sobreexpresada en la mitad de los tumores humanos.Se ha descrito que se produce una respuesta inmunológica específica mediada por linfocitosT citotóxicos dirigidos contra el epítopo 264-272 de p53 en pacientes con cáncer de cabezay cuello. Demostrar que se produce ese tipo de respuesta en otros tumores podría serdeterminante para el desarrollo de vacunas antitumorales específicas anti-p53. El objetivo deeste estudio fue demostrar in vivo la existencia de linfocitos T citotóxicos específicos anti-p53en sangre periférica de pacientes con cáncer de mama.PACIENTES Y MÉTODO: Se realizó la determinación mediante citometría de flujo del recuento delinfocitos T citotóxicos específicos dirigidos contra los epítopos HLA A2 restringidos 264-272 y149-147 de la proteína p53 en sangre periférica de pacientes con cáncer de mama.RESULTADOS: El percentil 99 de la concentración de células T anti-p53 en los pacientes conHLA A2.1 negativo fue 1/5.634 (punto de corte). En los pacientes con HLA A2 positivo, la medianade linfocitos anti-p53264-272 fue de 1/2.383 y la de linfocitos anti-p53149-157, de 1/2.335.Todos los pacientes con HLA A2 positivo presentaron recuentos de linfocitos anti-p53 por encimadel punto de corte para al menos uno de los 2 epítopos: 13/14 (93%) para p53264-272 y11/12 (92%) para p53149-157.CONCLUSIONES: Ha sido posible demostrar in vivo que hay una respuesta inmunológica específicamediada por linfocitos T citotóxicos anti-p53 en pacientes con cáncer de mama. Son necesariosfuturos estudios para confirmar estos resultados y determinar su utilidad para el diseño y eldesarrollo de vacunas dirigidas contra la proteína p53

BACKGROUND AND OBJECTIVE: p53 protein is overexpresed in nearly half of all human tumours. AnHLA-A2.1-restricted immunological response mediated by anti-p53 CD8+ T cells directedagainst the wild type p53 264-272 epitope has been demonstrated in patients with head andneck squamous carcinomas. The existence of such a response in patients with other cancer typescould be determinant for the development of specific antitumour vaccines targeting thep53 protein. We aimed to determine the presence of anti-p53 specific CD8+ T cells in peripheralblood of breast cancer patients in vivo.PATIENTS AND METHOD: p53 264-272-specific CD8+ T cells were directly enumerated in the peripheralcirculation of patients with breast cancer using tetrameric p53 264-272/HLA-A2.1complexes by multicolor flow cytometry. The same procedure was used to enumerate T cellsspecific for another HLA-A2.1 restricted wild type p53 epitope, p53 (149-157).RESULTS: The 99th percentile of the concentration of anti-p53 cells in 6 HLA A2– breast cancerpatients was 1/5634 (cut-off point). The median counts of anti-p53264-272 and anti-p53149-157lymphocytes in 14 HLA A2.1+ patients were 1/2383 and 1/2335 respectively. All of the HLAA2+ patients had concentrations of anti-p53 lymphocytes above the cut-off point for at leastone of the epitopes: 13/14 (93%) for p53264-272 and 11/12 (92%) for p53149-157.CONCLUSIONS: A specific immunological response mediated by anti-p53 CD8+ T cells has beendetected in patients with breast carcinoma. More studies are needed to confirm these resultsand to determine its usefulness for the development of p53-based vaccines

Prognostic significance and diagnostic value of protein S-100 and tyrosinase in patients with malignant melanoma.

OBJECTIVES: The utility of many molecules as tumor markers in melanoma has been investigated with different results. The aims of this study was to compare the value of tyrosinase mRNA by reverse transcription polymerase chain reaction (RT-PCR) in peripheral blood and of serum S-100 protein in patients with melanoma at different stages of disease. METHODS: We have studied 90 peripheral blood samples corresponding to 90 patients that had been diagnosed with melanoma. The clinical staging at the time of blood sampling was performed according to the American Join Committee on Cancer guidelines. S-100 protein in serum was measured by enzyme-linked immunosorbent assay (normal range: 0-0.150 microg) and the presence of tyrosinase mRNA was assessed by RT-PCR. RESULTS: Median progression-free survival was 281 days for tyrosinase positive patients and it has not been reached for tyrosinase negative patients (P = 0.03). Median progression free survival was 213 days for patients with elevated serum S-100 and it has not been reached for patients with normal level of serum S-100 (P < 0.001). Median overall survival (OS) was 396 days for tyrosinase positive patients and it has not been reached for negative patients (P = 0.0096). Median OS was 282 days for patients with elevated serum S-100 and it has not been reached for patients with normal level of serum S-100 (P < 0.001). In a multivariate analysis, both markers have significant prognostic value for time to progression and for survival (chi(2) test). CONCLUSIONS: RT-PCR for tyrosinase mRNA and S-100 are significant prognostic factors for progression-free survival and OS in melanoma. S-100 has higher sensitivity and specificity than tyrosinase.

Common variants on chromosome 5p12 confer susceptibility to estrogen receptor-positive breast cancer.

We carried out a genome-wide association study of breast cancer predisposition with replication and refinement studies involving 6,145 cases and 33,016 controls and identified two SNPs (rs4415084 and rs10941679) on 5p12 that confer risk, preferentially for estrogen receptor (ER)-positive tumors (OR = 1.27, P = 2.5 x 10(-12) for rs10941679). The nearest gene, MRPS30, was previously implicated in apoptosis, ER-positive tumors and favorable prognosis. A recently reported signal in FGFR2 was also found to associate specifically with ER-positive breast cancer.

Two variants on chromosome 17 confer prostate cancer risk, and the one in TCF2 protects against type 2 diabetes.

We performed a genome-wide association scan to search for sequence variants conferring risk of prostate cancer using 1,501 Icelandic men with prostate cancer and 11,290 controls. Follow-up studies involving three additional case-control groups replicated an association of two variants on chromosome 17 with the disease. These two variants, 33 Mb apart, fall within a region previously implicated by family-based linkage studies on prostate cancer. The risks conferred by these variants are moderate individually (allele odds ratio of about 1.20), but because they are common, their joint population attributable risk is substantial. One of the variants is in TCF2 (HNF1beta), a gene known to be mutated in individuals with maturity-onset diabetes of the young type 5. Results from eight case-control groups, including one West African and one Chinese, demonstrate that this variant confers protection against type 2 diabetes.

Common variants on chromosomes 2q35 and 16q12 confer susceptibility to estrogen receptor-positive breast cancer.

Familial clustering studies indicate that breast cancer risk has a substantial genetic component. To identify new breast cancer risk variants, we genotyped approximately 300,000 SNPs in 1,600 Icelandic individuals with breast cancer and 11,563 controls using the Illumina Hap300 platform. We then tested selected SNPs in five replication sample sets. Overall, we studied 4,554 affected individuals and 17,577 controls. Two SNPs consistently associated with breast cancer: approximately 25% of individuals of European descent are homozygous for allele A of rs13387042 on chromosome 2q35 and have an estimated 1.44-fold greater risk than noncarriers, and for allele T of rs3803662 on 16q12, about 7% are homozygous and have a 1.64-fold greater risk. Risk from both alleles was confined to estrogen receptor-positive tumors. At present, no genes have been identified in the linkage disequilibrium block containing rs13387042. rs3803662 is near the 5' end of TNRC9 , a high mobility group chromatin-associated protein whose expression is implicated in breast cancer metastasis to bone.

Prognostic role of circulating melanoma cells detected by reverse transcriptase-polymerase chain reaction for tyrosinase mRNA in patients with melanoma.

A need for factors predictive of prognosis is present in patients who are diagnosed with malignant melanoma. The detection of circulating melanoma cells by reverse transcriptase-polymerase chain reaction for tyrosinase mRNA is a possible negative prognostic factor. The aim of this study was to assess the prognostic value of reverse transcriptase-PCR for tyrosinase mRNA in peripheral blood samples. From January 2000 to February 2003, duplicate blood samples were drawn from 114 melanoma patients following surgery and informed consent, and were tested with reverse transcriptase-PCR, for tyrosinase mRNA. Outer primers for the first PCR were R1 (sense): TTGGCAGATTGTCTGTAGCC and R2 (antisense): AGGCATTGTGCATGCTGCT. For the second round of PCR, nested primers were R3 (sense): GTCTTTATGCAATGGAACGC and R4 (antisense): GCTATCCCAGTAAGTGGACT. Threshold for detection of the technique was determined by adding serially diluted MelJuSo cells to healthy volunteer blood samples. Overall, 91 (79.1%) patients tested negative for tyrosinase mRNA and 24 (20.9%) tested positive. The number of patients who tested positive by stage was 3/38 (7.9%) for stage I, 3/22 (13.6%) for stage II, 5/30 (16.7%) for stage III and 13/24 (54.2%) for stage IV (P< 0.0001). 11/90 (12.2%) patients with no evidence of disease (stage I, II and III) tested positive and 13/24 (54.2%) patients with clinically confirmed distant metastases (stage IV) tested positive (P<0.00001). With median follow-up of 372 days or to death (range: 0-1303 days), median progression-free survival has not been reached for tyrosinase-negative patients and was 265 days for tyrosinase-positive patients (P<0.00001, log-rank test=21.07). Median overall survival was 344 days for tyrosinase-positive patients and has not been reached for tyrosinase-negative patients (P=0.0001, log-rank test=21.38). Stage, Breslow thickness and result of RT-PCR were significant prognostic factors for disease-free survival in a multivariate analysis, and stage was the only significant prognostic factor for overall survival. In conclusion, detection of circulating melanoma cells by reverse transcriptase-PCR for tyrosinase mRNA is a significant adverse prognostic factor for disease-free survival in patients with malignant melanoma.

Results of a pilot trial of immunotherapy with dendritic cells pulsed with autologous tumor lysates in patients with advanced cancer.

AIMS AND BACKGROUND: The purpose of the study was to test the immunological and clinical effects of infusions of dendritic cells pulsed with autologous tumor lysate in patients with advanced cancer. PATIENTS AND METHODS: Peripheral blood mononuclear cells from 15 patients with metastatic cancer (melanoma in 10, lung cancer in 2, renal cell carcinoma in 1, sarcoma in 1, breast cancer in 1) were harvested by leukapheresis after mobilization with GM-CSF (5 microg/kg/day s.c. for 4 days). Mononuclear cells were separated and cultured in GM-CSF (1000 U/ml) and interleukin-4 (1000 U/ml) for 7 days. Phenotype was assessed by 2-color flow cytometry and immunocytochemistry. On day 6, dendritic cells were pulsed with 1 g of fresh autologous tumor lysate for 24 h and infused intravenously. Interleukin-2 (6 million IU), interferon a (4 million IU) and GM-CSF (400 microg) were injected s.c. daily for 10 days beginning on the day of dendritic cell infusion. Treatment was repeated every 21 days for 3 courses. RESULTS: The morphology, immunocytochemistry and phenotype of cultured cells was consistent with dendritic cells: intense positivity for HLA-DR and CD86, with negativity for markers of other lineages, including CD3, CD4, CD8 and CD14. More than 5 x 10(7) dendritic cells were injected in all patients. Nine patients developed >5 mm delayed type cutaneous hypersensitivity reactions to tumor lysate+/-GM-CSF after the first immunization (larger than GM-CSF in all cases). Median delayed type cutaneous hypersensitivity to lysate +/- GM-CSF was 3 cm after the third immunization. One melanoma patient with skin, liver, lung and bone metastases had a partial response lasting 8 months (followed by progression in the brain). Seven patients had stable disease for >3 months, and 7 had progression. CONCLUSIONS: Infusion of tumor lysate-pulsed dendritic cells induces a strong cell-mediated antitumor immune reaction in patients with advanced cancer and has some clinical activity.

Genome-wide association study identifies a second prostate cancer susceptibility variant at 8q24.

Prostate cancer is the most prevalent noncutaneous cancer in males in developed regions, with African American men having among the highest worldwide incidence and mortality rates. Here we report a second genetic variant in the 8q24 region that, in conjunction with another variant we recently discovered, accounts for about 11%-13% of prostate cancer cases in individuals of European descent and 31% of cases in African Americans. We made the current discovery through a genome-wide association scan of 1,453 affected Icelandic individuals and 3,064 controls using the Illumina HumanHap300 BeadChip followed by four replication studies. A key step in the discovery was the construction of a 14-SNP haplotype that efficiently tags a relatively uncommon (2%-4%) susceptibility variant in individuals of European descent that happens to be very common (approximately 42%) in African Americans. The newly identified variant shows a stronger association with affected individuals who have an earlier age at diagnosis.

Phase II multicentre study of temozolomide in combination with interferon alpha-2b in metastatic malignant melanoma.

OBJECTIVE: Temozolomide is a novel oral alkylating agent, active against metastatic melanoma. Combinations of chemotherapy and biological response modifiers have been associated with increased antitumour activity. A multicentre phase II study was performed to assess the activity and toxicity of temozolomide in combination with interferon alpha-2b. PATIENTS AND METHODS: Eligible patients had histologically confirmed metastatic melanoma. Previously untreated patients received temozolomide administered orally at a dose of 150 mg/m/day for 5 days every 4 weeks, in combination with interferon given continuously subcutaneously twice a week at a dose of 10 MU/m. Treatment continued until disease progression or for a maximum of 12 months. RESULTS: From June 1999 to August 2002, 27 eligible patients were included in the study at six centres. Median age was 59 (28-77) years; 17 male and 10 female patients were recruited; the median Karnofsky performance score was 90 (70-100); three patients had received prior adjuvant interferon; the majority of patients had fewer than three involved sites. A total of 96 cycles were administered; there were one complete response, four partial response and five stable disease (overall response rate: 18.5%, 95% confidence interval: 6.3-38.1). All responses were seen in patients with exclusively lymph node and pulmonary disease [M1a (one patient); M1b (four patients)]. The median response duration was 6.9 months. One patient remains in complete remission at 4 years. The median time to progression and the median survival were 1.87 and 9.5 months, respectively. Haematological toxicity was neutropenia G-IV: 1, G-III: 4, thrombocytopenia G-III: 2, and anaemia G-III: 2. Predominant non-haematological toxicity was hepatotoxicity G-III: 4. Other toxicities were mild or moderate. Dose reduction was required for nine cycles of interferon, one of temozolomide and two of both drugs. CONCLUSIONS: Temozolomide in combination with interferon is a well-tolerated palliative regimen that has moderate activity against metastatic melanoma. Further evaluation of this regimen in comparative studies or in combination with other drugs is warranted.

Gemcitabine/capecitabine in patients with metastatic breast cancer pretreated with anthracyclines and taxanes.

PURPOSE: Gemcitabine and capecitabine are 2 anticancer drugs with a mechanism of action involving metabolism of pyrimidine nucleotides. Both are among the few agents active in patients with metastatic breast cancer (MBC) progressing after therapy with anthracyclines and taxanes. We have conducted a phase II trial of gemcitabine/capecitabine in patients with disease progression after treatment with anthracyclines and taxanes. PATIENTS AND METHODS: Treatment included gemcitabine 2000 mg/m2 on day 1 every 3 weeks and capecitabine 2500 mg/m2 daily (divided into 2 doses) on days 1-14 every 3 weeks; treatment was administered until disease progression or unacceptable toxicity was documented. All patients received concomitant oral pyridoxine 300 mg twice daily to prevent hand-foot syndrome (HFS). Of 39 patients treated, 33 had received previous treatment with anthracyclines, 6 had medical contraindication to anthracyclines, 35 had previously received taxanes, and 23 had received vinorelbine. Fourteen patients had previous high-dose chemotherapy with stem cell rescue and 5 had previously received trastuzumab. Patients were 31-79 years of age (median, 55 years) and, altogether, were given 386 courses of therapy (range, 1-36 courses per patient; median, 6 courses). RESULTS: Grade 3/4 toxicities included HFS (11 courses, 6 patients), stomatitis (6 courses, 2 patients), diarrhea (5 courses, 4 patients), anemia (5 courses, 2 patients), thrombocytopenia (5 courses, 2 patients), and neutropenia (1 course, 1 patient). Response rate (all 39 patients were evaluable) was 48.7% (partial response, n = 19; stable disease, n = 7; progressive disease, n = 13). Thirty-six patients died because of disease progression, and 3 are alive with progressive disease. Median follow-up was 26 months or until death. Median duration of response was 15 months (range, 3-26 months). Median time to disease progression was 5 months (range, 1-26 months). Median overall survival duration was 10 months (range, 1-37 months). CONCLUSION: In this cohort of patients heavily pretreated with anthracyclines and taxanes, the response rate to gemcitabine/capecitabine is encouraging, although response duration is limited.

Biweekly docetaxel and vinorelbine as first-line chemotherapy in metastatic breast cancer.

This study was designed to evaluate the antitumor activity and tolerance of biweekly docetaxel plus vinorelbine as first-line chemotherapy in patients with metastatic breast cancer (MBC). Forty-one patients with measurable disease and no prior chemotherapy for MBC were treated with docetaxel 60 mg/m(2) plus vinorelbine 30 mg/m(2) on day 1, every 2 weeks for a maximum of 12 courses. Median age was 58 years (range, 23-75). Fourteen patients (34.1%) were premenopausal and 27 (65.9%) were postmenopausal. Most patients had received prior neoadjuvant/adjuvant chemotherapy (n = 27, 65.9%), radiation therapy (n = 22, 53.6%), and hormone therapy (n = 21, 51.2%). The most frequent sites of metastasis were bone (n = 18, 43.9%), pleuropulmonary (n = 16, 39%), and liver (n = 14, 34.1%). Twenty-seven patients (65.9%) had more than one site of metastasis. Three hundred and thirty-nine courses were given (median, 8 courses per patient; range, 1-12). Median relative dose intensity was 85% for both docetaxel and vinorelbine. Grade 3/4 toxicities included neutropenia (14 patients, 34.1%), febrile neutropenia (n = 14, 34.1%), and stomatitis (n = 4, 9.8%). No treatment-related deaths were reported. All patients were assessed for response in an intent-to-treat analysis. Four patients (9.8%) had a complete response and 19 (46.3%) had a partial response (overall response rate, 56.1%; 95% CI, 42%-70%). Six patients (14.6%) had stable disease and 12 patients (29.3%) had progressive disease. With a median follow-up of 15.1 months or until death, median duration of response is 12.6 months. Median time to progression is 12.4 months. Median survival time is 19.6 months. This biweekly combination of docetaxel plus vinorelbine is feasible and active as first-line chemotherapy in patients with MBC. This regimen is safe and well tolerated.