High nest failure in a zebra finch population and persistent nest predation by a monitor lizard.

Predation is well known to have substantial effects on behaviour and fitness in many animals. In songbirds, nest predation is rarely observed directly, so that research focusses primarily on the consequences of predation and less on the behaviour of the predator. Here, we report predation data in a zebra finch (Taeniopygia catanosis) nest box population, highlighting a 22-min-long sequence, captured on video, of a sand goanna (Varanus gouldii) predating a zebra finch nest in the wild. This monitor lizard appeared to be extremely persistent with climbing and jumping up to the next box nine times, including three successive unsuccessful attempts that lead to a change in approach strategy. It removed all six nestlings from the nest box during those repeated approaches and consumed them. In combination with overall high predation rates in the study population we document here, the findings highlight the role that a single predator species can have on nest success and, thus potentially also breeding decisions and social organisation of the prey population. Specifically so in a species like the zebra finch which synchronises reproductive attempts through the use of social information acquired through nest inspections and which uses social hotspots where they could gather information on changes in local social composition due to the individualised signals they use.

Edge computing in wildlife behavior and ecology.

Modern sensor technologies increasingly enrich studies in wildlife behavior and ecology. However, constraints on weight, connectivity, energy and memory availability limit their implementation. With the advent of edge computing, there is increasing potential to mitigate these constraints, and drive major advancements in wildlife studies.

Rouxiella badensis, a new bacterial pathogen of onion causing bulb rot.

Onion bulb rot can be caused by multiple plant pathogens including bacterial pathogens. During our routine survey of commercial onion farms in 2014, 2020, and 2021, seven putative Rouxiella spp. strains were isolated from symptomatic onion samples in Georgia, United States. Upon fulfilling Koch's postulates on onion, a genome analysis was conducted. Whole-genome indices (ANI and dDDH) showed that the strains belonged to Rouxiella badensis. Although the seven R. badensis strains were not pathogenic on onion foliage, the strains were able to cause bulb rot and could also produce necrotic lesions in a red onion scale assay. R. badensis populations increased significantly and to a level comparable to P. ananatis PNA 97-1R in a red onion scale infection assay. The core-genome analysis grouped all onion R. badensis strains from Georgia together, and distinct from R. badensis strains isolated from other sources and locations. Based on the genome analysis of strains (from the current study and available genomes in the repository), type I, III (Ssa-Esc and Inv-Mxi-Spa types), and V secretion systems are present in R. badensis genomes, while type II, IV, and VI secretion systems are absent. However, various secondary metabolite gene clusters were identified from R. badensis genomes, and a thiol/redox-associated enzyme gene cluster similar to the Pantoea alt cluster mediating thiosulfinate tolerance was also present in onion strains of R. badensis. This is the first report of R. badensis as a plant pathogen.

Pseudomonas alliivorans sp. nov., a plant-pathogenic bacterium isolated from onion foliage in Georgia, USA.

This study provides a taxonomic characterization of three bacterial strains isolated from onion seedlings in Georgia USA. Yellow-colored colonies were isolated, and a diffusible fluorescent pigment was visible under ultraviolet light on King's medium B. Preliminary analysis of the basic phenotype tests and 16S rRNA gene sequence analysis indicated the onion strains were closely related to Pseudomonas viridiflava with the highest similarity to P. viridiflava DSM 6694T (99.6%). The phylogenomic analyses based on whole genome sequences showed that the onion strains formed a separate monophyletic clade from other species with P. viridiflava as the closest neighbor. When the onion strains and the P. viridiflava type strain were compared, the average nucleotide identity values was 91.6%. Additionally, the digital DNA-DNA hybridization values of the onion strains were 45.8% or less when compared to the type strains of their close relatives, including P. viridiflava. In addition, biochemical, physiological features, and cellular fatty acid compositions were determined for a polyphasic taxonomic analysis. The results supported that the three onion strains represented a novel Pseudomonas species. We propose a new species as Pseudomonas alliivorans sp. nov., with 20GA0068T (=LMG 32210T = CFBP 8885T) as the type strain. The DNA G + C content of the strain 20GA0068T is 59.1 mol%.

First Report of Stubby-Root Nematode, Paratrichodorus minor, on Onion in Georgia, U.S.A.

Onions ( Allium cepa L.) are the leading vegetable crop in Georgia accounting for 13.7% of total state vegetable production ( Wolfe and Stubbs, 2017 ). In November 2017, two samples each of onion (var. Candy Ann) seedlings and soil were received from the University of Georgia Cooperative Extension office in Tattnall County, GA. The samples were collected from a nursery fumigated with metam sodium and used for sweet onion transplant production. Symptoms of the damaged plants included stunted growth both in the root system and foliage, tip die-back of the leaves ( Fig. 1A,B ), and slight swelling at the tip of roots. Vermiform life stages from the soil samples were extracted using centrifugal-flotation technique ( Jenkins, 1964 ). On an average, 67 stubby-root nematodes per 100 cm 3 of soil were obtained. Additional two soil samples were collected from the nursery in December 2017 to confirm the presence of the nematode. On an average, 1 and 75 nematodes per 100 cm 3 of soil were recovered from areas with healthy and infested plants, respectively. Because the male individuals were not found in the soil samples, females were used for species identification. Morphological and molecular analyses of females ( Fig. 2A-C ) identified the species as Paratrichodorus minor (Colbran) Siddiqi; ( Decraemer, 1995 ). Nematode body shape was "cigar-shaped" with dorsally curved "onchiostyle" stylet Females had an oval-shaped vagina, vulva a transverse slit, and lateral body pores were absent. The measurements of females ( n = 20) included: body length 671.1 (570.1-785.3) µm; body width 32.5 (27.8-37.0) µm; onchiostyle 32.5 (31.1-34.8) µm; anterior end to esophagus-intestinal valve 117.6 (101.2-128.5) µm; a 21.5 (15.3-28.1) µm; b 5.2 (4.9-6.3) µm; V 52.9% (48.1-55.4%) µm; and vagina length 8.7 (7.8-10.7) µm. To confirm the identity of P. minor, DNA was extracted from single females ( n = 3) using Extract-N-Amp ™ Tissue PCR Kit (Sigma-Alredich Inc., St. Louis, MO). The partial 18S rRNA, the D2-D3 expansion segments of 28S rRNA, and ITS1 rDNA were amplified using primer pairs 360F (5' CTACCACATCCAAGGAAGGC 3')/932R (5' TATCTGATCGCTGTCGAACC 3'), D2A (5' ACAAGTACCGTGAGGGAAAGTTG 3')/D3B (5' TCGGAAGGAACCAGCTACTA 3'), and BL18 (5' CCCGTCGCTACTACCGATT 3')/5818 (5' ACGARCCGAGTGATCCAC 3'), respectively ( Riga et al., 2007 ; Duarte et al., 2010 ; Ye et al., 2015 ; Shaver et al., 2016 ). The obtained PCR fragments were purified using QIAquick Gel Extraction Kit (Qiagen Inc., Santa Clara, CA, USA), sequenced and deposited in the GenBank databases (18S rRNA: MG856931; 28S rRNA: MG856933; ITS1 rDNA: MH464152). The 18S rRNA, 28S D2-D3, and ITS1 rDNA sequences shared 99% similarity (100% coverage) with GenBank accessions of P. minor from California, Arkansas, and China (18S rRNA: JN123365; 28S D2-D3: JN123395; ITS1 rDNA: GU645811). In a pathogenicity test, five sweet onion seeds var. Pirate were planted (one per pot) in 11.5-cm-diameter polyethylene pots containing 1,000 cm 3 of equal parts of pasteurized field soil and sand, and then inoculated with 1,000 fresh P. minor . Plants were grown for 9 wk in a greenhouse at 25 ± 2°C prior to extraction of nematodes from soil. Plant roots were abbreviated and final population density of P. minor was 2,856 ± 104 per pot (285 nematodes/100 cm 3 of soil) confirming the nematode parasitism on onion. To our knowledge, this is the first report of P. minor parasitizing onion in Georgia. Stubby-root nematode ( Paratrichodorus sp.) has already been reported on corn, St. Augustine grass, and switchgrass in Georgia ( Heald and Perry, 1969 ; Davis and Timper, 2000 ; Mekete et al., 2011 ). In the U.S.A, P. minor is known to occur on diverse crops in most of the states ( Decraemer, 1995 ; CABI/EPPO, 2002 ). A survey of vegetable-producing areas in Georgia is currently under investigation to determine the distribution of this economically important nematode species. Figure 1Damage symptoms caused by stubby-root nematode Paratrichodorus minor on sweet onion in Georgia. A large area of stunted and chlorotic plant foliage (A); Infested seedlings with abbreviated roots and necrotic leaf tips (B). Figure 2Light microscopy micrographs showing morphological characters of stubby-root nematode, Paratrichodorus minor. Entire body (A), anterior end (B), and posterior region (C) of female nematode.

Odours from marine plastic debris induce food search behaviours in a forage fish.

Plastic pollution is an anthropogenic stressor in marine ecosystems globally. Many species of marine fish (more than 50) ingest plastic debris. Ingested plastic has a variety of lethal and sublethal impacts and can be a route for bioaccumulation of toxic compounds throughout the food web. Despite its pervasiveness and severity, our mechanistic understanding of this maladaptive foraging behaviour is incomplete. Recent evidence suggests that the chemical signature of plastic debris may explain why certain species are predisposed to mistaking plastic for food. Anchovy (Engraulis sp.) are abundant forage fish in coastal upwelling systems and a critical prey resource for top predators. Anchovy ingest plastic in natural conditions, though the mechanism they use to misidentify plastic as prey is unknown. Here, we presented wild-caught schools of northern anchovy (Engraulis mordax) with odour solutions made of plastic debris and clean plastic to compare school-wide aggregation and rheotactic responses relative to food and food odour presentations. Anchovy schools responded to plastic debris odour with increased aggregation and reduced rheotaxis. These results were similar to the effects food and food odour presentations had on schools. Conversely, these behavioural responses were absent in clean plastic and control treatments. To our knowledge, this is the first experimental evidence that adult anchovy use odours to forage. We conclude that the chemical signature plastic debris acquires in the photic zone can induce foraging behaviours in anchovy schools. These findings provide further support for a chemosensory mechanism underlying plastic consumption by marine wildlife. Given the trophic position of forage fish, these findings have considerable implications for aquatic food webs and possibly human health.