Integrated pharmacokinetic, pharmacodynamic and immunogenicity profiling of an anti-CCL21 monoclonal antibody in cynomolgus monkeys.

QBP359 is an IgG1 human monoclonal antibody that binds with high affinity to human CCL21, a chemokine hypothesized to play a role in inflammatory disease conditions through activation of resident CCR7-expressing fibroblasts/myofibroblasts. The pharmacokinetics (PK) and pharmacodynamics (PD) of QBP359 in non-human primates were characterized through an integrated approach, combining PK, PD, immunogenicity, immunohistochemistry (IHC) and tissue profiling data from single- and multiple-dose experiments in cynomolgus monkeys. When compared with regular immunoglobulin typical kinetics, faster drug clearance was observed in serum following intravenous administration of 10 mg/kg and 50 mg/kg of QBP359. We have shown by means of PK/PD modeling that clearance of mAb-ligand complex is the most likely explanation for the rapid clearance of QBP359 in cynomolgus monkey. IHC and liquid chromatography mass spectrometry data suggested a high turnover and synthesis rate of CCL21 in tissues. Although lymphoid tissue was expected to accumulate drug due to the high levels of CCL21 present, bioavailability following subcutaneous administration in monkeys was 52%. In human disease states, where CCL21 expression is believed to be expressed at 10-fold higher concentrations compared with cynomolgus monkeys, the PK/PD model of QBP359 and its binding to CCL21 suggested that very large doses requiring frequent administration of mAb would be required to maintain suppression of CCL21 in the clinical setting. This highlights the difficulty in targeting soluble proteins with high synthesis rates.

Potent and efficacious inhibition of CXCR2 signaling by biparatopic nanobodies combining two distinct modes of action.

Chemokines and chemokine receptors are key modulators in inflammatory diseases and malignancies. Here, we describe the identification and pharmacologic characterization of nanobodies selectively blocking CXCR2, the most promiscuous of all chemokine receptors. Two classes of selective monovalent nanobodies were identified, and detailed epitope mapping showed that these bind to distinct, nonoverlapping epitopes on the CXCR2 receptor. The N-terminal-binding or class 1 monovalent nanobodies possessed potencies in the single-digit nanomolar range but lacked complete efficacy at high agonist concentrations. In contrast, the extracellular loop-binding or class 2 monovalent nanobodies were of lower potency but were more efficacious and competitively inhibited the CXCR2-mediated functional response in both recombinant and neutrophil in vitro assays. In addition to blocking CXCR2 signaling mediated by CXCL1 (growth-related oncogene α) and CXCL8 (interleukin-8), both classes of nanobodies displayed inverse agonist behavior. Bivalent and biparatopic nanobodies were generated, respectively combining nanobodies from the same or different classes via glycine/serine linkers. Interestingly, receptor mutation and competition studies demonstrated that the biparatopic nanobodies were able to avidly bind epitopes within one or across two CXCR2 receptor molecules. Most importantly, the biparatopic nanobodies were superior over their monovalent and bivalent counterparts in terms of potency and efficacy.

Proteolytic activity of the house dust mite allergen Der p 1 enhances allergenicity in a mouse inhalation model.

BACKGROUND: We have recently demonstrated that intraperitoneal immunization of mice with proteolytically active Der p 1, the major house dust mite allergen, results in a significant and selective enhancement of total and Der p 1-specific IgE synthesis compared to mice immunized with proteolytically inactive Der p 1. OBJECTIVE: To investigate whether the proteolytic activity of Der p 1 would lead to enhanced inflammatory cellular infiltration of the lungs and systemic IgE production when administered through the respiratory system, which is the natural route of entry for this allergen. METHODS: Groups of mice were initially sensitized with proteolytically active Der p 1 through the intraperitoneal and the subcutaneous routes and subsequently exposed intranasally to either proteolytically active Der p 1, inactive Der p 1 or PBS. The extent of cellular infiltration of the lungs and systemic IgE production in the three animal groups were then compared. RESULTS: Here, we show for the first time that the administration of proteolytically active Der p 1 to mice through the intranasal route leads to significant inflammatory cellular infiltration of the lungs and systemic production of IgE. CONCLUSIONS: These data underline the important role of the proteolytic activity of Der p 1 in driving the allergic response in the lungs.

Th2-dependent airway eosinophilia is regulated by preproenkephalin.

We have used preproenkephalin (PPNK)-deficient mice to study the role of PPNK in the development of airway inflammation. Airway eosinophilia was established by either sensitization followed by airway challenge with OVA or by infection with Nippostrongylus brasiliensis. Both models induce a strong Th2 immune response, characterized by an IL-5-dependent airway eosinophilia. We observed that although the accumulation of lymphocytes in the airways of PPNK-deficient mice was similar to that induced in control mice, IL-5 production and eosinophil infiltration were reduced. We conclude from this work that PPNK has a role in enhancing Th2 cell function and that this molecule may be an important target in asthma immunotherapy.

Homologous human and murine antisense oligonucleotides targeting stat6. Functional effects on germline cepsilon transcript.

Interleukin (IL)-4 and (IL)-13 induce immunoglobulin (Ig)E synthesis via activation of the transcription factor signal transducer and activator of transcription (Stat)6. The present study describes the identification and characterization of antisense oligonucleotides to Stat6 as an approach to interrupt IL-4 and IL-13 signaling and thereby to attenuate germline Cepsilon transcription, a prerequisite to IgE synthesis. A limited gene-walk was performed with chemically modified oligonucleotides to identify sequences capable of downregulating both human and murine Stat6. A chimeric oligonucleotide (9b, base sequence GTGAGGTCCTGTTCAGTGGG) demonstrated high levels of antisense activity in both species. Further characterization of 9b showed a dose-dependent Stat6 messenger RNA (mRNA) and protein downregulation (concentration that produces 50% inhibition of effect = 168 and 215 nM, respectively) through a ribonuclease H-dependent antisense mechanism with no effect on closely related members of the Stat family. Further, pretreatment of DND39 cells (human Burkitt lymphoma cell line) with oligonucleotide 9b before IL-4 stimulation successfully downregulated germline Cepsilon transcription. Because Stat6 represents an attractive but technically challenging drug discovery target, antisense oligonucleotides may provide an alternative approach to low molecular-weight compounds for inhibiting IL-4 and IL-13 signaling.

Preproenkephalin is a Th2 cytokine but is not required for Th2 differentiation in vitro.

Preproenkephalin (PPNK) mRNA expression has been detected in many cells of the immune system, including monocytes and lymphocytes. In the present paper, the expression of PPNK mRNA in purified CD4+ Th1 and Th2 lymphocyte subpopulations is investigated and correlated with the presence of the opioid neuropeptides leu- and met-enkephalin. We found that PPNK mRNA and met-enkephalin were present at higher levels in the Th2 cultures compared with the Th1 cultures. Lymphocytes from PPNK-deficient mice were then used to look at the role of PPNK in Th2 lymphocyte differentiation. Lymphocytes from these mice could be driven into a Th2 phenotype, suggesting that cultures containing IL-4 do not require PPNK for Th2 differentiation.

High yield expression and secretion of the ovine pregnancy recognition hormone interferon-tau by Pichia pastoris.

The early conceptus (embryo and associated membranes) of domestic ruminats signals its presence to the maternal uterus through production of interferon-tau (IFN-tau). Production of IFN-tau ensures continued production of progesterone, the hormone of pregnancy, by the ovarian corpus luteum. This paper reports the high-level expression and efficient secretion of biologically active recombinant ovine IFN-tau (rOvIFN-tau) by Pichia pastoris. The developed method produces more than 80% pure recombinant ovine IFN-tau, obviating the need for further purification for many purposes. Initial fermentation studies produced IFN-tau at 280 mg/liter and demonstrate the potential of this system for large-scale production of IFN-tau.

Histidine-49 is necessary for the pH-dependent transition between active and inactive states of the bovine F1-ATPase inhibitor protein.

The role of the histidyl residue at position 49 (H49) of the bovine mitochondrial F1-ATPase inhibitor protein (F1I) was examined by site-directed mutagenesis. Six amino acids (Q, E, K, V, L, and I) were substituted for H49 and the activities of the resulting inhibitor proteins were characterized with respect to pH. Each of the six mutations abolished the pH sensitivity which is characteristic of wild-type F1I. At pH 8.0 each of the mutations caused an increase in apparent maximum inhibition and a decrease in apparent Ki relative to wild type. At pH 6.7 the hydrophilic substitutions had little effect on apparent Ki, while the hydrophobic substitutions caused increases of 3.5- to 8.5-fold relative to wild type. The ratios of apparent Ki at pH 8.0 to apparent Ki at pH 6.7 were in the range of 0.5 to 1.6 for the mutants, whereas the wild-type value is 15.0. The mutations appear to shift the equilibrium between active and inactive conformations of F1I toward the active state. We find that H49 is required by F1I for sensitivity to pH and that it may facilitate the transition between active and inactive states of F1I. A possible role for H49 in the stabilization of the inactive state through participation in a multivalent complex with Zn2+ is also discussed.

Intrauterine injection of recombinant ovine interferon-tau extends the interestrous interval in sheep.

The ability of recombinant ovine interferon-tau (roIFNtau) to extend the interestrous interval (IEI) in sheep was studied. Ewes were fitted with bilateral uterine catheters 7 or 8 days post estrus and were assigned to receive either 10 or 20 million antiviral (AV) units/day i.u. ( approximately 100 or 200 ug) of roIFNtau or ovine conceptus secretory proteins containing equivalent AV units of native oIFNtau (noIFNtau; 4 ewes/treatment). Four control ewes received ovine serum proteins (SP). Total protein injected was 6 mg per day, half at 0700 hours and half at 1730 hours. The treatments were administered from Day 11.5 (estrus=Day 0) to Day 16. Blood samples were collected by jugular vienipuncture daily from Day 11 until ewes returned to estrus. Concentrations of progesterone (P) in plasma were determined by RIA. Treatment with either noIFNtau or roIFNtau extended IEI beyond that of SP-treated ewes (19.1 vs 31.2+/-3.4 days P<0.03). Of the ewes receiving 100 mug/day of oIFNtau, 2 of 4 receiving noIFNtau (23.6+/-5.2 days) and 3 of 4 receiving roIFNtau (34.2+/-5.2 days) had an extended IEI. All ewes receiving 200 mug/day of noIFNtau or roIFNtau had an extended IEI (28.8 and 38.5+/-5.2 days. respectively). Ewes receiving roIFNtau had a longer IEI than those receiving noIFNtau (36.7 vs 26.2+/-3.4 days; P=0.07). Ewes with an extended IEI had functional corpora lutea, as assessed by P production. The results demonstrate that 10 or 20 million AV units ( approximately 100 or 200 ug) of roIFNtau extends the IEI and that the length of the IEI is longer for ewes receiving roIFNtau than noIFNtau following injection of equivalent AV units.

Recombinant bovine heart mitochondrial F1-ATPase inhibitor protein: overproduction in Escherichia coli, purification, and structural studies.

A synthetic gene coding for the inhibitor protein of bovine heart mitochondrial F1 adenosine triphosphatase was designed and cloned in Escherichia coli. Recombinant F1-ATPase inhibitor protein was overproduced in E. coli and secreted to the periplasmic space. Biologically active recombinant F1-ATPase inhibitor protein was recovered from the bacterial cells by osmotic shock and was purified to near homogeneity in a single cation-exchange chromatography step. The recombinant inhibitor protein was shown to inhibit bovine mitochondrial F1-ATPase in a pH-dependent manner, as well as Saccharomyces cerevisiae mitochondrial F1-ATPase. Thorough analysis of the amino acid sequence revealed a potential coiled-coil structure for the C-terminal portion of the protein. Experimental evidence obtained by circular dichroism analyses supports this prediction and suggests F1I to be a highly stable, mainly alpha-helical protein which displays C-terminal alpha-helical coiled-coil intermolecular interaction.

Glutamine inhibits the ammonia-dependent activities of two Cys-1 mutants of human asparagine synthetase through the formation of an abortive complex.

Cys-1 mutants of recombinant human asparagine synthetase were constructed and their ability to catalyze the glutamine-dependent nitrogen transfer reaction required for asparagine biosynthesis was determined. In agreement with previous work, altering Cys-1 to either Ala or Ser eliminated the glutamine-dependent activity while only minimally affecting the kinetic properties of the ammonia-dependent reaction. A lack of glutaminase activity in these mutants also allowed examination of glutamine binding in studies of the ability of glutamine to inhibit the ammonia-dependent production of asparagine. In both mutants, analysis of the observed kinetics indicated that glutamine inhibited ammonia-dependent asparagine synthesis through the formation of an abortive complex. This unanticipated observation suggests that the commonly accepted mechanism for nitrogen transfer from the primary amide of glutamine to aspartic acid in asparagine synthetase may have to be re-examined. A novel mechanistic proposal which is consistent with the formation of an abortive complex in the two Cys-1 mutants is presented.

Gene fusions with human carbonic anhydrase II for efficient expression and rapid single-step recovery of recombinant proteins: expression of the Escherichia coli F1-ATPase epsilon subunit.

A new expression vector was constructed which allows the overproduction in Escherichia coli of tripartite proteins consisting of human carbonic anhydrase isozyme II (hCAII), a peptide linker containing an enterokinase cleavage site, and a target protein of interest. Carbonic anhydrase is soluble and stable in E. coli and serves as a highly specific purification tag in the recovery of the fusion protein by a single affinity chromatography step. The enterokinase cleavage site was engineered into the construct to allow accurate and efficient release of the target protein. To demonstrate the practical value of this vector, the E. coli F1-ATPase epsilon subunit was expressed as a fusion with hCAII. After a single purification step, biologically active recombinant E. coli F1-ATPase epsilon subunit was recovered following proteolytic removal of the hCAII moiety.

Kinetic analysis of a mutant (His107-->Tyr) responsible for human carbonic anhydrase II deficiency syndrome.

The replacement His107-->Tyr is a cause of carbonic anhydrase II deficiency syndrome in humans (Venta, P. J., Welty, R. J., Johnson, T. M., Sly, W. S., and Tashian, R. E. (1991) Am. J. Hum. Genet. 49, 1082-1090). We have prepared this mutant of human carbonic anhydrase II by site-directed mutagenesis and expressed it in Escherichia coli. The mutant was too unstable to purify; however, we were able to stabilize and store it at 4 degrees C in cell lysates containing 1-4 mg/ml bovine serum albumin. The concentration of this mutant in the lysate was determined by titration with the tight-binding inhibitor ethoxzolamide. The stability in this preparation was sufficient to determine that this mutant of carbonic anhydrase II has kcat/Km and apparent pKa for the hydration of CO2 equivalent to that of wild-type HCA II. The maximum velocity of CO2 hydration, which is dependent on the rate of proton transfer between enzyme and solution, was 3-fold smaller than for HCA II suggesting that the proton transfer pathway in the mutant is slightly less efficient than in wild type. Preliminary conformational energy calculations show that the replacement of His107 with the larger residue Tyr results in considerable distortion of the cavity surrounding site 107 and in the loss of at least two hydrogen bonds.

Catalysis by mutants of human carbonic anhydrase II: effects of replacing hydrophobic residues 198 and 204.

Previous studies shows that the replacement of Phe-198 in carbonic anhydrase III to the corresponding Leu residue found in carbonic anhydrase II caused the appearance of isozyme II-like activity (LoGrasso et al. (1991) Biochemistry 30, 8463-8470). Carbonic anhydrase II is more efficient in the catalysis of CO2 hydration by 500-fold and has an apparent pKa for this catalysis about two pKa units above that of carbonic anhydrase III. Moreover, isozyme II catalyzes the hydrolysis of 4-nitrophenyl acetate, whereas isozyme III shows no appreciable catalysis. The purpose of this work was to test the hypothesis that making the converse replacement Leu-198-->Phe as well as Leu-204-->Glu and the double replacement in carbonic anhydrase II would give the resulting mutants of isozyme II properties of isozyme III. The catalytic activities of these mutants in CO2 hydration and 4-nitrophenyl acetate hydrolysis were smaller by at most 5-fold and the pKa values for these catalyses were identical compared with wild-type isozyme II. The different effects of converse mutants of HCA II and III indicate complexity in structure not evident from their similar backbone conformations.

High-level expression of human asparagine synthetase and production of monoclonal antibodies for enzyme purification.

In order to obtain large quantities of extremely pure human asparagine synthetase for detailed kinetic and structural studies, its gene was cloned into a 2mu plasmid (pBS24.1GAS) suitable for replication in a Saccharomyces cerevisiae cir0 strain (AB116). In this construct, the transcription of the asparagine synthetase gene is regulated by the alcohol dehydrogenase II/glyceraldehyde-3-phosphate dehydrogenase promoter, which is subject to glucose repression. The expression of the enzyme was allowed to take place in yeast minimal medium containing D-galactose as the only sugar nutrient. Eleven monoclonal antibodies to recombinant human asparagine synthetase were produced and one of them was selected to make immunoaffinity resins. After single-step immunoaffinity chromatography, more than 1.2 mg of homogeneous enzyme was obtained from the total cell extract from a 100-ml yeast culture. The yield of pure enzyme was over 100-fold higher than that of a previously reported yeast expression system. SDS-PAGE analysis showed the enzyme to be extremely pure and isoelectric focusing gel electrophoresis showed that the enzyme has an isoelectric point of 7.5. Immunoaffinity-purified recombinant human asparagine synthetase demonstrated both glutamine-dependent and ammonia-dependent asparagine synthetase activities, as well as glutaminase activity.

Cloning and nucleotide sequence of the Vibrio proteolyticus aminopeptidase gene.

The gene encoding the Vibrio proteolyticus aminopeptidase was cloned and sequenced and its amino acid sequence was deduced. The gene encodes a 54 kDa protein, larger than the previously reported size of 30 kDa for the purified aminopeptidase. Sequence alignments revealed a 43-45% homology with two other Vibrio sp. extracellular proteinases.

Cloning and expression in Saccharomyces cerevisiae of a synthetic gene for the type-I trophoblast interferon ovine trophoblast protein-1: purification and antiviral activity.

Ovine trophoblast protein-1 (oTP-1) is a unique, Type I, trophoblast interferon (IFN) that possesses potent antiviral activity and is thought to be primarily responsible for maternal recognition of pregnancy in sheep. To provide sufficient amounts of protein for detailed studies, a synthetic gene for oTP-1 was designed and assembled in Escherichia coli, subcloned into a yeast expression plasmid, and used to overproduce recombinant oTP-1 in Saccharomyces cerevisiae. Recombinant oTP-1 was purified from soluble yeast extract using sequential ion-exchange and molecular sieve chromatography. Recombinant oTP-1 purified in this fashion exhibited potent antiviral activity (0.6 x 10(8) U/mg) similar to native oTP-1. This expression system will enable production of large quantities of soluble, biologically active, and correctly processed recombinant oTP-1. Furthermore, the synthetic gene construct facilitates introduction of mutations for ongoing structure/function studies of this unique, Type I, trophoblast IFN.

Expression of human asparagine synthetase in Saccharomyces cerevisiae.

Human asparagine synthetase was expressed in the yeast Saccharomyces cerevisiae. The identity of the expressed protein was confirmed by immunoblotting and in vitro enzymatic activity. The recombinant enzyme was shown to have both the ammonia- and glutamine-dependent asparagine synthetase activity in vitro. In contrast to overproduction in Escherichia coli, the expressed protein was found to be soluble in the yeast cell. Furthermore, expression in yeast made it possible to isolate non-degraded human asparagine synthetase which had also the N-terminal methionine correctly processed. The yeast expression plasmid was constructed for optimal production of the recombinant enzyme. In addition, unique restriction enzyme sites that bracket the first five codons of the human asparagine synthetase gene were introduced. This will allow the use of oligonucleotide cassette mutagenesis to investigate the role of the N-terminal amino acids in asparagine synthetase enzymatic activity.

The N-terminal cysteine of human asparagine synthetase is essential for glutamine-dependent activity.

Site-specific mutagenesis was used to replace the N-terminal cysteine in human asparagine synthetase by an alanine. The mutant enzyme was expressed in the yeast Saccharomyces cerevisiae, and the asparagine synthetase activity was analyzed in vitro. The mutation resulted in the loss of the glutamine-dependent asparagine synthetase activity, while the ammonia-dependent activity remained unaffected. These results confirm the existence of a glutamine amidotransfer domain with an N-terminal cysteine essential for the glutamine-dependent asparagine synthetase activity.