First report of Zymoseptoria tritici causing Septoria tritici blotch in wheat in Paraguay.

Wheat (Triticum aestivum) is the third most cultivated field crop in Paraguay; it is grown on over 450,000 hectares with an annual production of 927,776 tons (fao.org/faostat). In 1952, Septoria tritici blotch (STB) was associated with the fungus Septoria tritici solely based on microscopic observation of conidia (Viedma and Delgado 1987). However, no morphometric or molecular studies have been performed in Paraguay up to date. Over the following decades, STB epidemic outbreaks were recorded, with a reduction in wheat production of up to 70% (Viedma and Delgado 1987). During winter 2021, leaf blotch symptoms were observed with an incidence above 50% in wheat fields in Capitán Miranda, Itapúa, Paraguay. Scattered, spherical, buried, and light brown necrotic spots with dark edges were observed on the leaves. Pycnidia with prominent central ostiole were observed. Leaves with symptoms were washed with 1% sodium hypochlorite for 1 min, rinsed with sterile distilled water, and incubated in wet chambers to induce sporulation of the fungus. Pycnidia produced greyish to white cirri. Isolated conidia were thin, elongated, and hyaline, ranging from 26.9-72.7 × 1.5-2.9 µm with one to three septa. Monosporic colonies on potato dextrose agar (PDA, ; Difco laboratories, Detroit, MI) media varied in color from white to pink, dark gray to black, or black with stroma-like structures. Based on morphology, the fungus was characterized as Zymoseptoria tritici (Hoorne et al. 2002; Gilchrist-Saavedra et al. 2005). Fungal DNA was extracted from mycelia, and the internal transcribed spacer (ITS), translation elongation factor 1-α (TEF1-α), 28S rRNA gene (LSU), actin gene (act), calmodulin (CaM) were amplified using ITS1/ITS4, EF1-728F/EF-2, LSU1Fd/ LR5, ACT-512F/ACT-783R, CAL-228F/CAL737R primers, respectively. PCR amplicons were sequenced at Macrogen (Seoul, Republic of Korea) and deposited in the NCBI GenBank database (ITS: OQ360718; TEF1-α: OQ999044, LSU: OQ996413, act: OQ999046, CaM: OQ999045). Sequences were aligned with several isolates of Septoria spp. previously reported (Verkley et al. 2013; Stukenbrock et al. 2012) using ClustalW. The alignments were concatenated with Bioedit (Hall 1999). The UPGMA method with 1,000 bootstrap replications, was used to construct the phylogenetic tree using MEGA11 with Readeriella mirabilis as the outgroup. The isolate from Paraguay grouped into the Zymoseptoria tritici clade with 96% bootstrap support. To confirm pathogenicity, ten wheat plants cv. Itapúa 80 were grown in pots for three weeks in growth chambers (22 ± 2°C; 16 h photoperiod). Subsequently, these plants were inoculated with 1×107 conidia ml-1 suspension, and ten non-inoculated plants served as control. Seven days after inoculation (DAI), symptoms were observed displaying oval necrotic lesions and approximately 14 DAI abundant pycnidia were observed on and around the lesions. Segments of symptomatic leaves were placed in moisture chambers overnight to enhance cirri development. Conidia were mounted on a slide and observed under the compound microscope. Individual cirrhus were transferred to plates containing PDA and produced colonies like those used in the inoculation (Hoorne et al. 2002). We confirmed that the causal agent of STB from wheat fields in Paraguay was Zymoseptoria tritici. This pathogen causes annual wheat disease epidemics in Paraguay; therefore, optimizing surveillance for early detection and understanding its distribution will improve integrated management.

First report of yellow rust (Puccinia striiformis f. sp. tritici) in wheat (Triticum aestivum) in Paraguay.

Wheat yellow (stripe) rust caused by Puccinia striiformis Westend. f. sp. tritici Eriks. (Pst) is an important disease worldwide (Chen 2005; Afzal et al., 2007; Hovmøller et al. 2011). In Latin America, the disease has been reported in Argentina, Bolivia, Chile, Colombia, Ecuador, Peru, Brazil, and Uruguay (van Beuningen and Kohli, 1986; German et al., 2007). The disease was observed for the first time in Paraguay at Capitán Miranda (Itapúa) (27°12'07.5888''S, 55°47'20.3640''W) in an environment with average minimum temperature below 10°C in July 2021 (coldest month). Symptoms were yellow rust pustules distributed linearly on the leaves of adult host plants (Fig. 1). Oval-shaped uredinia contained unicellular, yellow to orange, spherical urediniospores (28, 82 × 26, 83 µm), within the range reported by Rioux et al. (2015). Black telia produced yellow to orange teliospores (64, 12 × 15, 46 µm), which were within the range reported by Chen et al. (2014). All susceptible wheat cultivars had up to 100% disease severity. Ten- day-old seedlings of the susceptible cultivars were inoculated in a greenhouse using urediniospores collected from the field. Two weeks after inoculation, extensive sporulation was observed on the seedlings. For pathogen identification, DNA was extracted from wheat leaf segments containing urediniospores using the PureLink® Plant Total DNA Purification Kit (Invitrogen). PCR and sequencing were carried out by Macrogen (Korea), using the following species-specific primers: PSF (5`-GGATGTTGAGTGCTGCTGTAA-3`) / PSR (5`-TTGAGGTCTTAAGGTTAAAATTG-3`), which amplifies an internal transcribed spacer (ITS) region (Zhao et al. 2007); LidPs9 (TCGGTAAAACTGCACCAATACCT) / LidPs10 (TCCCAACAGTCCCCTTCTGT), which amplifies a fragment of the RNA polymerase II gene encoding the second largest subunit (rpb2); and LidPs11 (TTACGACATCTGCTTCCGCA) / LisPs12 (TGCGATGTCAACTCTGGGAC) and LidPs13 (TACGACATCTGCTTCCGCAC) / LidPs14 (GATTGCCCGGTATTGTTGGC), both pairs amplifying fragments of the ß-tubulin 1 gene (tub1) (Kuzdralinski et al. 2017). The sequences obtained were OM631935, OM638432, OM718000, and OM718001 and were aligned using the GenBank BLAST tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi), obtaining a 100% match with the following sequences: KC677574.1, KY411522.1, KY411533.1, and KY411542.1, respectively. Yellow-rust-infected leaf samples were collected from a field trial and sent to the Global Rust Reference Center (GRRC), Denmark. Simple sequence repeat (SSR) genotyping of samples from two different cultivars exhibited the genetic lineage PstS13 (www.wheatrust.org), which had previously been detected in South America (Carmona et al., 2019), thereby confirming the first report of wheat yellow rust in Paraguay. Considering that the Paraguayan wheat germplasm is highly susceptible to yellow rust, further studies are required to monitor potential spread and establishment of yellow rust in Paraguay and to explore potential sources of resistance to prevent future epidemics.

Consenso colombiano de expertos sobre recomendaciones informadas en la evidencia para la prevención, el diagnóstico y el manejo de la lesión renal aguda por SARS-CoV-2/COVID-19 / Colombian consensus of experts on recommendations informed in the evidence for the prevention, diagnosis and management of acute kidney injury by SARS-CoV-2/COVID-19

resumen está disponible en el texto completo

Abstract Introduction: Acute kidney injury is a frequent complication in patients with COVID-19 and its occurrence is a potential indicator of multi-organ dysfunction and disease severity. Objective: Develop, through an expert consensus, evidence-based recommendations for the prevention, diagnosis, and management of acute kidney injury in patients with SARS CoV2 / COVID-19 infection. Materials and methods: Based on a rapid systematic review in Embase and Pubmed databases and documents from scientific societies, we made preliminary recommendations and consulted with an expert group through an online tool. Then we defined agreement after at least 70 % consensus approval. Quality evidence was evaluated according to the type of document included. The strength of the recommendations was graded as strong or weak. Results: Fifty clinical experts declared their conflict of interest; the consultation took place between May 2 and 29, 2020. The range of agreement ranged from 75.5 % to 100 %. Recommendations for prevention, diagnosis and management of acute kidney injury in patients with SARS CoV2 infection are presented. Conclusions: Although the good quality information available regarding acute kidney injury in patients with COVID-19 is scarce, the recommendations of clinical experts will guide clinical decision-making and strategies around patients with this complication, guaranteeing care focused on the people, with high quality standards, and the generation of safety, health and wellness policies for multidisciplinary care teams.

Paquimeningitis y glomerulonefritis crescéntica en vasculitis p-ANCA / Pachymeningitis and crescentic glomerulonephritis in p-ANCA vasculitis

Resumen Las vasculitis asociadas a anticuerpos contra el citoplasma del neutrófilo configuran patologías multisistémicas caracterizadas por afectar pequeños vasos. Se ha descrito compromiso de sistema nervioso central en 2-8% de los casos, rara vez al inicio del cuadro clínico. Este corresponde al caso de un hombre de 67 años de edad con vasculitis p-ANCA, quien debutó con proptosis, paquimeningitis y disfagia severa. Posteriormente deterioro renal, necesidad de hemodiálisis, ciclofosfamida y recambio plasmático terapéutico con lo cual alcanza criterios de remisión parcial y egresa de diálisis. Las vasculitis ANCA se relacionan con una amplia gama de signos y síntomas inespecíficos. La edad de aparición, creatinina inicial y requerimiento de diálisis, son factores pronósticos. El inicio oportuno del tratamiento es fundamental, requiriendo por tanto un alto índice de sospecha. (Acta Med Colomb 2018; 43: 107-110).

Abstract Vasculitis associated with antibodies against the neutrophil cytoplasm they form multisystemic pathologies characterized by affecting small vessels. Central nervous system involvement has been described in 2 - 8% of cases, rarely at the beginning of the clinical picture. This corresponds to the case of a 67-year-old man with p-ANCA vasculitis, who debuted with proptosis, pachymeningitis and severe dysphagia. Subsequently, renal deterioration, the need for hemodialysis, cyclophosphamide and therapeutic plasma exchange, with which it reaches criteria of partial remission and dialysis discharge. ANCA vasculitis is associated with a wide range of nonspecific signs and symptoms. The age of onset, initial creatinine and dialysis requirement are prognostic factors. The timely initiation of treatment is fundamental, requiring therefore a high index of suspicion. (Acta Med Colomb 2018; 43: 107-110).

Costo-efectividad de dos esquemas de prevención de la infección por citomegalovirus en pacientes con trasplante renal y riesgo intermedio en Colombia.

Introducción. El citomegalovirus es la causa más frecuente de infección en pacientes con trasplante renal. Existen dos estrategias de similar efectividad para prevenirlo: la profilaxis universal con valganciclovir durante 90 días o el tratamiento anticipado verificando la carga viral semanal y aplicándolo solo si esta es positiva.Objetivo. Determinar cuál de estas dos estrategias sería más costo-efectiva en pacientes de riesgo intermedio en Colombia.Materiales y métodos. Se diseñó un árbol de decisiones bajo la perspectiva del tercer pagador considerando únicamente los costos médicos directos en pesos colombianos (COP) del 2014 durante un periodo de un año en una población de pacientes con riesgo intermedio para citomegalovirus (donante positivo y receptor positivo, o donante negativo y receptor positivo). Las probabilidades de transición se extrajeron de los estudios clínicos y se validaron con expertos mediante el método Delphi.Los costos de los procedimientos se basaron en el manual tarifario ISS 2001, con un incremento del 33 % a partir del índice de precios al consumidor (IPC) en salud de 2014, en tanto que los de los medicamentos se extrajeron de las circulares del Ministerio de Salud y del Sistema de Información de Medicamentos (Sismed).Resultados. La profilaxis universal con valganciclovir resultó ser menos costosa y se asoció con una menor probabilidad de infección. El costo promedio del primer año de tratamiento anticipado sería de COP$ 30'961.290, mientras que el universal sería de COP$ 29'967.834, es decir, un costo 'incremental' de COP$ 993.456.Conclusiones. Para los pacientes de riesgo intermedio con trasplante renal en Colombia, la profilaxis universal es la mejor estrategia por ser menos costosa y reducir el riesgo de infección.

Incidencia y características clínicas de pacientes trasplantados renales con infección y enfermedad por citomegalovirus en un centro de trasplante / Incidence and clinical characteristics of renal transplanted patients with infection and disease by cytomegalovirus in a transplant center

Resumen Introducción: la infección viral más importante postrasplante renal es la infección por citomegalovirus (CMV), hay discrepancia entre centros y países en datos de incidencia de infección-enfermedad en esta población de pacientes. Diseño: se realiza un estudio observacional analítico, tomando una cohorte retrospectiva de pacientes mayores de 18 años, trasplantados renales de donante vivo o cadavérico entre el 2004 y 2015 con al menos seis meses de seguimiento. Material y métodos: se realiza muestreo no probabilístico por conveniencia, se toman los datos de las historias clínicas de los pacientes trasplantados renales, calculando la densidad de incidencia de infección-enfermedad por CMV y se describen las características clínicas y demográficas de los pacientes que presentaron estas patologías. Resultados: se analizaron 252 pacientes, encontrando 92.4% receptores con riesgo intermedio para CMV y 7.5% con riesgo alto, ninguno fue de riesgo bajo. Se identificaron 19 casos, 13 con infección (5.1%) y seis con enfermedad (2.3%). El compromiso gastrointestinal fue el más frecuente. El tiempo promedio desde el momento del trasplante hasta la aparición de la infección-enfermedad fue de 417 (±479) y 650 días (±481), respectivamente. La tasa de infección fue de 10.08 casos por 1000 pacientes/año y la tasa de enfermedad de 5.88 por 1000 pacientes/año. Conclusiones: la densidad de incidencia de infección-enfermedad por CMV en pacientes trasplantados renales fue de 10.08 casos y 5.88 casos por 1000 pacientes/año, respectivamente. Estas tasas son menores a las reportados en la literatura. Dada la baja frecuencia de eventos, no fue posible establecer factores de asociación.

Abstract Introduction: the most important viral infection after renal transplantation is cytomegalovirus (CMV) infection. There is a discrepancy between centers and countries in terms of incidence data of infection-disease in this population of patients. Design: an analytical observational study was conducted, taking a retrospective cohort of patients older than 18 years old, kidney transplant recipients of living or cadaveric donors between 2004 and 2015, with at least 6 months of follow-up. Material and methods: non-probability convenience sampling was done; data from the clinical records of the kidney transplant patients were taken, calculating the incidence density of CMV infection-disease and the clinical and demographic characteristics of the patients who presented these pathologies were described. Results: 252 patients were analyzed; 92.4% of recipients with intermediate risk for CMV and 7.5% with high risk were found. None of them had low risk. 19 cases were identified, 13 with infection (5.1%) and 6 with disease (2.3%). Gastrointestinal involvement was the most frequent. The average time from the time of transplant to the onset of the infection-disease was 417 (± 479) and 650 days (± 481), respectively. The infection rate was 10.08 cases per 1000 patients / year and the disease rate was 5.88 per 1000 patients/year. Conclusions: the incidence density of CMV infection-disease in renal transplant patients was 10.08 cases and 5.88 cases per 1000 patients / year, respectively. These rates are lower than those reported in the literature. Given the low frequency of events, it was not possible to establish association factors. (Acta Med Colomb 2018; 43: 20-23).

Costo-efectividad de dos esquemas de prevención de la infección por citomegalovirus en pacientes con trasplante renal y riesgo intermedio en Colombia / Cost-effectiveness of two prevention cytomegalovirus infection schemes in renal transplant patients at intermediate risk in Colombia

Resumen Introducción. El citomegalovirus es la causa más frecuente de infección en pacientes con trasplante renal. Existen dos estrategias de similar efectividad para prevenirlo: la profilaxis universal con valganciclovir durante 90 días o el tratamiento anticipado verificando la carga viral semanal y aplicándolo solo si esta es positiva. Objetivo. Determinar cuál de estas dos estrategias sería más costo-efectiva en pacientes de riesgo intermedio en Colombia. Materiales y métodos. Se diseñó un árbol de decisiones bajo la perspectiva del tercer pagador considerando únicamente los costos médicos directos en pesos colombianos (COP) del 2014 durante un periodo de un año en una población de pacientes con riesgo intermedio para citomegalovirus (donante positivo y receptor positivo, o donante negativo y receptor positivo). Las probabilidades de transición se extrajeron de los estudios clínicos y se validaron con expertos mediante el método Delphi. Los costos de los procedimientos se basaron en el manual tarifario ISS 2001, con un incremento del 33 % a partir del índice de precios al consumidor (IPC) en salud de 2014, en tanto que los de los medicamentos se extrajeron de las circulares del Ministerio de Salud y del Sistema de Información de Medicamentos (Sismed). Resultados. La profilaxis universal con valganciclovir resultó ser menos costosa y se asoció con una menor probabilidad de infección. El costo promedio del primer año de tratamiento anticipado sería de COP$ 30'961.290, mientras que el universal sería de COP$ 29'967.834, es decir, un costo 'incremental' de COP$ 993.456. Conclusiones. Para los pacientes de riesgo intermedio con trasplante renal en Colombia, la profilaxis universal es la mejor estrategia por ser menos costosa y reducir el riesgo de infección.

Abstract Introduction: Cytomegalovirus (CMV) is the most frequent opportunistic infection after renal transplantation. There are two strategies for its prevention: Universal prophylaxis, with valganciclovir for 90 days, and anticipated therapy, using weekly viral load surveillance, and therapy only if positive. Meta-analysis directly comparing both strategies have shown them to have similar effectiveness. Objective: To determine which strategy is more cost-effective in intermediate risk patients in Colombia. Materials and methods: We designed a third-party payer perspective decision tree, considering only direct medical costs in 2014 Colombian pesos (COP) (USD$ 1=COP$ 2,000) and a time horizon of one year. The target population was intermediate CMV risk patients (positive receptor). Transition probabilities were extracted from clinical studies, validated with a Delphi expert panel method; procedural costs were obtained from the ISS 2001 manual with a 33% increment based on the Consumer Price Index for 2014, while medication costs were obtained from the official Ministry of Health information system. Results: Universal prophylaxis with valganciclovir was dominant, with lower costs and less probability of infection. The average cost of the first year in anticipated therapy would be COP$ 30,961,290, whereas in the case of universal therapy the cost would be COP$ 29,967,834 (incremental cost of COP$ 993,456). Conclusions: For Colombian renal transplant patients at intermediate risk for CMV infection, universal prophylaxis strategy is the best option.

Síndrome nefrótico secundario a glomerulonefritis membranoproliferativa por síndrome de Sjögren / Nephrotic syndrome secondary to membranoproliferative glomerulonephritis due to Sjögren's syndrome

Resumen El síndrome de Sjögren (SS), enfermedad autoinmune crónica, primaria o secundaria a otros desórdenes inmunológicos. La prevalencia es 0.05-0.23%, relación hombre: mujer 1:9, grupo etáreo 52-72 años. La afectación renal en el SSP (primario) puede ocasionar compromiso glomerular y/o tubular. Reportamos el caso de un hombre de 56 años, previamente sano que presentó síndrome nefrótico en el contexto de una glomerulonefritis membranoproliferativa (GMNMP), se diagnosticó SS con compromiso glomerular y se realizó revisión de la literatura. (Acta Med Colomb 2017; 42: 136-139).

Abstract Sjögren's syndrome (SS) is a chronic autoimmune disease primary or secondary to other immunological disorders. The prevalence is 0.05-0.23%, male: female ratio 1:9, age group 52-72 years. Renal involvement in primary SS can lead to glomerular and/or tubular involvement. The case of a 56-year-old man previously healthy that presented nephrotic syndrome in the context of a membranoproliferative glomerulonephritis (MPGN) and was diagnosed with SS with glomerular involvement is reported, and a literature review was performed. (Acta Med Colomb 2017; 42: 136-139).

Viremia and Clinical Presentation in Nicaraguan Patients Infected With Zika Virus, Chikungunya Virus, and Dengue Virus.

BACKGROUND: Zika virus (ZIKV), chikungunya virus (CHIKV), and dengue virus (DENV) cocirculate in Nicaragua. In this study, we sought to compare the quantified viremia and clinical presentation of patients infected with 1 or more of these viruses. METHODS: Acute-phase serum samples from 346 patients with a suspected arboviral illness were tested using a multiplex real-time reverse-transcription polymerase chain reaction for ZIKV, CHIKV, and DENV. Viremia was quantitated for each detected virus, and clinical information from request forms submitted with each sample was recorded. RESULTS: A total of 263 patients tested positive for 1 or more viruses: 192 patients tested positive for a single virus (monoinfections) and 71 patients tested positive for 2 or all 3 viruses (coinfections). Quantifiable viremia was lower in ZIKV infections compared with CHIKV or DENV (mean 4.70 vs 6.42 and 5.84 log10 copies/mL serum, respectively; P < .001 for both comparisons), and for each virus, mean viremia was significantly lower in coinfections than in monoinfections. Compared with patients with CHIKV or DENV, ZIKV patients were more likely to have a rash (P < .001) and less likely to be febrile (P < .05) or require hospitalization (P < .001). Among all patients, hospitalized cases had higher viremia than those who did not require hospitalization (7.1 vs 4.1 log10 copies/mL serum, respectively; P < .001). CONCLUSIONS: ZIKV, CHIKV, and DENV result in similar clinical presentations, and coinfections may be relatively common. Our findings illustrate the need for accurate, multiplex diagnostics for patient care and epidemiologic surveillance.

[Behavior of carbapenemase-producing Klebsiella pneumoniae cases in cancer patients at a third level hospital in Bogotá, D.C]. / Comportamiento de casos de Klebsiella pneumoniae productora de carbapenemasas en pacientes con cáncer de un hospital de tercer nivel de Bogotá, D.C.

INTRODUCTION: The presence of carbapenemase-producing Enterobacteriaceae in hospitals is increasingly common. Patients with advanced cancer who require invasive means for diagnosis, treatment or palliative care, and the use of broad-spectrum antimicrobials to treat secondary infections show increased susceptibility to infections caused by these bacteria. OBJECTIVE: To report the behavior of carbapenemase-producing Klebsiella pneumoniae (CPKP) isolates at the Instituto Nacional de Cancerología in Bogotá between January 2010 and December 2012. MATERIALS AND METHODS: By analyzing the database kept by the infection committee of the institution, as well as the records of patients with CPKC isolates, we identified and described the epidemiology of detected cases. Outbreaks were determined by using quality control statistical tools. RESULTS: Between January 2010 and December 2012, we found 45 patients with CPKC isolates recovered from any sample. There were more isolates from patients with malignant solid tumors. CPKC isolates from urine samples were more often recovered; 17.7% of CPKC isolates corresponded to colonization, and 82.3% to infection; 35.5% of patients (16/45) survived. We identified two outbreaks during this period, which were controlled using a multimodal approach. CONCLUSIONS: This study found that CPKC presence is more frequent as infection than as colonization. During the two years of the study we detected two outbreaks, which were controlled by limiting multi-resistant bacteria cross transmission using conventional control strategies.

Comportamiento de casos de Klebsiella pneumoniae productora de carbapenemasas en pacientes con cáncer de un hospital de tercer nivel de Bogotá, D.C. / Behavior of carbapenemase-producing Klebsiella pneumoniae cases in cancer patients at a third level hospital in Bogotá, D.C.

Introducción. La presencia en los hospitales de enterobacterias productoras de carbapenemasas es cada vez más frecuente. Los pacientes con cáncer en estado avanzado requieren medios invasivos para el diagnóstico, el tratamiento o los cuidados paliativos, así como el uso de antimicrobianos de amplio espectro para tratar infecciones secundarias, lo cual aumenta su propensión a las infecciones causadas por estas bacterias. Objetivo. Informar el comportamiento de Klebsiella pneumoniae productora de carbapenemasas de tipo KPC en el Instituto Nacional de Cancerología de Bogotá, entre enero de 2010 y diciembre de 2012. Materiales y métodos. Mediante el análisis de la base de datos y de los registros de los pacientes con aislamientos de K. pneumoniae productores de carbapenemasas de tipo KPC, a cargo del comité de infecciones de la institución, se identificaron y describieron las características epidemiológicas de los casos detectados. La determinación de brotes se efectuó con herramientas de control estadístico de calidad. Resultados. Entre enero de 2010 y diciembre de 2012 se identificaron 45 pacientes con aislamiento de K. pneumoniae productor de carbapenemasas de tipo KPC en alguna muestra. Hubo más aislamientos en pacientes de cáncer con tumores sólidos. La identificación se logró más frecuentemente en muestras de orina; el 17,7 % de los casos correspondió a colonización y el 82,3 %, a infección; 35,5 % (16/45) de los pacientes sobrevivió. Durante este periodo se identificaron dos brotes que se controlaron aplicando una estrategia multimodal. Conclusiones. Se encontró que la presencia de KPC fue más frecuente en infecciones que en colonizaciones. Durante estos dos años ocurrieron dos brotes que fueron controlados limitando la transmisión cruzada de bacterias multirresistentes por medio de estrategias de control convencionales.

Introduction: The presence of carbapenemase-producing Enterobacteriaceae in hospitals is increasingly common. Patients with advanced cancer who require invasive means for diagnosis, treatment or palliative care, and the use of broad-spectrum antimicrobials to treat secondary infections show increased susceptibility to infections caused by these bacteria. Objective: To report the behavior of carbapenemase-producing Klebsiella pneumoniae (CPKP) isolates at the Instituto Nacional de Cancerología in Bogotá between January 2010 and December 2012. Materials and methods: By analyzing the database kept by the infection committee of the institution, as well as the records of patients with CPKC isolates, we identified and described the epidemiology of detected cases. Outbreaks were determined by using quality control statistical tools. Results: Between January 2010 and December 2012, we found 45 patients with CPKC isolates recovered from any sample. There were more isolates from patients with malignant solid tumors. CPKC isolates from urine samples were more often recovered; 17.7% of CPKC isolates corresponded to colonization, and 82.3% to infection; 35.5% of patients (16/45) survived. We identified two outbreaks during this period, which were controlled using a multimodal approach. Conclusions: This study found that CPKC presence is more frequent as infection than as colonization. During the two years of the study we detected two outbreaks, which were controlled by limiting multi-resistant bacteria cross transmission using conventional control strategies.

Symptomatic versus inapparent outcome in repeat dengue virus infections is influenced by the time interval between infections and study year.

Four dengue virus serotypes (DENV1-4) circulate globally, causing more human illness than any other arthropod-borne virus. Dengue can present as a range of clinical manifestations from undifferentiated fever to Dengue Fever to severe, life-threatening syndromes. However, most DENV infections are inapparent. Yet, little is known about determinants of inapparent versus symptomatic DENV infection outcome. Here, we analyzed over 2,000 DENV infections from 2004 to 2011 in a prospective pediatric cohort study in Managua, Nicaragua. Symptomatic cases were captured at the study health center, and paired healthy annual samples were examined on a yearly basis using serological methods to identify inapparent DENV infections. Overall, inapparent and symptomatic DENV infections were equally distributed by sex. The mean age of infection was 1.2 years higher for symptomatic DENV infections as compared to inapparent infections. Although inapparent versus symptomatic outcome did not differ by infection number (first, second or third/post-second DENV infections), substantial variation in the proportion of symptomatic DENV infections among all DENV infections was observed across study years. In participants with repeat DENV infections, the time interval between a first inapparent DENV infection and a second inapparent infection was significantly shorter than the interval between a first inapparent and a second symptomatic infection. This difference was not observed in subsequent infections. This result was confirmed using two different serological techniques that measure total anti-DENV antibodies and serotype-specific neutralizing antibodies, respectively. Taken together, these findings show that, in this study, age, study year and time interval between consecutive DENV infections influence inapparent versus symptomatic infection outcome, while sex and infection number had no significant effect. Moreover, these results suggest that the window of cross-protection induced by a first infection with DENV against a second symptomatic infection is approximately 2 years. These findings are important for modeling dengue epidemics and development of vaccines.

Transfer of quinolone resistance gene qnrA1 to Escherichia coli through a 50 kb conjugative plasmid resulting from the splitting of a 300 kb plasmid.

OBJECTIVES: To analyse the in vitro transfer of the qnrA1 gene by a 50 kb (pSZ50) self-transferable plasmid that derives from a 300 kb plasmid (pSZ300) and to determine the complete nucleotide sequence of plasmid pSZ50. METHODS: Extended-spectrum ß-lactamase (ESBL) and plasmid-mediated quinolone resistance (PMQR) genes of an Escherichia coli clinical isolate were analysed. Plasmid analysis included conjugation and selection on seven antibiotics examined by antimicrobial susceptibility testing, RFLP comparison, Southern hybridization, incompatibility group identification and shotgun sequencing. RESULTS: The E. coli 5509 isolate carries the genes encoding the ESBL CTX-M-15 and the quinolone resistance determinants qnrA1, qnrB2 and aac(6')-Ib-cr on a 300 kb plasmid. Seven transfer resistances were analysed by conjugation under two conditions (30 and 37°C), leading to two distinct transconjugant phenotypes with different resistances. Transconjugants of phenotype A harboured a 300 kb plasmid named pSZ300 that conferred resistance to eight antibiotics and harboured the qnrA1, aac(6')-Ib-cr and bla(CTX-M-15) genes. Transconjugants of phenotype B were resistant to three antibiotics and they harboured the qnrA1 gene on an ≈ 50 kb plasmid named pSZ50. Both plasmids were self-transferable at a frequency of 1 × 10(-3). Plasmid pSZ300 was typed to be both an IncF and IncN plasmid, whereas pSZ50 corresponded only to type IncN. Fingerprinting and Southern hybridization showed that plasmid pSZ50 derived from pSZ300. The complete nucleotide sequence of plasmid pSZ50 was determined (51556 bp) and 55 open reading frames were predicted. The qnrA1 gene was identified in a tandem duplicate inside a sul1-type integron structure. CONCLUSIONS: The plasmid pSZ300 represented a fusion of two replicons (IncF and IncN), and our observations suggest that the plasmid pSZ50 (IncN) may split and transfer antibiotic resistance determinants. This mechanism could be advantageous in the dissemination of antibiotic resistance genes.