RESUMO
Hazelnut (Corylus avellana L.) is one of the most economically important tree crops in Italy. Xanthomonas arboricola pv. corylina (Xac) causes bacterial blight of hazelnut (4). During early summer 2010, a survey of three orchards (5 ha total) containing 4-year-old hazelnut trees (cv. Tonda di Giffoni) in Viterbo Province, Latium region, Italy, showed an 80 to 100% incidence of bacterial blight. Initially, water-soaked, necrotic spots were visible on leaves, fruit involucres, and shells, followed by lateral shoot dieback and development of cankers as longitudinal bark cracks on twigs, branches, and main trunks. Brown necrosis of the cambium was observed when bark tissue was removed. By late summer, necrosis had extended down main branches to the trunk, causing complete girdling of branches. Symptomatic tissues were collected from leaves, branches, and trunks, sections were surface-sterilized in 1% NaOCl for 1 min followed by two rinses in sterile distilled water (SDW, each for 1 min), and each section was then crushed in SDW. A loopful of the suspension was streaked onto yeast extract-dextrose-calcium carbonate agar medium (YDCA). Thirty six (12 from each type of tissue) yellow-mucoid, shiny, round bacterial colonies, each approximately 2 mm in diameter, were subcultured on YDCA. All strains were gram-negative and aerobic; negative for indole, lecithinase, urease, tyrosinase, and nitrate reduction; and positive for catalase, growth in 2% NaCl in nutrient broth, and growth at 35°C. All strains produced dark green pigment on succinate-quinate (SQ) medium. Inoculum of each of 15 isolates was prepared in nutrient broth, and washed cells from late log-phase cultures used to prepare a bacterial suspension of each isolate for inoculation of 2-year-old potted hazelnut plants cv. Tonda di Giffoni. A suspension of 106 CFU/ml for each isolate was sprayed onto leaves (10 ml/plant), and drops of inoculum were placed on wounds made on twigs with a sterile scalpel (0.10 µl/wound). For each isolate, three plants were inoculated per inoculation method. Inoculations with two reference strains of Xac (Xaco 1 from central Italy (3) and NCPPB 2896 from England) and SDW were performed on the same number of plants for positive and negative control treatments, respectively. Inoculated plants were maintained at 26 ± 1°C in a greenhouse. After 21 days, all inoculated plants had developed symptoms on leaves, while cankers developed on twigs after 40 days. Positive control plants developed the same symptoms, while negative control plants remained asymptomatic. Bacteria recovered from lesions on plants inoculated with the test strains or positive control strains had the same morphological and physiological characteristics as the original strains. No bacteria were recovered from negative control plants. Total DNA was extracted from bacterial suspensions and 16S rDNA amplified using universal primers (2). Sequences (GenBank Accession Nos. JQ861273, JQ861274, and JQ861275 for strains Xaco VT3 to VT5) had 99 to 100% identity with 16S rDNA sequences of Xac strains in GenBank. In Italy, Xac was reported by Petri in 1932 in Latium, and later in other regions on several hazelnut cultivars (1). However, to our knowledge, this is the first report of the disease causing severe damage in Italy. References: (1) M. Fiori et al. Petria 16:71, 2006. (2) J. R. Lamichhane et al. Plant Dis. 95:221, 2011. (3) J. R. Lamichhane et al. Acta Horticol.:In press. 2012. (4) OEPP/EPPO Bull. 179:179, 2004.
RESUMO
From May to July 2010, severe outbreaks of bacterial canker of tomato (Solanum lycopersicum L.) were observed in 16 fields in the Province of Viterbo, central Italy. Cultivars affected were Uno Rosso, Peto 1296, UG 812, UG 822, and Podium. Disease incidence ranged from 70 to 100% and was highest for Uno Rosso followed by UG 812, UG 822, Peto 1296, and Podium. Leaf symptoms initially appeared as interveinal, pale green, water-soaked areas that quickly turned yellow-brown to necrotic, resembling sunburn. Infected parts of the plants began to wilt and then die. Light yellow-to-brown streaks or cankers appeared on stems and the cankers darkened. As the disease progressed, affected stems split lengthwise and a pale yellow-to-reddish brown discoloration of the vascular tissue was observed. The pith of infected stems turned brown, granular to mealy, and filled with cavities. Dividing the stem into two pieces lengthwise revealed yellowing of vascular tissues in the fruits that otherwise was asymptomatic. Eventually, vascular wilting and premature death of entire plants were observed. Once a month, infected samples were randomly collected three times from each field from five plants. A gram-positive, nonmotile, nonspore forming, aerobic, curved, rod-shaped bacterium was consistently isolated onto nutrient broth yeast extract agar medium from symptomatic plant tissues. Strains tested positive for gelatin liquefaction, H2S production from peptone, utilization of citrate and negative for starch hydrolysis. Forty-five isolates were used to inoculate four-o'clock (Mirabilis jalapa L.) plants by injecting a bacterial suspension of the appropriate isolate in sterilized distilled water (108 CFU/ml) into leaves (1). Known strains of Clavibacter michiganensis subsp. michiganensis (DPP22) and Pseudomonas fluorescens (DPP09N) were used as positive and negative control treatments, respectively. Four leaves per plant and three plants were inoculated for each bacterial strain and control treatment. All 45 tomato field isolates and the known strain of C. michiganensis subsp. michiganensis produced a hypersensitive reaction within 48 h. Pathogenicity tests were performed on 3-week-old, potted tomato seedlings (cv. Ciliegino) by placing a drop of the appropriate bacterial suspension (108 CFU/ml) on wounds created by excising the leaf petiole. The inoculated plants were maintained at 26 ± 1°C in a greenhouse. The two control isolates were similarly inoculated onto tomato seedlings. After 15 days, all inoculated plants developed symptoms, whereas negative control plants remained asymptomatic. Bacteria reisolated from inoculated leaf lesions had the same characteristics as the original bacteria. A 1,400-bp region of the 16S rDNA was amplified from 15 of the 45 strains with primers NOC 1F (AGAGTTTGATCATGGCTCAG) and NOC 3R (ACGGTTACCTTGTTACGACTT) and sequenced (GenBank Accession Nos. HQ144228 to HQ144242; strains CmmVT1 to CmmVT15). A BlastN search of the sequences in GenBank revealed the tomato strains had 99 to 100% identity with the 16S rDNA sequences of C. michiganensis subsp. michiganensis strains (GenBank Accession Nos. EU 685335, AM711867, and AM410696). In Italy, this pathogen was first reported in 1914 in Vasto and later in a few other regions. However, to our knowledge, this is the first observation of widespread outbreaks in >300 ha of tomato fields with severe economic losses. Reference: (1) R. D. Gitaitis. Plant Dis. 74:58, 1990.
RESUMO
Potato (Solanum tuberosum L.) is the fourth most important major crop of Nepal after rice, corn, and wheat, with an annual production of 1.94 million t and 153,000 ha of harvested area. It is a staple food crop in the remote hilly areas and the main vegetable in other parts of the country. Potato is grown in all three major agricultural zones (high hills, mid hills, and plain land) of Nepal, at an altitude ranging from 60 m to more than 4,000 m. Erwinia carotovora causes soft rot worldwide on a wide range of hosts including potato, carrot, and cabbage. During the spring of 2009, a soft rot with a foul smell was noted in stored potato tubers of different local cultivars, especially Rato Alu and Seto Alu, in the Kathmandu District, central region of Nepal. Symptoms on tubers appeared as tan, water-soaked areas with watery ooze. The rotted tissues were white-to-cream colored. Seven different potato fields, where the stored tubers originated, were surveyed and 23 samples consisting of approximately three symptomatic tubers were collected. Bacteria were successfully isolated from all diseased tissues on nutrient agar supplemented with 5% sucrose and incubated at 26 ± 1°C. After purification on tripticase soy agar medium, 17 isolates were identified as E. carotovora by the following deterministic tests: all strains were gram-negative rods; oxidase negative; facultatively anaerobic; able to degrade pectate; sensitive to erythromycin; negative for phosphatase; unable to produce acid from α-methyl-glucoside; and produced acid from trehalose. Pathogenicity of the strains was evaluated by depositing a bacterial suspension (106 CFU/ml) on potato slices (cv. Monalisa) and incubating at 30 ± 1°C. A reference strain of E. carotovora subsp. carotovora (NCPPB 2577) and sterile distilled water were used, respectively, as positive and negative controls. All strains caused soft rot within a week. Bacteria were reisolated from the slices and were shown to be identical to the original strains according to the above morphological, cultural, and biochemical tests. A 1,430-bp region of the 16S rDNA from all strains was amplified with primers NOC 1F (AGAGTTTGATCATGGCTCAG) and NOC 3R (ACGGTTACCTTGTTACGACTT) and sequenced (GenBank Accession No. GU075708; strain NEP ECC09). A BlastN search of GenBank revealed that the strains had 100% nt identity with the 16S rDNA sequence of E. carotovora subsp. carotovora type strain ATCC 15713 (GenBank Accession No. U80197). The finding of this pathogen is of fundamental value since this crop represents one of the economically important crops of Nepal. This pathogen has already been reported in the countries of China and India (1) with whom Nepal shares its boundaries. The pathogen may have been introduced to this region of Nepal via seed potato tubers from other countries. Reference: (1) G. S. Shekhawat et al. Potato Res. 19:241, 1976.
