First report of Root-Knot Nematode Meloidogyne enterolobii infecting coriander in Shaanxi, Northern China.

Coriander (Coriandrum sativum), which can be used for its root, stem, and leaf as both food and medicine (Prachayasittikul et al. 2018), is widely cultivated in China. The coriander cultivation area of Guanzhong region, including Xi' an, Xianyang, and Weinan, is 20 million m2, which accounts for 85.7% of the total cultivation area in Shaanxi. In September 2022, obvious galls were observed on the roots of coriander plants (cv. Xiaoye) growing in a field in Huyi District, Xi' an City (34°1'26.4"N, 108°31'58.8"E). The diseased plants did not show obvious above-ground symptoms. To identify the species, second-stage juveniles (J2s) and males were collected from soil in the root zone, and adult females were isolated from galls of diseased roots. The perineal patterns of adult females (n = 20) were round to oval, with high dorsal arches and no obvious lateral lines were observed. Morphological measurements of females (n = 20) included body length (L) = 682 ± 56 (554 to 780) µm, body width (BW) = 522 ± 45 (420 to 597) µm, stylet = 14.9 ± 0.9 (13.4 to 16.3) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 5.3 ± 0.5 (4.3 to 6.3) µm, vulval slit length = 26 ± 2.8 (20 to 32) µm, vulval slit to anus distance = 21 ± 1.7 (18.5 to 26) µm. Measurements of males (n = 8) were L = 1398 ± 57 (1308 to 1450) µm, BW = 28 ± 2.9 (23 to 32) µm, stylet = 16.1 ± 0.8 (15.3 to 17.3) µm, DGO = 4.5 ± 0.5 (3.5 to 4.9) µm, spicules = 27 ± 1.1 (26 to 29) µm. Measurements of J2s (n = 20) were as follows: L = 434 ± 16.8 (391 to 477) µm, BW = 15.6 ± 0.9 (13.7 to 17.3) µm, stylet = 12.6 ± 0.6 (11.3 to 13.6) µm, DGO = 3.9 ± 0.3 (3.4 to 4.5) µm, tail = 52 ± 4.0 (47 to 60) µm, hyaline tail length = 15.6 ± 1.3 (13.6 to 18.6) µm. These morphological characteristics were consistent with those described for Meloidogyne enterolobii (Yang and Eisenback 1983). Ten females were put in 10 tubes for DNA extraction following Htay et al. (2016). The ITS-rDNA sequence was amplified using the primers 18S/26S (Vrain et al. 1992). A 765 bp fragment was obtained and the sequence (GenBank OR789453) was 99.87% identical to sequences of M. enterolobii (MT406251 and MT067559). The mtDNA CoxII-16S sequence was amplified using primers C2F3/1108 (Powers and Harris, 1993). The sequence was 705 bp (OR795028) and 100% identical to sequences of M. enterolobii (MK455870 and MZ643270). A single 236 bp fragment was amplified using species-specific primers Me-F/Me-R, confirming the species as M. enterolobii (Long et al. 2006). The infection test was conducted in a greenhouse at 27 ± 2℃. Eight 2-week-old coriander plants (cv. Xiaoye) were individually grown in pots filled with sterilizer soil and inoculated with 800 J2s hatched from collected M. enterolobii egg masses. Forty-five days after nematode inoculation, the inoculated plants had galled roots like those observed in the field. The reproduction factor (final population density/initial population density) was 11.9 ± 2.0, indicating coriander was a suitable host for M. enterolobii. No symptoms were observed in controls. To our knowledge, this is the first known natural infection of coriander with M. enterolobii in China. M. enterolobii has been reported on various crops in southern provinces of China (EPPO, 2023). Considering the high level of agricultural trade between different regions, there is a high risk of M. enterolobii transmission to Guanzhong region through infested soil and susceptible plant materials. Further monitoring and research on effective control strategies are needed to prevent the spread of this nematode.

First Report of Meloidogyne incognita on Coral dealbatus in Shaanxi, China.

Coral dealbatus belonging to Crassulaceae, is a new kind of health care vegetable as both medicine and food (Qin et al., 2022). Because of its obvious health care function, C. dealbatus was widely cultivated in China and market demand increased quickly. In August of 2022, a large number of C. dealbatus showed the symptoms of stunting and leaf yellowing in Dali county, Weinan, Shaanxi province, China (109°43'E, 34°36'N). Many galls were observed on the roots of infected plants, and females were observed under the plant epidermis. Infected roots and soil samples were collected, the females, males and second-stage juveniles (J2s) were isolated. The female had a spherical body with a protruding neck, the stylet of females was slender and curved toward the back slightly. The perineal pattern of female (n=20) was round or elliptical, with high and squared dorsal arch, without obvious lateral lines. Morphological measurements of females (n=20): body length (L)=782.09±54.54 ( 518.52 to 1137.76) µm, body width (W)=439.51±19.23 (336.51 to 551.74 ) µm, stylet length (ST)=15.39±0.67 (12.55 to 18.80) µm, stylet knob height (STKH)=2.02±0.09 (1.88 to 2.46) µm, stylet knob width (STKW)=3.69±0.15 (2.91to 4.58) µm, distance from dorsal esophageal gland orifice to base of stylet (DGO)=2.32±0.17 (1.77 to 3.48) µm, vulval slit length (V)=23.99±0.75 (20.71 to 28.83) µm, and vulval slit to anus distance (V') = 18.62±0.55 (14.95 to 21.20) µm. The males showed a trapezoidal labial region, with a high head cap and concaved at the center of the top end in lateral view; and had blunt tail that bended slightly towards the abdomen, stylet knobs were prominent, speculum were in pairs and acicular. Measurements of females (n=10) were: L=1377.82±198.09 (1040.66 to 1726.59) µm, W=37.32±4.49 (28.35 to 41.90) µm, ST=21.48±1.23 (19.69 to 23.51) µm, STKH=2.99±0.12 (2.82 to 3.23) µm, STKW=5.34±0.41 (4.64 to 6.06) µm, DGO=2.54±0.13 (2.31 to 2.77) µm. J2s had the following characteristics: L=435.57±40.75 (414.92 to 462.14) µm, W=16.73±2.62 (12.76 to 21.95) µm, ST=12.66±1.02 (10.68 to 14.76) µm, STKH=1.58±0.29 (1.07 to 1.98) µm, STKW=2.22±0.38 (1.63 to 2.70) µm, DGO=2.26±0.18 (2.03 to 2.70) µm, tail length(T)= 87.97±9.71 (72.98 to 92.53) µm, hyaline tail terminus (HT) = 12.44±2.21 (9.59 to 13.90) µm. The nematode had uniform morphological characteristics with Meloidogyne incognita (Orton Williams, 1973). DNA was extracted from ten single females, and the species-specific primers Mi2F4/Mi1R1 (ATGAAGCTAAGACTTTGGGCT/TCCCGCTACACCCTCAACTTC) were used for identification of M. incognita (Kiewnick et al., 2013), and a 300bp fragment was amplified by this pair of primers, confirming the nematode was M. incognita. 18S rDNA gene was amplified using the primer pair 18S/26S (TTTCACTCGCCGTTACTAAGG/TTGATTACGTCCCTGCCCTTT) (Vrain et al.,1992), and the sequence was submitted to GenBank (GenBank Accession No. OR477177). Sequence aligment was conducted and showed 100% identical with the known sequence of M. incognita (GenBank Accession Nos. MH113856 and OQ269709). The result of identification was also confirmed by amplifying the sequence of NADH dehydrogenase subunit 5 (nad5) from mitochondrial DNA region using primers: NAD5-F/R(TATTTTTTGTTTGAGATATATTAG/TCGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). A611bp fragment was amplified and the sequence (GenBank Accession No. OR520436) showed 100% identical with other M. incognita sequences (GenBank Accession Nos. OP753345 and MT683461). In order to determine the pathogenicity of the nematode, infestation test was conducted in greenhouse. Ten 20-day-old healthy plants were cultured in pots with sterilized soil respectively and 2000 J2 hatched from egg masses of M. incognita were inoculated to the root of the plant. Five non-inoculated healthy C. dealbatus were used as negative control. After cultured at 25℃ for 60 days, roots were galled as observed in the field, and the symptoms of the root inoculated artificially with M. incognita were the same as those in the field. The nematodes were collected from inoculated roots, and identified as M. incognita with the species-specific primers Mi2F4/Mi1R1. An average of 7362 J2 was recovered and the reproduction factor value was 3.68. No galls were observed in control plants. These results suggested that C. dealbatus is a host for M. incognita. To our knowledge, this is the first report of M. incognita parasitizing C. dealbatus. This finding may be important to C. dealbatus industry and appropriate strategies should be taken to deal with the spreading of M. incognita.

Identification of Meloidogyne species on traditional Chinese medicine plants in the Qinling mountain area of China and their aggressiveness to different medicinal herbs.

Root-knot nematodes (Meloidogyne spp.) are plant-parasitic nematodes that cause serious damage on a worldwide basis. There are many species of traditional Chinese medicine (TCM) plants, but only a few have been reported to be infected by Meloidogyne species. From 2020 to 2022, a survey was conducted in the Qinling mountain area, which is the main producing region of TCM plants in China. Obvious galling symptoms were observed on the root systems of fifteen species of TCM plants. Females were collected from diverse diseased TCM plants and subsequently identified at morphological and molecular level. Among the twenty diseased root samples collected, Meloidogyne hapla populations were identified in twelve samples (60%) and Meloidogyne incognita populations were identified in eight samples (40%). Among the fifteen species of diseased TCM plants, eight of them, namely Scutellaria baicalensis, Leonurus japonicus, Dioscorea zingiberensis, Cornus officinalis, Viola philippica, Achyranthes bidentata, Senecio scandens, and Plantago depressa were reported to be infected by Meloidogyne species for the first time. The host status of five species of TCM plants for two M. hapla isolates and one M. incognita isolate from TCM plants in this study was then evaluated. Differences in TCM plants' response to nematode infection were apparent when susceptibility was evaluated by the egg counts per gram fresh weight of root and the reproduction factor of the nematodes. Among the five species of TCM plants tested, Salvia miltiorrhiza and Gynostemma pentaphyllum were the most susceptible, while S. baicalensis and V. philippica were not considered suitable hosts for M. hapla or M. incognita.

Effect of low-temperature stress on the survival of Meloidogyne incognita and its application in greenhouse of northern China.

We examined the effects of low temperature on egg hatching and killing rate of the 2nd instars of Meloi-dogyne incognita (J2) in the laboratory. We further evaluated the effects of two soil treatment methods on the survival rate of M. incognita in northern China in a field experiment. The results of laboratory experiment showed that survival rate of J2 was 0 after being subjected to -7 ℃ for 24 hours, and that egg hatching was completely inhibited 24 hours after being subjected to -9 ℃. The survival rate of J2 was 0 after being subjected to -1, -2, -3, and -4 ℃ for 8, 5, 3, and 1.5 d, respectively. Egg hatching was completely inhibited after being subjected to -2, -3, -4, and -5 ℃ for 9, 6, 4, and 1 d, respectively. Results of the fitting analysis showed that both the relationships between the temperature and the lethal time of J2 as well as the temperature and the non-hatching time of the eggs followed exponential functions. The results of field test showed that death rate of M. incognita in 0-50 cm soil layer after ridging treatment and 0-30 cm soil layer after leveling treatment could reach 100%, while the disease index of the former in 30-40 cm and 40-50 cm was 84.9% and 75.8%, respectively, which was lower than that in the greenhouse. Our results suggest that preventing and controlling M. incognita in greenhouses through low-tempe-rature in winter could achieve a better control effect in Yulin City and the northward region. The proposed technique is convenient and has high potential for popularization.

An Agrobacterium-Mediated Transient Expression Method for Functional Assay of Genes Promoting Disease in Monocots.

Agrobacterium-mediated transient expression (AMTE) has been widely used for high-throughput assays of gene function in diverse plant species. However, its application in monocots is still limited due to low expression efficiency. Here, by using histochemical staining and a quantitative fluorescence assay of ß-glucuronidase (GUS) gene expression, we investigated factors affecting the efficiency of AMTE on intact barley plants. We found prominent variation in GUS expression levels across diverse vectors commonly used for stable transformation and that the vector pCBEP produced the highest expression. Additionally, concurrent treatments of plants with one day of high humidity and two days of darkness following agro-infiltration also significantly increased GUS expression efficiency. We thus established an optimized method for efficient AMTE on barley and further demonstrated its efficiency on wheat and rice plants. We showed that this approach could produce enough proteins suitable for split-luciferase assays of protein-protein interactions on barley leaves. Moreover, we incorporated the AMTE protocol into the functional dissection of a complex biological process such as plant disease. Based on our previous research, we used the pCBEP vector to construct a full-length cDNA library of genes upregulated during the early stage of rice blast disease. A subsequent screen of the library by AMTE identified 15 candidate genes (out of ~2000 clones) promoting blast disease on barley plants. Four identified genes encode chloroplast-related proteins: OsNYC3, OsNUDX21, OsMRS2-9, and OsAk2. These genes were induced during rice blast disease; however, constitutive overexpression of these genes conferred enhanced disease susceptibility to Colletotrichum higginsianum in Arabidopsis. These observations highlight the power of the optimized AMTE approach on monocots as an effective tool for facilitating functional assays of genes mediating complex processes such as plant-microbe interactions.

First Report of Meloidogyne incognita on Daylily (Hemerocallis citrina) in Shaanxi, China.

Daylilies (Hemerocallis citrina Baroni) are herbaceous perennials grown extensively as ornamental plants worldwide. In China, daylilies are important cash crops, which are used for their roots, leaves, and flowers as both food and medicine (Guo et al., 2022). Dali County, Shaanxi Province, is an important production region for the commercial cultivation of daylily in China. The daylily cultivation area of Dali County was 43.33 million m2 and the output reached 227 thousand kg, which worth more than 109.12 million dollars. In July 2021, numerous daylily plants (cv. Shayuan) showed chlorotic leaves and stunted growth in a field in Dali County. The area of daylily field we investigated was about 2000 m2, and the incidence of root-knot nematode disease was more than 90%. The inflorescences of diseased plants decreased by nearly 30%, which affected the yield seriously. The diseased plants exhibited obvious galling on the roots which were typical symptoms of infection by root-knot nematodes (RKNs). Population densities of second-stage juveniles (J2s) ranged from 300 to 350 in 100g soil layer of 10-20 cm. Nematodes were collected from root samples (n = 15) and were found in all of the diseased plant samples. Morphological and molecular analysis were conducted using females, males, and J2s. The perineal patterns of females (n = 20) showed a high dorsal arch, and with wavy striae, which mostly lacking obvious lateral lines. Morphological measurements of adult females (n = 20) include body length (BL) = 668.99 ± 24.56 (487.57-897.84) µm, body width (BW) = 433.73 ±12.84 (343.71-551.61) µm, stylet length = 15.64 ± 1.45 (10.86-28.26) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 2.57 ± 0.20 (1.41-3.68) µm, vulval slit length = 20.44 ± 0.91 (16.00-24.22) µm, and vulval slit to anus distance = 18.05 ± 1.06 (14.58-24.90) µm. The males showed a trapezoidal labial region, with a high head cap and concaved at the center of the top end in lateral view; and the stylet knobs were prominent, usually demarcated from the shaft. The morphological characters of males (n = 7) were as follows: BL = 1124.56 ± 53.97 (998.37-1336.52) µm, BW = 33.60 ± 0.79 (30.21-36.52) µm, stylet length = 23.63 ± 0.78 (20.14-26.37) µm, DGO = 3.04 ± 0.09 (2.69-3.38) µm, spicule length = 25.72 ± 0.57 (23.97-28.33) µm. The key morphometrics of J2s: BL = 439.13 ± 6.52 (398.32-481.33) µm, BW = 15.14 ± 0.26 (13.91-16.66) µm, stylet length = 13.44 ± 0.29 (10.96-14.60) µm, DGO = 2.13 ± 0.18 (1.22-3.10) µm, tail length = 57.46 ± 4.89 (38.85-101.33) µm, hyaline tail terminus = 16.93 ± 0.97 (11.45-22.54) µm. The morphological features of the females, males, and J2s match the original description of Meloidogyne incognita (Eisenback and Hirschmann, 1981). Eleven individual females were transferred to eleven different tubes for DNA extraction and the species-specific primers Mi2F4/Mi1R1 (ATGAAGCTAAGACTTTGGGCT/TCCCGCTACACCCTCAACTTC) were used for the identification of M. incognita (Kiewnick et al. 2013). A 300 bp target fragment was amplified by the primer pairs, confirming the RKNs collected from daylily plants were M. incognita. To confirm the result of species identification, the NADH dehydrogenase subunit 5 (nad5) from the mitochondrial DNA region was amplified using primers NAD5-F/R (TATTTTTTGTTTGAGATATATTAG/CGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). A fragment of 611 bp was obtained and the sequence (GenBank Accession No.OP115729) was 100% identical to the known sequence of M. incognita (GenBank Accession No. MT683461). The ITS region was amplified using the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992). The sequences from the ITS region were 768 bp (GenBank Accession No. OP095037) and showed 100% identical to the known sequence of M. incognita (GenBank Accession No. MH113856). An infection test was conducted in greenhouse conditions. Eighteen 5-weeks-old healthy daylily seedlings (cv. Shayuan) were individually cultured in 9 L pots filled with autoclaved-soil and each plant was inoculated with 3,000 J2s. Six non-inoculated daylily plants served as negative controls. After 60 days, all of the inoculated plant roots showed galling symptoms which were similar to those observed in the field, the nematodes were extracted from roots and were identified as M. incognita with the sequence-specificprimers Mi2F4/Mi1R1. No obvious symptoms were observed on control plants. An average of 9635 J2s were recovered from inoculated plants, (reproductive factor = 3.21), which confirmed the pathogenicity of M. incognita on daylily. Although it was reported that daylily was a host of M. incognita in Florida (Inserra et al. 1995), to our knowledge, this is the first evidence that M. incognita naturally infecting daylily in China. This root-knot disease leads to the yield reduction of daylily and may cause serious economic losses, so further studies should focus on the occurrence and effective control of this disease.

The influence of involving patients in postoperative pain treatment decisions on pain-related patient-reported outcomes: A STROBE-compliant registering observational study.

The evidence regarding the influence of allowing patients to participate in postoperative pain treatment decisions on acute pain management is contradictory. This study aimed to identify the role of patient participation in influencing pain-related patient-reported outcomes (PROs). This is a cross-sectional study. The data were provided by PAIN OUT (www.pain-out.eu). A dataset specific to adult Chinese patients undergoing orthopedic surgery was selected. The PROs were assessed on postoperative day 1. The patient participant was assessed using an 11-point scale. Participants who reported >5 were allocated to the "participation" group, and those who reported ≤5 were allocated to the "nonparticipation" group. A 1:1 propensity score matching was conducted. The primary outcome was the desire for more pain treatment. All other items of PROs were the secondary outcomes comprising pain intensity, interference of pain with function, emotional impairment, adverse effects, and other patient perception. From February 2014 to November 2020, 2244 patients from 20 centers were approached, of whom 1804 patients were eligible and 726 pairs were matched. There was no significant difference between the groups in the desire for more pain treatment either before (25.4% vs 28.2%, risk ratio [95% CI]: 0.90 [0.77, 1.05], P = .18) or after matching (26.7% vs 28.8%, risk ratio [95% CI]: 0.93 [0.79, 1.10], P = .43). After matching, patients in the participation group reported significantly better PROs, including pain intensity (less time spent in severe pain [P < .01]), emotional impairment (less anxiety [P < .01]), interference with function (less interference with sleep [P < .01]), adverse effects (less drowsiness [P = .01]), and patient perception (more pain relief [P < .01] and more satisfaction [P < .01]), than the nonparticipation group. Patient participation in pain treatment decisions was associated with improved pain experience but failed to mitigate the desire for more treatment.

SPP1 and CXCL9 Promote Non-alcoholic Steatohepatitis Progression Based on Bioinformatics Analysis and Experimental Studies.

Background and Aims: Non-alcoholic fatty liver disease (NAFLD) is a major chronic liver disease worldwide, and non-alcoholic steatohepatitis (NASH) is one of its pathological subtypes. The pathogenesis of NASH has not yet been fully elucidated. The purpose of this study was to identify the hub genes and pathways involved in NASH using bioinformatics methods. The hub genes were confirmed in human and animal models. Materials and Methods: Three Gene Expression Omnibus (GEO) datasets (GSE48452, GSE58979, and GSE151158) of NASH patients and healthy controls were included in the study. We used GEO2R to identify differentially expressed genes (DEGs) between NASH patients and healthy controls. Functional enrichment analyses were then performed to explore the potential functions and pathways of the DEGs. In all DEGs, only two genes were highly expressed in NASH patients throughout the three datasets; these two genes, SPP1 and CXCL9, were further studied. Serum and liver tissues from NASH patients and healthy controls were collected. Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were measured in NASH patients and healthy controls. Liver tissues were stained with hematoxylin and eosin. Immunohistochemical staining was used to evaluate the expression levels of the two genes in liver tissues. Male C57BL/6J mice were fed a methionine choline-deficient (MCD) diet for 8 weeks, after which serum ALT and AST levels were measured and liver tissues were stained. Results: SPP1 and CXCL9 were the hub genes detected in the three datasets. "Lipid metabolism," "inflammatory response," and "lymphocyte activation" were the most significant biological functions in GSE48452, GSE58979, and GSE151158, respectively. Kyoto Encyclopedia of Genes and Genomes pathway analysis showed that the toll-like receptor signaling pathway was significantly enriched in NASH patients. Serum ALT and AST levels were significantly increased in NASH patients compared to healthy controls. Liver tissues had more serious steatosis, hepatocyte ballooning degeneration, and lobular inflammatory infiltration, and the expression of SPP1 and CXCL9 in liver cells was significantly upregulated in NASH patients compared to healthy controls. MCD diet mice were consistent with NASH patients. Conclusion: SPP1 and CXCL9 may play important roles in NASH pathogenesis and could be potential therapeutic targets and biomarkers of NASH in the future. Further experimental studies are needed to confirm our results.

[Barrier effect against Bemisia tabaci and the control of tomato yellow leaf curl virus in a tomato-maize intercropping system]. / ç•ªèŒ„çŽ‰ç±³é—´å¥—ä½œå¯¹çƒŸç²‰è™±çš„å±éšœæ•ˆåº”åŠæŽ§åˆ¶ç•ªèŒ„é»„åŒ–æ›²å¶ç— æ¯’ç— çš„æ•ˆæžœ.

We examined the barrier effects against Bemisia tabaci and the potential to control the tomato yellow leaf curl virus (TYLCV) of different tomato-maize intercropping modes. Tomatoes (variety Jinshan 511) were planted at a fixed row distance either as a monoculture or together with maize (variety Xianyu 335) at the distances of 10, 20, and 30 cm. We investigated the viral index for TYLCV and the population density of B. tabaci. Compared with tomato monoculture, the natural barrier established by the maize stabilized the growth environment for tomato. When the maize spacing was 10, 20, and 30 cm, the average temperature of tomato plants from 6:00 to 20:00 decreased by 3.01, 2.26, and 1.45 ℃, the average relative humidity increased by 13.0%, 8.8%, and 6.0%, and the mean light intensity reduced by 26.1%, 20.4%, and 14.5%, respectively. The changes of those factors alleviated the adverse environmental conditions (i.e., intense light, high temperature, and lack of moisture) that promote the spread of virus-related diseases during the high-temperature period of the day, with the most effective planting distance for the maize being 10 cm. Our results suggested that the intercropping of tomato and maize had a barrier effect against B. tabaci and was able to control the TYLCV in tomato. When the planting distance for the maize was 10, 20, and 30 cm, the number of B. tabaci was 88.7%, 82.0%, and 73.9% lower than tomato monoculture, respectively. The TYLCV was inhibited, with the viral disease index being decreased by 67.3%, 59.4%, and 44.5%, respectively. Tomato-maize intercropping was also beneficial for tomato plant growth and fruit set, which could enhance tomato yield. Such effect was strengthened under higher maize density.

First report of Meloidogyne hapla infecting Salvia miltiorrhiza in Shaanxi, China.

Salvia miltiorrhiza is a perennial herbaceous plant for traditional Chinese medicine. It has been extensively applied for many hundred years to treat various diseases (Su et al. 2015). It is also a kind of important cash crop that is widely cultivated in southern Shaanxi province. In June of 2021, in a field in Luonan County, Shaanxi Province, some S. miltiorrhiza plants with stunting and leaf wilting symptoms were observed. The diseased plants exhibited a large number of globular galling on the secondary and tertiary roots. The symptoms were typical of infection by root-knot nematodes. Population densities of second-stage juveniles (J2s) ranged from 330 to 650 per 100 cm3. To identify the species of the root-knot nematodes, J2s and males were collected from the soil in the root zone, and females were isolated from diseased roots. The perineal patterns of females (n = 12) were round-shaped, with low dorsal arches, obvious lateral lines, and characteristic small punctations near anus. Morphological measurements of females (n = 20) included body length (L) = 565.25 ± 33.9 (503.35 - 632.47) µm, body width (BW) = 420.00 ± 21.28 (378.27 - 452.51) µm, stylet = 11.11 ± 0.73 (10.05-12.29) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.69 ± 0.45 (3.82-5.32) µm, vulval slit length = 21.1 ± 1.33 (18.38-22.96) µm, and vulval slit to anus distance = 15.76 ± 1.24 (13.38-17.45) µm. The morphological characters of males (n = 7): L = 1098.14 ± 82.99 (962.83-1193.87) µm, BW = 28.44 ± 1.18 (26.59-29.83) µm, stylet = 18.27 ± 0.97 (16.57-19.28) µm, DGO = 4.89 ± 0.62 (3.82-5.68) µm, and spicule length = 24.04 ± 1.80 (21.30-26.71) µm. The key morphometrics of J2s: L = 380.24 ± 18.24 (354.43-423.13) µm, BW = 13.94 ± 0.70 (12.88-15.34) µm, stylet = 11.82 ± 0.49 (10.96-12.61) µm, DGO = 3.68 ± 0.42 (3.09-4.56) µm, tail length = 55.42 ± 5.81 (46.97-67.03) µm, and hyaline tail terminus = 13.79 ± 1.24 (12.0-16.51) µm. These morphological characteristics are consistent with Meloidogyne hapla as described by Whitehead (1968). Ten individual females were transferred to ten different tubes for DNA extraction. The DNA extraction followed the method described by Htay et al. (2016). The species-specific primers JMV1 (5'-GGATGGCGTGCTTTCAAC-3') and JMV (5'-AAAAATCCCCTCGAAAAATCCACC-3') were used for the identification of M. hapla (Adam et al. 2007). A single 440 bp fragment was amplified by this pair of primers, confirming their identities as M. hapla. To confirm species identification, the ITS region was amplified using the primers 18S/26S (5'-TTGATTACGTCCCTGCCCTTT-3'/5'-TTTCACTCGCCGTTACTAAGG-3') (Vrain et al. 1992). The sequence from the ITS region was 768 bp (GenBank Accession No. OM049198) and was 100% identical to the sequences of M. hapla (GenBank Accession Nos. MT249016 and KJ572385). The mitochondrial DNA (mtDNA) region between COII and the lRNA gene was amplified using primers C2F3 (5'-GGTCAATGTTCAGAAATTTGTGG-3') and 1108 (5'-TACCTTTGACCAATCACGCT-3') (Powers and Harris, 1993). A fragment of 529 bp was obtained and the sequence (GenBank Accession No. OM055828) was 100% identical to the known sequence of M. hapla from Taiwan (GenBank Accession No. KJ598134). An infection test was conducted in greenhouse conditions. Six 2-month-old S. miltiorrhiza plants were individually maintained in 12-cm diameter, 10-cm deep plastic pots containing sterilized soil and each plant was inoculated with 3000 J2s hatched from egg masses of collected M. hapla samples. Two non-inoculated S. miltiorrhiza plants served as negative controls. After 60 days, inoculated plants exhibited galled roots similar to those observed in the field. Many galls (61.33 ± 8.52) and egg masses (26.17 ± 4.79) were found on each root system. The nematode reproduction factor (RF = final population/initial population) was 4.5. No symptoms were observed in control plants. The nematode was reisolated from root tissue and identified to be M. hapla with its sequence-specific primers JMV1/JMV. These results confirmed that the nematode population could infect S. miltiorrhiza. To our knowledge, this is the first time of natural infection of S. miltiorrhiza with M. hapla in China. Including S. miltiorrhiza, the medicinal ingredients of many traditional Chinese herbal medicines were extracted from the roots of the plants. The infection of root-knot nematode will cause a serious decline in the quality of Chinese medicinal materials. Therefore, it is necessary to identify the species of root-knot nematode in different Chinese herbal medicines.

Identification of hub genes for adult patients with sepsis via RNA sequencing.

To screen out potential prognostic hub genes for adult patients with sepsis via RNA sequencing and construction of a microRNA-mRNA-PPI network and investigate the localization of these hub genes in peripheral blood monocytes. The peripheral blood of 33 subjects was subjected to microRNA and mRNA sequencing using high-throughput sequencing, and differentially expressed genes (DEGs) and differentially expressed microRNAs (DEMs) were identified by bioinformatics. Single-cell transcriptome sequencing (10 × Genomics) was further conducted. Among the samples from 23 adult septic patients and 10 healthy individuals, 20,391 genes and 1633 microRNAs were detected by RNA sequencing. In total, 1114 preliminary DEGs and 76 DEMs were obtained using DESeq2, and 454 DEGs were ultimately distinguished. A microRNA-mRNA-PPI network was constructed based on the DEGs and the top 20 DEMs, which included 10 upregulated and 10 downregulated microRNAs. Furthermore, the hub genes TLR5, FCGR1A, ELANE, GNLY, IL2RB and TGFBR3, which may be associated with the prognosis of sepsis, and their negatively correlated microRNAs, were analysed. The genes TLR5, FCGR1A and ELANE were mainly expressed in macrophages, and the genes GNLY, IL2RB and TGFBR3 were expressed specifically in T cells and natural killer cells. Parallel analysis of mRNAs and microRNAs in patients with sepsis was demonstrated to be feasible using RNA-seq. Potential hub genes and microRNAs that may be related to sepsis prognosis were identified, providing new prospects for sepsis treatment. However, further experiments are needed.

Association Between Frailty and Clinical Outcomes and Quality of Life in Older Adults Following Hip Fracture Surgery: A Retrospective Cohort Study.

BACKGROUND: Hip fracture is a serious event in the older population and is associated with morbidity, mortality, and disability among those who survive. Emerging evidence suggests that frailty is pertinent to the clinical outcomes of older patients with hip fracture. METHODS: We conducted a retrospective cohort study on older patients (aged ≥65 years) who underwent orthopedic repair with hip fracture under spinal or general anesthesia between June 1, 2019 and May 31, 2020. Demographic, surgical, and anesthetic features; chart-derived frailty index (CFI); occurrence of complications; and length of stay were retrospectively collected by reviewing patients' anesthesia records and medical charts. Patients were divided into 2 groups according to their CFI: high CFI group (CFI, 3-5) and low CFI group (CFI, 0-2). The CFI was calculated as the addition of the patient's conditions, including age >70 years, preoperative body mass index <18.5 kg/m2, hematocrit <35%, albumin <34 g/L, and serum creatinine >176.8 mol/L (2.0 mg/dL). The EuroQol 5-dimensional questionnaire (EQ-5D) was obtained through telephone interviews 12 months after surgery to assess mortality and long-term quality of life. RESULTS: During the study period, 381 patients met the inclusion criteria. Patients in the high CFI group had an increased incidence of delirium by 13.80% (95% confidence interval [CI], 6.31-21.29) (17 [16.6%] vs 8 [2.8%]; P < .001) compared to patients in the low CFI group. More patients in the high CFI group had pneumonia with an increased incidence of 17.71% (95% CI, 7.08-23.34) (40 [39.2%] vs 60 [21.5%]; P < .001) than patients in the low CFI group. Postoperative hospital stay was significantly longer in the high CFI group (8 [6-12] vs 7 [5-10] days; P = .0222) than in the low CFI group. More patients died in the high CFI group 1 year after surgery with an increased mortality of 19.33% (95% CI, 9.47-29.18) (26.4% [23/87] vs 7.1% [16/225]; P < .001) than patients in the low CFI group. A total of 64 patients in the high CFI group and 209 patients in the low CFI group completed the EQ-5D survey 1 year after surgery. The EQ-5D score in the high CFI group was significantly lower than that in the low CFI group (0.63 ± 0.22 vs 0.72 ± 0.22; P = .002). CONCLUSIONS: Frailty status is associated with adverse postoperative outcomes, mortality, and low quality of life 12 months after hip fracture surgery in older patients.

Three new pigment protein tyrosine phosphatases inhibitors from the insect parasite fungus Cordyceps gracilioides: terreusinone A, pinophilin C and cryptosporioptide A.

Three new pigment compounds--terreusinone A (1), pinophilin C (2) and cryptosporioptide A (3)-were isolated from a solid culture of Cordyceps gracilioides. The structures of these compounds were determined by extensive spectroscopic analysis including HRESIMS, 1D- and 2D-NMR. The structure of terreusinone A (1) was further confirmed by single-crystal X-ray crystallographic diffraction analysis. In an in vitro activity assay, 1, 2 and 3 exhibited high inhibitory activity against PTP1B, SHP2, CDC25B, LAR and SHP1. Terreusinone A (1) inhibited PTP1B, SHP2, CDC25B, LAR and SHP1 enzyme with IC50 values 12.5, >50, 4.1, 10.6, 5.6 µg/mL, respectively; pinophilin C (2) with IC50 values 6.8, 8.0, 4.5, 4.7, 3.4 µg/mL, respectively; and cryptosporioptide A (3) with IC50 values 7.3, 5.7, 7.6, >50, 4.9 µg/mL, respectively.

A novel oxybis cresol verticilatin with highly varying degrees of biological activities from the insect pathogenic fungus Paecilomyces verticillatus.

A novel oxybis cresol compound named verticilatin (1), together with two known compounds, 5-methylresorcinol (2) and 2,4-dihydroxy-3,6-dimethylbenzaldehyde (3), was isolated from cultures of the insect pathogenic fungi Paecilomyces verticillatus. The structures of compounds were determined by extensive spectroscopic analysis of HR-ESI-MS and 1D and 2D NMR including HSQC, HMBC, COSY, and ROESY. Fortunately, compound 1 exhibited significant inhibitory activities against CDC25B, cathepsin B, MEG2, and SHP2 enzyme, with IC50 values of 11.5, 3.5, 7.8, and 15 µg/ml, respectively.

Penostatin derivatives, a novel kind of protein phosphatase 1b inhibitors isolated from solid cultures of the entomogenous fungus Isaria tenuipes.

Protein tyrosine phosphatase 1B (PTP1B) is implicated as a negative regulator of insulin receptor (IR) signaling and a potential drug target for the treatment of type II diabetes and other associated metabolic syndromes. Therefore, small molecular inhibitors of PTP1B can be considered as an attractive approach for the design of new therapeutic agents of type II diabetes diseases. In a continuing search for new protein phosphatase inhibitors from fungi, we have isolated a new compound, named penostatin J (1), together with three known ones, penostatin C (2), penostatin A (3), and penostatin B (4), from cultures of the entomogenous fungus Isaria tenuipes. The structure of penostatin J (1) was elucidated by extensive spectroscopic analysis. We also demonstrate for the first time that penostatin derivatives exhibit the best PTP1B inhibitory action. These findings suggest that penostatin derivatives are a potential novel kind of PTP1B inhibitors.