Human Ku antigen tightly binds and stabilizes a tetrahelical form of the Fragile X syndrome d(CGG)n expanded sequence.

Hairpin and tetrahelical structures of a d(CGG)(n) sequence in the FMR1 gene have been implicated in its expansion in fragile X syndrome. The identification of tetraplex d(CGG)(n) destabilizing proteins (Fry, M., and Loeb, L. A.(1999) J. Biol. Chem. 274, 12797-12803; Weisman-Shomer, P., Naot, Y., and Fry, M. (2000) J. Biol. Chem. 275, 2231-2238) suggested that proteins might modulate d(CGG)(n) folding and aggregation. We assayed human TK-6 lymphoblastoid cell extracts for d(CGG)(8) oligomer binding proteins. The principal binding protein was identified as Ku antigen by its partial amino acid sequence and antigenicity. The purified 88/75-kDa heterodimeric Ku bound with similar affinities (K(d) approximately 1. 8-10.2 x 10(-9) mol/liter) to double-stranded d(CGG)(8).d(CCG)(8), hairpin d(CGG)(8), single-stranded d(CII)(8), or tetraplex structures of telomeric or IgG switch region sequences. However, Ku associated more tightly with bimolecular G'2 tetraplex d(CGG)(8) (K(d) approximately 0.35 x 10(-9) mol/liter). Binding to Ku protected G'2 d(CGG)(8) against nuclease digestion and impeded its unwinding by the tetraplex destabilizing protein qTBP42. Stabilization of d(CGG)(n) tetraplex domains in FMR1 by Ku or other proteins might promote d(CGG) expansion and FMR1 silencing.

Interruption of the fragile X syndrome expanded sequence d(CGG)(n) by interspersed d(AGG) trinucleotides diminishes the formation and stability of d(CGG)(n) tetrahelical structures.

Fragile X syndrome is caused by expansion of a d(CGG) trinucleotide repeat sequence in the 5' untranslated region of the first exon of the FMR1 gene. Repeat expansion is thought to be instigated by formation of d(CGG)(n)secondary structures. Stable FMR1 d(CGG)(n)runs in normal individuals consist of 6-52 d(CGG) repeats that are interrupted every 9-11 triplets by a single d(AGG) trinucleotide. By contrast, individuals having fragile X syndrome premutation or full mutation present >54-200 or >200-2000 monotonous d(CGG) repeats, respectively. Here we show that the presence of interspersed d(AGG) triplets diminished in vitro formation of bimolecular tetrahelical structures of d(CGG)(18)oligomers. Tetraplex structures formed by d(CGG)(n)oligomers containing d(AGG) interspersions had lower thermal stability. In addition, tetraplex structures of d(CGG)(18)oligomers interspersed by d(AGG) triplets were unwound by human Werner syndrome DNA helicase at rates and to an extent that exceeded the unwinding of tetraplex form consisting of monotonous d(CGG)(18). Diminished formation and stability of tetraplex structures of d(AGG)-containing FMR1 d(CGG)(2-50)tracts might restrict their expansion in normal individuals.

Tetrahelical forms of the fragile X syndrome expanded sequence d(CGG)(n) are destabilized by two heterogeneous nuclear ribonucleoprotein-related telomeric DNA-binding proteins.

Formations of hairpin and tetrahelical structures by the trinucleotide repeat sequence d(CGG)(n) might contribute to its expansion in fragile X syndrome. Here we show that tetraplex structures of d(CGG)(n) are destabilized by two mammalian heterogeneous nuclear ribonucleoprotein-related tetraplex telomeric DNA-binding and -stabilizing proteins, quadruplex telomeric DNA-binding protein 42 (qTBP42) (Sarig, G., Weisman-Shomer, P., Erlitzki, R., and Fry, M. (1997) J. Biol. Chem. 272, 4474-4482) and unimolecular quadruplex telomeric DNA-binding protein 25 (uqTBP25) (Erlitzki, R., and Fry, M. (1997) J. Biol. Chem. 272, 15881-15890). Blunt-ended and 3'-tailed or 3'- and 5'-tailed bimolecular tetraplex structures of d(CGG)(n) and guanine-sparse 20-/46-mer partial DNA duplex were progressively destabilized by increasing amounts of qTBP42 or uqTBP25 in time-dependent and ATP- or Mg(2+)-independent reactions. By contrast, tetraplex structures of telomeric and IgG sequences or guanine-rich double-stranded DNA resisted destabilization by qTBP42 or uqTBP25. Increased stability of tetraplex d(CGG)(n) in the presence of K(+) or Na(+) ions or at lowered reaction temperature diminished the destabilizing activity of uqTBP25. The contrasting stabilization of tetraplex telomeric DNA and destabilization of tetraplex d(CGG)(n) by qTBP42 and uqTBP25 suggested that sequence or structural differences between these tetraplexes might serve as cues for the differential stabilizing/destabilizing activities.

Telomeric and tetraplex DNA binding properties of qTBP42: a homologue of the CArG box binding protein CBF-A.

qTBP42, a rat liver binding protein of telomeric and of guanine-rich single stranded or tetraplex DNA (Sarig, G., Weisman-Shomer, P., Erlitzki, R., and Fry, M. (1997) J. Biol. Chem. 272, 4474-4482), is identified here by its partial amino acid sequence as a homologue of the mouse muscle cell CArG box binding protein CBF-A. Complexes of qTBP42 with single stranded telomeric DNA or with double or single stranded CArG DNA are formed non-cooperatively and have a similar nanomolar-range dissociation constants, Kd. Double stranded telomeric or Plasmid DNA or poly d[(I-C)] are bound by qTBP42 less tightly. Analysis of the binding of tetramolecular quadruplex structures of the IgG switch sequence indicates that one molecule of qTBP42 associates with a single cluster of guanine quartets. The tight binding by qTBP42 of CArG box DNA, telomeric DNA and quadruplex DNA suggests that this protein may bind multiple targets in cellular DNA.

Purification and characterization of qTBP42, a new single-stranded and quadruplex telomeric DNA-binding protein from rat hepatocytes.

Telomeres of vertebrate chromosomes terminate with a short 5'-d(TTAGGG)-3' single-stranded overhang that can form in vitro tetrahelical structures. Here we describe a new protein from rat hepatocyte nuclei designated quadruplex telomere-binding protein 42 (qTBP42) that tightly binds 5'-d(TTAGGG)n-3' and 5'-d(CCCTAA)n-3' single-stranded and tetraplex forms of 5'd(TTAGGG)n-3'. The thermostable qTBP42 was isolated from boiled nuclear extracts and purified to near homogeneity by successive steps of column chromatography on DEAE-cellulose, phosphocellulose, and phenyl-Sepharose. A subunit molecular size of 42.0 +/- 2.0 kDa was determined for qTBP42 by Southwestern blotting and SDS-polyacrylamide gel electrophoresis of the protein and its UV cross-linked complex with labeled telomeric DNA. A native size of 53. 5 +/- 0.9 kDa, estimated by Superdex copyright 200 gel filtration, suggests that qTBP42 is a monomeric protein. Sequences of five tryptic peptides of qTBP42 contained motifs shared by a mammalian CArG box-binding protein, hnRNP A/B, hnRNP C, and a human single-stranded telomeric DNA-binding protein. Complexes of qTBP42 with each complementary strand of telomeric DNA and with quadruplex forms of the guanine-rich strand had 3.7-14.6 nM dissociation constants, Kd, whereas complexes with double-stranded telomeric DNA had up to 100-fold higher Kd values. By associating with tetraplex and single-stranded telomeric DNA, qTBP42 increased their heat stability and resistance to digestion by micrococcal nuclease.

The fragile X syndrome single strand d(CGG)n nucleotide repeats readily fold back to form unimolecular hairpin structures.

Expansion of a d(CGG)n run within the 5'-untranslated region of the X-linked human gene FMR1 blocks FMR1 transcription, delays its replication, and precipitates the fragile X syndrome. We showed previously that d(CGG)n tracts aggregate into interstrand tetrahelical complexes (Fry, M., and Loeb, L. A. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 4950-4954). Here we show that these sequences also form under physiological conditions in in vitro unimolecular hairpin structures. Folding is demonstrated by temperature-dependent mobility of d(CGG)n oligomers in a nondenaturing polyacrylamide gel, by UV-hyperchromicity of thermally denaturing oligomers, and by UV cross-linking of compact forms of d(CGG)n runs interspersed by thymidine clusters. That the compact d(CGG)n structures are unimolecular is suggested by their zero-order kinetics of formation. Diethyl pyrocarbonate modification reveals a single, 4-5 residue-long central or epicentral unpaired loop in folded d(CGG)n oligomers. The position of this loop remains unchanged by insertion of thymidine clusters into 15- or 33-mer d(CGG) tracts as indicated by KMnO4 probing of unpaired thymidines. The presence of a single loop in folded d(CGG)n oligomers and the accessibility of every guanine to dimethyl sulfate modification suggest that they are hairpin and not tetraplex structures. Modeling indicates that different d(CGG)n hairpins are stabilized by guanine-guanine Hoogsteen hydrogen bonds or by Hoogsteen and Watson-Crick bonds. If formed in vivo, d(CGG)n hairpins could entail slippage and trinucleotide expansion during replication and could obstruct FMR1 gene transcription and replication.

Stabilization of tetrahelical DNA by the quadruplex DNA binding protein QUAD.

The 57-kDa hepatic nuclear protein QUAD binds tightly and specifically a parallel tetrahelical form of the IgG switch region DNA (Weisman-Shomer, P. and Fry, M. (1993) J. Biol Chem. 268, 3306-3312). Here we show that QUAD is a heat-stable protein, maintaining approximately 90% of its tetrahelix binding activity after 10 min at 100 degrees C and becoming fully inactivated only after 30 min at 100 degrees C. To demonstrate that QUAD protects bound quadruplex DNA, naked and QUAD-bound tetrahelices were boiled, the protein residue in the complex was digested with trypsin and quadruplex and single-strand forms of the DNA component were resolved by electrophoresis. Whereas naked quadruplex DNA became fully denatured after 2 min at 100 degrees C, 55% of the QUAD-bound DNA was conserved as a tetrahelix after 6 min at 100 degrees C. These findings support the proposal that QUAD may act in vivo to stabilize tetrahelical DNA.

QUAD, a protein from hepatocyte chromatin that binds selectively to guanine-rich quadruplex DNA.

The single-stranded oligomer Q, whose nucleotide sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3' corresponds to the IgG switch region, forms in concentrated solutions and in the presence of alkali metal cation parallel four-stranded complexes termed G4 DNA (Sen, D., and Gilbert, W. (1988) Nature 334, 364-366). We show that G4 DNA was also formed during storage of dried oligomer Q. This quadruplex complex migrated more slowly than mono-strand oligomer Q during nondenaturing gel electrophoresis, the rate of its formation depended on the mass of stored oligomer Q, and N7 positions of guanine residues were involved in its stabilization. Here we report the purification of a protein designated QUAD that binds specifically to the G4 form of oligomer Q, from non-histone protein extracts of rabbit hepatocytes. QUAD was 80-90% purified by sequential steps of column chromatography on Sepharose 6B, DEAE-cellulose, phosphocellulose, and phenyl-Sepharose. Purified QUAD migrated on SDS-polyacrylamide gel electrophoresis as a 58 +/- 2.6-kDa polypeptide and had a native molecular mass of 57 +/- 2.5 kDa as determined by Sepharose 6B gel filtration. The dissociation constant of G4 DNA binding to QUAD was in the range of 2.5 to 7.0 x 10(-9) M/liter. Excess unlabeled monostranded oligomer Q did not compete with 5'-32P-labeled G4 DNA on its binding to QUAD. Further, that QUAD recognized the G4 DNA structure rather than a DNA sequence was also demonstrated by the inefficient competition on the binding of 5'-[32P]G4 DNA to QUAD by excess unlabeled single- or double-stranded DNA molecules that contained guanine clusters of different length or various other nucleotide sequences.

Sequence specificity of pausing by DNA polymerases.

We have constructed recombinant M13 DNA templates containing stretches of oligo (purines) and oligo (pyrimidines). Each of these inserts hinders the advancement of the large fragment of E. coli Pol I during DNA synthesis. The pattern of blockage is independent of changes in KCl or Mg2+ concentrations and pausing is moderately alleviated at lower pH. Blockage is not affected by either the concentration of template or by the position of the DNA primer. The pattern of pause sites is similar for calf thymus DNA polymerase-alpha, implying that replicative barriers are determined by the structure of the DNA at its growing point. There is a lack of correlation between the position of pause sites with different inserts and known alternate DNA structures. Thus, the homo-oligomeric inserts may possess a different structure when complexed with DNA polymerase. This concept accounts for the appearance of unique new upstream and downstream pause sites that result from the insertion of each oligonucleotide.

Distamycin paradoxically stimulates the copying of oligo(dA).poly(dT) by DNA polymerases.

Distamycin A, a polypeptide antibiotic, binds to dA.dT-rich regions in the minor groove of B-DNA. By virtue of its nonintercalating binding, distamycin acts as a potent inhibitor of the synthesis of DNA both in vivo and in vitro. Here we report that distamycin paradoxically stimulates Escherichia coli DNA polymerase I (pol I), its large (Klenow) fragment, and bacteriophage T4 DNA polymerase to copy oligo(dA).poly(dT) in vitro. It is found that distamycin increases the maximum velocity (Vmax) of the extension of the oligo(dA) primer by pol I without affecting the Michaelis constant (Km) of the primer. Gel electrophoresis of the extended primer indicates that the antibiotic specifically increases the rate of addition of the first three dAMP residues. Lastly, in the presence of both distamycin and the oligo(dT)-binding protein factor D, which increases the processivity of pol I, a synergistic stimulation of polymerization is attained. Taken together, these results suggest that distamycin stimulates synthesis by increasing the rate of initiation of oligo(dA) extension. The stimulatory effect of distamycin is inversely related to the stability of the primer-template complex. Thus, maximum stimulation is exerted at elevated temperatures and with shorter oligo(dA) primers. That distamycin increases the thermal stability of [32P](dA)9.poly(dT) is directly demonstrated by electrophoretic separation of the hybrid from dissociated [32P](dA)9 primer. It is proposed that by binding to the short primer-template duplex, distamycin stabilizes the oligo(dA).poly(dT) complex and, therefore, increases the rate of productive initiations of synthesis at the primer terminus.

Factor C from rabbit liver. A new poly(dC) and poly[d(G-C)] template-selective stimulatory protein of DNA polymerases.

We have undertaken a search for mammalian DNA-binding proteins that enhance the activity of DNA polymerases in a template sequence-specific fashion. In this paper, we report the extensive purification and characterization of a new DNA-binding protein from rabbit liver that selectively stimulates DNA polymerases to copy synthetic poly[d(G-C)] and the poly(dC) strand of poly(dC).poly(dG) as well as single-stranded natural DNA that contains stretches of oligo(dC). The enhancing protein, a polypeptide of 65 kDa designated factor C, stimulates the copying of the two synthetic templates by Escherichia coli DNA polymerase I, Micrococcus luteus polymerase, and eukaryotic DNA polymerases alpha and beta, but not by avian myeloblastosis virus polymerase. Factor C, however, does not affect utilization by these polymerases of the poly(dG) strand of poly(dC).poly(dG), of poly(dC) primed by oligo(dG), or of poly(dA).poly(dT) and poly[d(A-T)]. With polymerase I, Michaelis constants (Km) of poly[d(G-C)] and of the poly(dC) strand of poly(dC).poly(dG) are decreased by factor C 37- and 4.7-fold, respectively, whereas maximum velocity (Vmax) remains unchanged. By contrast, neither the Km value of the poly(dG) strand of poly(dC).poly(dG) nor the Vmax value with this template is altered by factor C. Rates of copying of activated DNA, denatured DNA, or singly primed M13 DNA are not affected significantly by factor C. However, primer extension analysis of the copying of recombinant M13N4 DNA that contains runs of oligo(dC) within an inserted thymidine kinase gene shows that factor C increases processivity by specifically augmenting the efficiency at which polymerase I traverses the oligo(dC) stretches. Direct binding of factor C to denatured DNA is indicated by retention of the protein-DNA complex on columns of DEAE-cellulose. Binding of factor C to poly[d(G-C)] is demonstrated by the specific adsorption of the enhancing protein to columns of poly[d(G-C)]-Sepharose. We propose that by binding to poly[d(G-C)] and to poly(dC).poly(dG), factor C enables tighter binding of some DNA polymerases to these templates and facilitates enzymatic activity.

Rabbit liver factor D, a poly(thymidine) template stimulatory protein of DNA polymerases: purification and characterization.

Factor D, a DNA binding protein that enhances the activities of diverse DNA polymerases with a common restricted set of templates, was initially characterized in mouse liver but has resisted extensive purification. In this paper, we report that a similar stimulatory activity can be obtained in highly purified form from nuclei of rabbit hepatocytes. The rabbit liver protein increases the rates at which several DNA polymerases copy sparsely primed natural DNA templates and primed synthetic poly(dT), but it has no effect on the rates of copying of activated DNA or of poly(dG), poly(dA), and poly(dC). Direct binding of the purified stimulatory protein to an oligomer that contains a (dT)16 base stretch is visualized by retardation of the nucleoprotein complex on nondenaturing electrophoretograms. In the presence of the enhancing factor, Michaelis constants, Km, of responsive polymerase for singly primed bacteriophage M13 DNA and for poly(dT), but not for poly(dA), are decreased. Product analysis of M13 DNA primer extension indicates that the rabbit factor augments the apparent processivity of DNA polymerase by decreasing the extent of enzyme pausing at a tract of four consecutive thymidine residues in the template. Gel filtration of the native stimulatory protein yields an apparent relative molecular size of 58 +/- 2 kilodaltons. Stimulatory activity is readily inactivated by heat or by trypsin digestion, but it is resistant to micrococcal nuclease, N-ethyl-maleimide, or calcium ions.

Template-selective stimulation of diverse DNA polymerases by the murine DNA-binding protein factor D.

Factor D, a template-selective DNA polymerase-alpha stimulatory protein from mouse liver (Fry, M., Lapidot, J., and Weisman-Shomer, P. (1985) Biochemistry 24, 7549-7556) is shown here to enhance the activities of diverse DNA polymerases with a cognate template specificity. DNA synthesis catalyzed by Escherichia coli DNA polymerase I, avian myeloblastosis virus polymerase, and some mammalian alpha- and gamma-polymerases was increased by factor D. With every enhanced polymerase, factor D increased the rate of copying of only poly(dT) among various tested synthetic poly-deoxynucleotides. Of the natural DNA templates examined, rates of copying of sparsely primed denatured DNA and of singly primed circular phi X174 or M13 bacteriophage DNA, but not of activated DNA, were enhanced. Michaelis constants (Km) of affected templates with responsive polymerases were decreased by factor D, without alteration in maximum velocity (Vmax). By contrast, factor D increased Vmax of deoxyribonucleoside 5'-monophosphate incorporation without changing Km of deoxyribonucleoside 5'-triphosphate substrates. Binding of factor D to poly(dT), poly(dA).poly(dT), and DNA, but less to poly(dA), was indicated by specific retention of their complexes on a DEAE-cellulose column. That factor D does not bind to DNA polymerase-alpha or to its complex with the DNA template was demonstrated by the failure of the factor to be coprecipitated with alpha-polymerase by anti-polymerase-alpha monoclonal antibodies in either the absence or presence of various templates. Lack of binding of factor D to the polymerase molecule was also indicated by simultaneous maximum stimulation of two competing polymerases by a limiting amount of factor. These combined results suggest that the enhancement of DNA synthesis is exerted through interaction of factor D with the template. It is proposed that this association leads to a tighter binding of the polymerase to the template and facilitates DNA synthesis.

The DNA sequence specificity of stimulation of DNA polymerases by factor D.

The mechanism of enhancement of DNA polymerase activity by the murine DNA-binding protein factor D was investigated. Extension by Escherichia coli DNA polymerase I and calf thymus DNA polymerase-alpha of 5'-32P-labeled oligodeoxynucleotide primers that are complementary to poly(dT) or to bacteriophage M13 DNA was measured in the absence or presence of factor D. With 5'-[32P](dA)9.poly(dT), factor D enables E. coli polymerase I to fill approximately 15-nucleotide gaps between adjacent primers; whereas in the absence of the stimulatory protein, poly(dT) is not copied significantly. In order to study the nucleotide specificity of synthesis enhancement, we used M13mp10 DNA containing 4 consecutive thymidine residues downstream from the 3-hydroxyl terminus of an oligonucleotide primer. Upon addition of factor D, both polymerase I and polymerase-alpha can traverse this sequence more efficiently and thus generate longer DNA products. Densitometric analysis of nonextended and elongated 5'-32P-labeled M13 primer indicates that, without changing the frequency of primer utilization, factor D enhances the activity of these DNA polymerases by increasing their apparent processivity. By positioning oligonucleotide primers 4, 8, and 12 bases upstream from the (dT)4 template sequence, we show that the enhancement of synthesis by factor D is independent of the position of the oligothymidine cluster. We hypothesize that factor D interacts with oligo(dT).oligo(dA) domains in DNA to alter their conformation, which may normally obstruct the progression of DNA polymerases.

A DNA template recognition protein: partial purification from mouse liver and stimulation of DNA polymerase alpha.

A protein that specifically enhances up to 13-fold the rate of copying of poly(dT) template by DNA polymerase alpha was partially purified from chromatin of regenerating mouse liver cells. This stimulatory protein, designated herein factor D, also increases 2-3-fold the activity of polymerase alpha with heat-denatured DNA and with primed, circular single-stranded phi X174 DNA. However, factor D has no detectable effect on the copying by polymerase alpha of poly(dG), poly(dA), and poly(dC) templates. Activity of mouse DNA polymerase beta is not affected by factor D with all the tested templates. In contrast to polymerase alpha, factor D is resistant to inactivation by N-ethylmaleimide and calcium ions, but it is readily heat-inactivated at 46 degrees C and is inactivated by trypsin digestion. Partially purified factor D is not associated with detectable activities of DNA polymerase, DNA primase, deoxyribonucleotidyl terminal transferase, and endo- or exodeoxyribonuclease.

Replicative activity of isolated chromatin from proliferating and quiescent early passage and aging cultured mouse cells.

Replicative activity of isolated chromatin from late passage cultured mouse cells has been compared to the activities of chromatin preparaions from dividing and quiescent early passage cells. Rates of endogenous DNA synthesis are similar for chromatin from growing or resting cells but this activity is stimulated 2.5-fold in senescent cell chromatin. Chromatin from growing young cells copies exogenously added single stranded DNA at the highest efficiency. Chromatin of senescent cells copies this template at a lower rate and resting young cell chromatin replicates single stranded DNA at the lowest efficiency. Similar relative rates are obtained when activated DNA is copied by the various chromatin preparations. Total activity of DNA polymerase extracted by salt from chromatin is similar for dividing and quiescent young cells but the proportion of DNA polymerase beta is higher in the latter. Elevated activities of DNA polymerases are extracted from chromatin of old cells. It is concluded, therefore, that chromatin-directed replication is differently arrested in non-dividing senescent cells and in quiescent early passage cells. The possible regulatory mechanisms of DNA replication in quiescence and aging are discussed.

Cell adhesion and acquisition of detergent resistance by the cytoskeleton of cultured chick fibroblasts.

About 30% of the proteins of adherent cultured chick embryo fibroblasts are not solubilized by the non-ionic detergent Triton X-100 and remain firmly attached to the substratum. The insoluble residue contains a considerable part of the cell's cytoskeleton and its major constituents are large external transformation-sensitive (LETS) protein, the heavy chain of myosin, a 52,000 molecular weight protein and actin. Kinetic studies reveal that cytoskeleton insolubility in Triton is acquired either concurrently with cell adhesion or very closely with it. Neither cell adhesion nor binding of the Triton cytoskeleton to the substratum require de novo synthesis of protein. In the attempt to assess the role of LETS protein in cytoskeleton attachment, we find that trypsin-detached cells rapidly acquire Triton-insoluble cytoskeleton although their LETS protein content is about 15--20% of its level in long-term cultures. Removal of the great majority of LETS molecules of adherent cultures by either urea or trypsin treatment does not affect the relative amount or composition of the anchored cytoskeletal proteins. Also, LETS protein of cultures exposed to cycloheximide for extended periods of time, is reduced to 10% of its maximum amount without much affecting the attachment and composition of the cytoskeleton. It is deduced that the great majority of LETS protein is not required for the attachment of the Triton cytoskeleton to the substratum.

Surface proteins of young and senescent cultured avian fibroblasts.

Proliferation of senescent cultured chick fibroblasts is arrested at densities that are 3-4 fold lower than densities inhibiting growth of young cells. The effects of density and growth rate of young and aged cultures on the accessibility of their surface proteins to external iodination were studied. LETS glycoprotein and a protein of 110,000 daltons are the major iodinated proteins of resting, highly dense and of sparse young cells, respectively. By contrast, LETS is minimally exposed on undividing, relatively disperse old cells. Therefore, exposure of LETS is correlated with cell density rather than with growth rate.