RESUMO
Four benzophenanthridine phosphoramidite reagents have been prepared in which the linker chain between the benzophenanthridine and the phosphoramidite moiety is attached to C-2, C-6, C-9, and C-12 of the benzophenanthridine ring system. These benzophenanthridine phosphoramidites should prove to be useful in the syntheses of antisense oligonucleotide-intercalator conjugates in which the linker chain is attached to various regions of the benzophenanthridine intercalator. One of the new benzophenanthridine phosphoramidite reagents was used to prepare an antisense oligonucleotide-intercalator conjugate in which the oligonucleotide TCAGTGGTp was connected at its 5'-hydroxyl group through a linker chain to the C-2 hydroxyl group of a benzophenanthridine.
Assuntos
Amidas , Aminas/síntese química , Substâncias Intercalantes/química , Oligonucleotídeos Antissenso/química , Fenantridinas , Ácidos Fosfóricos/síntese química , Animais , Sequência de Bases , Sítios de Ligação , Globinas/biossíntese , Indicadores e Reagentes , Substâncias Intercalantes/síntese química , Espectroscopia de Ressonância Magnética , Espectrometria de Massas , Estrutura Molecular , Oligonucleotídeos Antissenso/síntese química , RNA Mensageiro , Coelhos , Espectrofotometria , Relação Estrutura-AtividadeRESUMO
The effects of 5' proximal secondary structure in mRNA molecules on their translation and on their interaction with the eukaryotic initiation factors (eIF)-4F, eIF-4A, and eIF-4B have been examined. Secondary structures were generated in the 5' noncoding region of rabbit globin and reovirus mRNAs by means of hybridization with cDNA molecules. cDNAs hybridized to the first 15 bases downstream from the cap inhibited the translation of the mRNAs in both reticulocyte and wheat germ lysates. The degree of inhibition was directly related to the monovalent ion concentration and inversely related to reaction temperature. These hybrid structures also reduced the competitive ability of the messages. Hybrid structures beginning downstream from the first 15 bases did not inhibit the translation of beta-globin mRNA or reovirus s3 mRNA. None of the hybrid structures were detrimental to the interaction of the mRNAs with the 26-kDa cap binding protein of eIF-4F, as determined by chemical cross-linking assays. However, in the presence of ATP, hybrid structures immediately adjacent to the cap severely inhibited the cross-linking to the p46 subunit of eIF-4F or to additional eIF-4A or eIF-4B. In order to account for these observations, a two-step mechanism is proposed for the interaction of eIF-4F with the 5' end of an mRNA molecule. The first step involves a weak initial interaction of the p26 subunit with the cap. The second step requires the hydrolysis of ATP and results in the formation of a stable initiation factor-mRNA complex, which may involve eIF-4A and eIF-4B. This second step is inhibited by the presence of 5' proximal secondary structure. In any event, our results demonstrate that the effect of mRNA structure on translation rate depends strongly on its position with respect to the 5' end and that this effect is due at least in part to an inhibition of the action of initiation factors normally required for the unwinding of structure.
Assuntos
Biossíntese de Proteínas , RNA Mensageiro/metabolismo , DNA/análise , Fator de Iniciação 4F em Eucariotos , Globinas/genética , Metionina/metabolismo , Conformação de Ácido Nucleico , Hibridização de Ácido Nucleico , Fatores de Iniciação de Peptídeos/metabolismo , Reoviridae/genéticaRESUMO
The Ile repressor protein negatively controls expression from the ilv and thr promoters of Escherichia coli K12. Its existence was inferred from an analysis of the phenotypes of the ileR mutant avr-16 (Johnson, D. I., and Somerville, R. L. (1983) J. Bacteriol. 155, 49-55). The nucleotide sequence of ileR, the structural gene for Ile repressor, has been determined. A DNA segment of 300 base pairs constitutes the ileR gene. The predicted gene product, a protein of 100 amino acids (molecular weight 11,823) has primary structural features reminiscent of other double-stranded DNA-binding regulatory proteins. S1 nuclease mapping of the 5' terminus of ileR mRNA revealed two discrete species whose startpoints differed by approximately 47 nucleotides. The ileR gene, like other repressors for amino acid biosynthetic systems, is autogenously regulated at the transcriptional level. Within the ileR promoter region lie two 18-base pair segments of DNA bearing significant homology to putative operator targets also found within the thr and ilv promoters. A second open reading frame capable of specifying a protein of 83 amino acids, designated orf83, is transcribed divergently from the ileR gene. There are 202 base pairs separating the first codons of the two genes. S1 nuclease mapping of the 5' terminus of orf83 mRNA revealed two discrete species whose startpoints differed by approximately 27 nucleotides. The upstream promoters for ileR and orf83 overlap in their -35 regions.
Assuntos
Escherichia coli/genética , Proteínas Repressoras/genética , Fatores de Transcrição/genética , Sequência de Aminoácidos , Sequência de Bases , Mapeamento Cromossômico , Clonagem Molecular , Regulação da Expressão Gênica , Fenótipo , Plasmídeos , Transcrição GênicaRESUMO
Negative-ion fast atom bombardment mass spectrometry is quite useful for the identification of products and by-products formed during the synthesis of nucleoside 3'-phosphoramidites. The data show that detritylation and oxidation are side reactions which occur during the synthesis of monomeric units used in the construction of oligodeoxyribonucleotides by the phosphite triester method.
Assuntos
Amidas/análise , Espectrometria de Massas/métodos , Nucleotídeos/análise , Oligodesoxirribonucleotídeos/síntese química , Ácidos Fosfóricos/análise , Fenômenos Químicos , QuímicaRESUMO
In Salmonella typhimurium, expression of the leucine operon is regulated by a transcription attenuation mechanism. According to a current model of attenuation, elevated expression of this operon requires that a ribosome stall at one of four adjacent codons for leucine on a leader RNA. We used oligonucleotide-directed mutagenesis to convert the four leucine codons of the S. typhimurium leu leader to four threonine codons. Analysis of the resulting mutant operon showed that almost all regulation by leucine had been abolished. The mutant operon was, instead, partially derepressed by a limitation for charged threonine tRNA. These results provide direct evidence for the function for the four leucine codons postulated by the attenuator model. An unexpected observation made during these studies was that the wild-type leu operon was partially derepressed by starvation for threonine.
Assuntos
Códon , Leucina/genética , Mutação , RNA Mensageiro , Salmonella typhimurium/genética , Treonina/genética , Óperon , Aminoacil-RNA de Transferência/metabolismoRESUMO
Cysteine 84 was replaced by glycine in Serratia marcescens anthranilate synthase Component II using site-directed mutagenesis of cloned trpG. This replacement abolished the glutamine-dependent anthranilate synthase activity but not the NH3-dependent activity of the enzyme. The mutation provides further evidence for the role of active site cysteine 84 in the glutamine amide transfer function of anthranilate synthase Component II. By the criteria of circular dichroism, proteolytic inactivation, and feedback inhibition the mutant and wild type enzymes were structurally similar. The NH3-dependent anthranilate synthase activity of the mutant enzyme supported tryptophan synthesis in media containing a high concentration of ammonium ion.
Assuntos
Antranilato Sintase/metabolismo , Cisteína , Serratia marcescens/enzimologia , Sequência de Aminoácidos , Amônia/farmacologia , Antranilato Sintase/antagonistas & inibidores , Antranilato Sintase/genética , Sequência de Bases , Clonagem Molecular , DNA Bacteriano , Escherichia coli/genética , Glutamina/farmacologia , Mutação , Ácidos Nucleicos Heteroduplexes , Plasmídeos , Conformação Proteica , Serratia marcescens/genética , Relação Estrutura-AtividadeRESUMO
Two new protected 5'-ribonucleotides, 2'3'-O-bis(4,4'-dimethoxytrityl)uridine 5'-(4-chlorophenyl phosphate) and 2',3'-O-(methoxymethylene)uridine 5'-(4-chlorophenyl phosphate), form the basis of a chemical procedure for phosphorylating the 5'-ends of DNA fragments synthesized by the phosphotriester approach. Condensation of either of these mononucleotide units with the free 5'-hydroxyl of an otherwise fully protected oligomer results in high-yield formation of a 5'-5' triester linkage. Subsequently, the terminal ribonucleotide of the deprotected product rU5'-5'd(N-Nn-N) can be cleaved by periodate oxidation of its 2',3'-cis-hydroxyl system followed by beta-elimination, leaving its phosphate attached to the 5'-hydroxyl group of the oligodeoxyribonucleotide. This procedure together with a tactic employing a 2',3'-O-acylribonucleotide residue at the 3'-terminus of the chain allows the synthesis of oligomers possessing monophosphate groups at either end or both ends. Furthermore, oligonucleotide intermediates possessing a 5'-5'-linked uridine terminal are shown to have a special application as acceptors in RNA ligase reactions, where the presence of the ribonucleoside cap on the 5'-phosphate limits ligation specifically to the 3'-ends of the oligomers. Removal of the uridine residues to expose free 5'-phosphates would then enable the products to participate as donors in further elongation reactions.
Assuntos
Oligodesoxirribonucleotídeos/síntese química , Oligonucleotídeos/síntese química , Nucleotídeos de Uracila , Fenômenos Químicos , Química , Oxirredução , Fosfatos , Fosforilação , RNA Ligase (ATP) , UridinaRESUMO
A rapid and effective method for separating oligonucleotides using high-performance ion-exchange chromatography is described. Columns were prepared by adsorbing a layer of polyethylene imine on 5-micron-diameter porous silica followed by crosslinking with a multifunctional oxirane. This weak anion-exchange matrix was found to be useful in the separation of mononucleotides and oligonucleosides containing up to 20 residues in either homo- or heteropolymers. Small analytical columns (4.2 X 150 mm) had a capacity ranging from less than a microgram in analytical separations to several milligrams in the preparative mode. The columns have proven to be especially useful in assessing the purity of precursor blocks, monitoring the chemical synthesis of oligonucleotides, and isolating reaction products after the synthesis.
Assuntos
Oligonucleotídeos/isolamento & purificação , Fenômenos Químicos , Química , Cromatografia Líquida de Alta Pressão/métodos , Cromatografia por Troca Iônica/métodos , Polietilenoimina , Dióxido de SilícioRESUMO
An undecanucleotide extended hybridization probe has been used to screen a rat medullary thyroid carcinoma cDNA library for clones which contain preprosomatostatin sequences. The nucleotide sequence encoding rat preprosomatostatin is reported. The sequence of cDNA contains 67 nucleotides in the 3'-noncoding region, 84 nucleotides in the 5'-untranslated region, and 458 bases corresponding to the coding region. The mRNA codes for a somatostatin precursor 116 amino acids in length (Mr = 12,773). The preprosomatostatin has a sequence of hydrophobic amino acids at the NH2 terminus, followed by a peptide of approximately 78 residues, which precedes somatostatin-14. The amino acid sequences of rat and human preprosomatostatin (Shen, L. P., Pictet, R. L., and Rutter, W. J. (1982) Proc. Natl. Acad. Sci. U.S.A. 79, 4575-4579) differ by only 4 amino acid residues. Translation of rat poly(A) RNA in a rabbit reticulocyte cell-free system followed by immunoprecipitation with antisera directed against somatostatin-14 demonstrated the synthesis of a single protein having a molecular weight of 15,000. Two proteins having molecular weights of 14,000 and 15,000 are immunoprecipitated from a wheat germ cell-free translation mixture. Northern analysis of the somatostatin mRNA indicated that it is approximately 850 nucleotides in length. Analysis of several medullary thyroid carcinomas demonstrated that one tumor, designated WF, had immunoreactive somatostatin-14 in concentrations of 350 ng of somatostatin-14/mg of protein and somatostatin mRNA that represented 10% of the cellular poly(A) RNA. Cell lines derived from this tumor may provide an attractive system to investigate the regulation of somatostatin gene expression.
Assuntos
Clonagem Molecular , DNA/metabolismo , Precursores de Proteínas/genética , RNA Mensageiro/genética , Somatostatina/análogos & derivados , Neoplasias da Glândula Tireoide/metabolismo , Sequência de Aminoácidos , Animais , Sequência de Bases , Enzimas de Restrição do DNA , Peso Molecular , Neoplasias Experimentais/metabolismo , Hibridização de Ácido Nucleico , RNA Mensageiro/isolamento & purificação , Ratos , Somatostatina/genéticaRESUMO
Pancreatic poly(A) RNA isolated from the channel catfish (Ictalurus punctatus) was enriched for sequences corresponding to somatostatin mRNA on isokinetic sucrose gradients. Double-stranded cDNA was synthesized and inserted into the Pst I site pBR322 via the poly(dG) . poly(dC) tailing method. Escherichia coli was transformed with this DNA, and colonies containing somatostatin cDNA sequences were identified by hybridization using a primer-extended somatostatin cDNA. The somatostatin cDNA was obtained by extending a 5'-labeled undecanucleotide primer complementary to somatostatin mRNA with reverse transcriptase using catfish poly(A) RNA as a template. The synthetic primer d(T-T-C-C-A-G-A-A-G-A-A) was deduced from the amino acid sequence Phe-Phe-Trp-Lys present in somatostatin-14. Twenty positive colonies were obtained upon screening 2000 transformants. The restriction maps of the plasmid DNA obtained from the positive colonies were examined. Nineteen of these plasmids contained sequences corresponding to somatostatin-14, while one contained a sequence corresponding to somatostatin-22. The nucleotide sequence of pancreatic somatostatin-14 is reported here. The cDNA contains 350 nucleotides in the 3' noncoding region, 345 nucleotides in the coding region, and 104 nucleotides in the 5'-untranslated region. The mRNA codes for a precursor to somatostatin which is 114 amino acids in length. The preprosomatostatin has a sequence of hydrophobic amino acids at the NH2 terminus, followed by a connecting peptide of approximately 75 amino acids. The sequence Arg-Lys precedes somatostatin-14. Analysis of genomic DNA from the channel catfish reveals that somatostatin-14 and somatostatin-22 are present on different restriction fragments.
Assuntos
Clonagem Molecular , DNA , Pâncreas/metabolismo , RNA Mensageiro/genética , Somatostatina/genética , Sequência de Aminoácidos , Animais , Sequência de Bases , Escherichia coli/genética , Peixes , Hibridização de Ácido Nucleico , Poli A/genética , RNA/genéticaRESUMO
A synthetic oligonucleotide having the sequence d(T-T-C-C-A-G-A-A-G-A-A) deduced from the amino acid sequence Phe-Phe-Trp-Lys of somatostatin-14 was used to prime the synthesis of a cDNA from channel catfish (Ictalurus punctatus) pancreatic poly(A)-RNA. The major product of this reaction was a cDNA fragment of 565 nucleotides. Chemical sequence analysis of the cDNA fragment revealed that it was complementary to a mRNA coding for somatostatin. The 565-nucleotide cDNA hybridizes strongly with a poly(A)-RNA estimated to be 1000 nucleotides in length. An amino acid sequence of the somatostatin precursor was predicted from the nucleotide sequence. Oyama et al. [Oyama, H., Bradshaw, R. A., Bates, O. J. & Permutt, A. (1980) J. Biol. Chem. 255, 2251-2254] have reported the isolation of a somatostatin from the catfish that is 22 residues in length (somatostatin-22). This peptide differs from somatostatin-14 in amino acid sequence. The cDNA sequence obtained by this laboratory codes for somatostatin-14 and predicts another somatostatin gene product from this species. Thus it would appear that there are at least two somatostatin gene products.
Assuntos
Clonagem Molecular , DNA Recombinante , Pâncreas/metabolismo , Precursores de Proteínas/genética , Somatostatina/genética , Animais , Sequência de Bases , Peixes , Hibridização de Ácido Nucleico , Oligodesoxirribonucleotídeos , Poli A/genética , Poli A/isolamento & purificação , RNA/genética , RNA/isolamento & purificação , RNA Mensageiro/genéticaAssuntos
Oligodesoxirribonucleotídeos/genética , Oligonucleotídeos/genética , Prolactina/genética , RNA Mensageiro/genética , Transcrição Gênica , Sequência de Aminoácidos , Animais , Sequência de Bases , Clonagem Molecular , Feminino , Lactação , Adeno-Hipófise/metabolismo , Poli A/genética , Gravidez , Biossíntese de Proteínas , RNA/genética , Coelhos , Ratos , Reticulócitos/metabolismoRESUMO
A DNA sequence of 1041 base pairs from a BamHI fragment containing the E. coli trpR gene has been determined. With this sequence and other experimental evidence, the primary structure (88 amino acids) of the Trp repressor can be predicted. Additional features of the DNA sequences include a 22 base pair region upstream from the proposed structural gene which exhibits striking homology with the trp operator, thus implying that expression of the trpR gene may be under autogenous regulation.
Assuntos
Proteínas de Bactérias , DNA , Escherichia coli/metabolismo , Genes , Proteínas Repressoras/biossíntese , Fatores de Transcrição/biossíntese , Sequência de Aminoácidos , Composição de Bases , Sequência de Bases , Clonagem Molecular , DNA/metabolismo , Código Genético , Biossíntese de Proteínas , Transcrição GênicaRESUMO
Suitably protected ribonucleotide and ribonucleoside derivatives have been employed as versatile intermediates in both oligoribo- and oligodeoxyribonucleotide synthesis by the phosphotriester method. Thus, the barium salt of 5'-O-dimethoxytrityl-2'-O-(o-nitrobenzyl) uridine-3' p-chlorophenyl-phosphate was used to prepare U-U-U as one example of a procedure that has general applicability in the construction of oligoribonucleotides. In addition, ribonucleosides like N4,O2',O3'-tribenzoylcytidine, and ribonucleotides such as the 2',3'-O-bis(dimethoxytrityl) and 2',3'-O-methoxymethylidene derivatives of uridine-5' p-chlorophenyl phosphate, provide a convenient means of introducing 3'- and/or 5'-terminal phosphate residues into oligonucleotides at the phosphotriester level.
Assuntos
Oligodesoxirribonucleotídeos/síntese química , Oligonucleotídeos/síntese química , Oligorribonucleotídeos/síntese química , Ribonucleosídeos , Ribonucleotídeos , Indicadores e Reagentes , MétodosRESUMO
A new experimental approach to the synthesis of polydeoxyribonucleotides via the phosphotriester method involves construction of oligonucleotide blocks by direct use of the easily prepared barium salts of O5',N-protected deoxyribonucleoside-3' p-chlorophenyl phosphates as the key monomers in condensation reactions. The procedure has been demonstrated by the rapid synthesis in high yield and purity of all sixteen fuly protected dinucleotides (Formula: see text) (where dN' = dT, dbzC, dbzA, or dibG; (Formula: see text) This set of molecules constitutes a "syllabary" for the preparation of defined sequence oligonucleotides.
Assuntos
Desoxirribonucleotídeos , Oligodesoxirribonucleotídeos/síntese química , Oligonucleotídeos/síntese química , Bário , Métodos , Polidesoxirribonucleotídeos/síntese químicaRESUMO
Several modifications have been incorporated into the phosphotriester strategy for chemical synthesis of oligodeoxyribonucleotides. These include high-yield methods of preparation and isolation of O5', N-protected deoxyribonucleoside-3' p-chlorophenyl phosphates which serve as key intermediates, and the elimination of some superfluous manipulation and purification steps commonly used in the process of synthesizing oligonucleotide blocks. In addition, two new arylsulfonyl nitroimidazole derivatives have been prepared and found to be highly effective agents for internucleotide bond formation. These techniques have been applied in construction of the iconsamer d(G-C-C-A-T-T-T-T-A-C-C-A-T-T-C-A-C-C-A)-rC, equivalent to a ribonucleotide sequence located at both the 5' and 3' ends of Rous sarcoma virus 35S RNA.
Assuntos
Vírus do Sarcoma Aviário/análise , Oligonucleotídeos/síntese química , Oligorribonucleotídeos/síntese química , RNA Viral , Sequência de Bases , Indicadores e Reagentes , Métodos , Peso MolecularRESUMO
A sequence of 20 nucleotide residues immediately adjacent to the 3'-terminal poly(A) in Rous sarcoma virus (Prague strain, subgroup C) 35S RNA has been determined by extension of a riboguanylic acid-terminated oligothymidylic acid primer hybridized at the 5' end of the 3'-terminal poly(A) with purified reverse transcriptase (RNA-directed DNA polymerase; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC 2.7.7.7) from avian myeloblastosis virus. The sequence is 5'GCCAUUUUACCAUUCACCACpoly(A)3'. This same nucleotide sequence, excluding the poly(A) segment, has also been found at the 5' terminus of Rous sarcoma virus RNA (W. A. Haseltine, A. Maxam, and W. Gilbert, this issue pp. 989-993), and therefore the RNA genome of this virus is terminally redundant. Possible mechanisms for endogenous in vitro copying of the complete RNA genome by reverse transcriptase which involve terminally repeated nucleotide sequences are discussed.
Assuntos
Vírus do Sarcoma Aviário/análise , RNA Viral/análise , Sequência de Bases , Poli A , DNA Polimerase Dirigida por RNA/metabolismoRESUMO
A decadeoxynucleotide complementary to ten nucleotides in the major ribosome-protected fragment of phiX-174 plus-strand DNA has been chemically synthesized and used as a primer for DNA polymerase I on phiX-174 plus-strand DNA as template. The sequence of the first 40 nucleotides incorporated onto the decadeoxynucleotide has been determined. This sequence extends further the sequence of the intercistronic region preceding gene G and shows the presence of another termination codon. The sequence was determined by using manganese as the activating cation for DNA polymerase I which allows ribonucleotides to be incorporated as well as deoxyribonucleotides. The ribo-substituted product was then cleaved specifically at the ribonucleotide residues to generate a series of overlapping ribo-terminated fragments whose sequences were sufficient to determine the complete sequence of the first 40 nucleotides. No evidence for misincorporation by DNA polymerase I in the presence of manganese was detected.