RESUMO
Tris(2-chloroethyl) phosphate (TCEP), a chlorinated organophosphate ester, is commonly found in aquatic environments. Due to its various toxic effects, it may pose a risk to the health of aquatic organisms. However, the potential impacts of TCEP exposure on the intestinal microbiota and hepatic function in amphibians have not been reported. This study investigated the impact of long-term exposure to environmentally relevant concentrations of TCEP (0, 3, and 90 µg/L) on the intestinal microbiota and hepatic transcriptome of Polypedates megacephalus tadpoles. The results showed that the body size of the tadpoles decreased significantly with an increase in TCEP concentration. Additionally, TCEP exposure affected the diversity and composition of the intestinal microbiota in tadpoles, leading to significant changes in the relative abundance of certain bacterial groups (the genera Aeromonas decreased and Citrobacter increased) and potentially promoting a more even distribution of microbial species, as indicated by a significant increase in the Simpson index. Moreover, the impact of TCEP on hepatic gene expression profiles in tadpoles was significant, with the majority of differentially expressed genes (DEGs) (709 out of 906 total DEGs in 3 µg/L of TCEP versus control, and 344 out of 387 DEGs in 90 µg/L of TCEP versus control) being significantly down-regulated, which were primarily related to immune response and immune system process. Notably, exposure to TCEP significantly reduced the relative abundance of the genera Aeromonas and Cetobacterium in the tadpole intestine. This reduction was positively correlated with the down-regulated expression of immune-related genes in the liver of corresponding tadpoles. In summary, these findings provide empirical evidence of the potential health risks to tadpoles exposed to TCEP at environmentally relevant concentrations.
RESUMO
Lightweight and robust aerogels with multifunctionality are highly desirable to meet the technological demands of current society. Herein, we designed lightweight, elastic, and superhydrophobic multifunctional organic-inorganic fibrous hybrid aerogels which were assembled with organic aramid nanofibers and inorganic hierarchical porous carbon fibers. Thanks to the organic-inorganic fiber hybridization strategy, the optimal aerogels possessed remarkable compressibility and elasticity. Benefiting from the microscopic hierarchical porous structure of carbon fibers and the macroscopic macroporous lamellar structure of aerogels, the optimal aerogels exhibited superb lightweight property, conspicuous electromagnetic microwave absorption ability, and outstanding oily wastewater purification capacity. As for electromagnetic microwave absorption, it achieved a strong reflection loss of -41.8 dB, and the effective absorption bandwidth reached 6.86 GHz. Besides, the oil adsorption capacity for trichloromethane reached as high as 93.167 g g-1 with a capacity retention of 95.6% after 5 cycles. Meanwhile, it could act as a gravity-driven separation membrane to continuously separate trichloromethane from a trichloromethane-water mixture with a high flux of 7867.37 L·m-2·h-1, even for surfactant-stabilized water-in-n-heptane emulsions of 3794.94 L·m-2·h-1. Such a strategy might shed some light on the construction of multifunctional aerogels toward broader applications.
RESUMO
Tris(2-chloroethyl) phosphate (TCEP) and tris(1-chloro-2-propyl) phosphate (TCPP) are common chlorinated organophosphorus flame retardants (OPFRs) used in industry. They have been frequently detected together in aquatic environments and associated with various hazardous effects. However, the ecological risks of prolonged exposure to these OPFRs at environmentally relevant concentrations in non-model aquatic organisms remain unexplored. This study investigated the effects of long-term exposure (up to 25 days) to TCEP and TCPP on metamorphosis, hepatic antioxidants, and endocrine function in Polypedates megacephalus tadpoles. Exposure concentrations were set at 3, 30, and 90 µg/L for each substance, conducted independently and in equal-concentration combinations, with a control group included for comparison. The integrated biomarker response (IBR) method developed an optimal linear model for predicting the overall ecological risks of TCEP and TCPP to tadpoles in potential distribution areas of Polypedates species. Results showed that: (1) Exposure to environmentally relevant concentrations of TCEP and TCPP elicited variable adverse effects on tadpole metamorphosis time, hepatic antioxidant enzyme activity and related gene expression, and endocrine-related gene expression, with their combined exposure exacerbating these effects. (2) The IBR value of TCEP was consistently greater than that of TCPP at each concentration, with an additive effect observed under their combined exposure. (3) The ecological risk of tadpoles exposed to the combined presence of TCEP and TCPP was highest in China's Taihu Lake and Vietnam's Hanoi than in other distribution locations. In summary, prolonged exposure to environmentally relevant concentrations of TCEP and TCPP presents potential ecological risks to amphibian tadpoles, offering insights for the development of policies and strategies to control TCEP and TCPP pollution in aquatic ecosystems. Furthermore, the methodology employed in establishing the IBR prediction model provides a methodological framework for assessing the overall ecological risks of multiple OPFRs.
RESUMO
The introduction of single-atom catalysts (SACs) into Fenton-like oxidation promises ultrafast water pollutant elimination, but the limited access to pollutants and oxidant by surface catalytic sites and the intensive oxidant consumption still severely restrict the decontamination performance. While nanoconfinement of SACs allows drastically enhanced decontamination reaction kinetics, the detailed regulatory mechanisms remain elusive. Here, we unveil that, apart from local enrichment of reactants, the catalytic pathway shift is also an important cause for the reactivity enhancement of nanoconfined SACs. The surface electronic structure of cobalt site is altered by confining it within the nanopores of mesostructured silica particles, which triggers a fundamental transition from singlet oxygen to electron transfer pathway for 4-chlorophenol oxidation. The changed pathway and accelerated interfacial mass transfer render the nanoconfined system up to 34.7-fold higher pollutant degradation rate and drastically raised peroxymonosulfate utilization efficiency (from 61.8% to 96.6%) relative to the unconfined control. It also demonstrates superior reactivity for the degradation of other electron-rich phenolic compounds, good environment robustness, and high stability for treating real lake water. Our findings deepen the knowledge of nanoconfined catalysis and may inspire innovations in low-carbon water purification technologies and other heterogeneous catalytic applications.
RESUMO
Urolithin A (UroA), a dietary phytochemical, is produced by gut bacteria from fruits rich in natural polyphenols ellagitannins (ETs). The efficiency of ETs metabolism to UroA in humans depends on gut microbiota. UroA has shown a variety of pharmacological activities. In this study we investigated the effects of UroA on atherosclerotic lesion development and stability. Apolipoprotein E-deficient (ApoE-/-) mice were fed a high-fat and high-cholesterol diet for 3 months to establish atherosclerosis model. Meanwhile the mice were administered UroA (50 mg·kg-1·d-1, i.g.). We showed that UroA administration significantly decreased diet-induced atherosclerotic lesions in brachiocephalic arteries, macrophage content in plaques, expression of endothelial adhesion molecules, intraplaque hemorrhage and size of necrotic core, while increased the expression of smooth muscle actin and the thickness of fibrous cap, implying features of plaque stabilization. The underlying mechanisms were elucidated using TNF-α-stimulated human endothelial cells. Pretreatment with UroA (10, 25, 50 µM) dose-dependently inhibited TNF-α-induced endothelial cell activation and monocyte adhesion. However, the anti-inflammatory effects of UroA in TNF-α-stimulated human umbilical vein endothelial cells (HUVECs) were independent of NF-κB p65 pathway. We conducted RNA-sequencing profiling analysis to identify the differential expression of genes (DEGs) associated with vascular function, inflammatory responses, cell adhesion and thrombosis in UroA-pretreated HUVECs. Human disease enrichment analysis revealed that the DEGs were significantly correlated with cardiovascular diseases. We demonstrated that UroA pretreatment mitigated endothelial inflammation by promoting NO production and decreasing YAP/TAZ protein expression and TEAD transcriptional activity in TNF-α-stimulated HUVECs. On the other hand, we found that UroA administration modulated the transcription and cleavage of lipogenic transcription factors SREBP1/2 in the liver to ameliorate cholesterol metabolism in ApoE-/- mice. This study provides an experimental basis for new dietary therapeutic option to prevent atherosclerosis.
RESUMO
Background: Serum carbohydrate antigen 50 (CA50) is an auxiliary diagnostic marker for various solid tumors, but it remains unclear whether CA50 in pleural fluid can assist in the diagnosis of malignant pleural effusion (MPE). This study aimed to evaluate the diagnostic accuracy of pleural fluid CA50 for MPE in pleural effusion patients with undetermined causes. Methods: This study prospectively recruited pleural effusion patients with undetermined causes who visited the Affiliated Hospital of Inner Mongolia Medical University between September 2018 and July 2021. We measured pleural fluid CA50 level with an electrochemiluminescence assay. We analyzed the diagnostic accuracy of CA50 and carcinoembryonic antigen (CEA) for MPE with the receiver operating characteristic (ROC) curve. The net benefits of CA50 and CEA were analyzed using the decision curve analysis (DCA). Results: We enrolled 66 MPEs and 87 benign pleural effusions (BPEs). MPE patients had significantly higher CA50 and CEA than BPE patients. The area under the ROC curve (AUC) of CA50 was 0.72 (95% CI: 0.63-0.80). CA50 had a sensitivity of 0.30 (95% CI: 0.19-0.41) and a specificity of 1.00 (95% CI: 1.00-1.00) at the threshold of 15 IU/mL. The decision curve of CA50 was above the reference line at the calculated risk probability of between 0.30 and 1.00. Venn diagram indicated that some patients with low CEA (<50 or <150 ng/mL) and/or negative cytology can be identified by positive CA50 (>15 IU/mL). Conclusions: Pleural fluid CA50 has moderate accuracy and net benefit for detecting MPE. CA50 >15 IU/mL can be used to diagnose MPE. The combination of CA50 and CEA improves the diagnostic sensitivity for MPE.
RESUMO
BACKGROUND: Accumulating evidence has shown that the NOD-like receptor protein 3 (NLRP3) inflammasome plays a crucial role in the inflammatory cascades involved in the development of acute pancreatitis (AP). However, the specific agonist responsible for activating the NLRP3 inflammasome in this process has not yet been identified. The purpose of this study is to clarify whether heparan sulfate (HS) works as an NLRP3 inflammasome activator to evoke inflammatory cascades in the progression of AP. METHODS: Two experimental mouse models of AP were utilized to investigate the pro-inflammatory activity of HS in the development of AP by measuring the secretion of inflammatory cytokines and the neutrophil infiltration in pancreatic tissue. The ability of HS to activate the NLRP3 inflammasome was evaluated both in vitro and in vivo. The nuclear factor kappa B (NF-κB)-mediated expression of NLRP3 inflammasome components in response to HS treatment was determined to decipher the role of HS in transcriptional priming of NLRP3 inflammasome. Furthermore, HS-triggered deubiquitination of NLRP3 was analyzed to reveal the promoting effect of HS on the NLRP3 inflammasome priming via a non-transcriptional pathway. RESULTS: High plasma level of HS was observed with a positive correlation to that of inflammatory cytokines in AP mice. Administration of HS to mice resulted in an exacerbated inflammatory profile, while reducing HS production by an inhibitor of heparanase significantly attenuated inflammatory response. Pharmacological inhibition or genetic deletion of NLRP3 substantially suppressed the HS-stimulated elevation of IL-1ß levels in AP mice. The in vitro data demonstrated that HS primarily serves as a priming signal for the activation of the NLRP3 inflammasome. HS possesses the ability to increase the transcriptional activity of NF-κB and TLR4/NF-κB-driven transcriptional pathway is employed for NLRP3 inflammasome priming. Moreover, HS-induced deubiquitination of NLRP3 is another pathway responsible for non-transcriptional priming of NLRP3 inflammasome. CONCLUSIONS: Our current work has unveiled HS as a new activator of the NLRP3 inflammasome responsible for the secondary inflammatory cascades during the development of AP, highlighting the HS-NLRP3 pathway as a potential target for future preventive and therapeutic approaches of AP.
RESUMO
BACKGROUND: Knee osteoarthritis (KOA) is a chronic musculoskeletal disorder characterized by pain and functional impairment. Blood flow restriction (BFR) with low-load resistance training (LLRT) demonstrates a similar improvement in clinical outcomes to high-load resistance training (HLRT) in treating KOA. It has not been established whether intermittent blood flow restriction (iBFR) with LLRT can lead to clinical outcomes that are comparable to those produced by continuous blood flow restriction (cBFR) with LLRT and HLRT. The aim of the proposed study is to evaluate the efficacy of iBFR with LLRT on pain, Western Ontario and McMaster Universities Osteoarthritis Index (WOMAC), muscle strength, muscle mass, physical function, perceptions of discomfort and effort, and adherence in KOA patients. METHODS: This is a three-arm, non-inferiority, randomized controlled trial utilizing blinded assessors. Two hundred thirteen participants will be randomly allocated to one of the following three groups: iBFR group-receiving 4 months of LLRT with iBFR, twice weekly (n = 71); cBFR group-receiving 4 months of LLRT with cBFR, twice weekly (n = 71); or HLRT group-receiving 4 months of HLRT without BFR, twice weekly (n = 71). The primary outcome is pain. The secondary outcomes include the WOMAC, muscle strength, muscle mass, physical function, perceptions of discomfort and effort, and adherence. Pain and WOMAC will be measured at the baseline and 4 and 12 months after randomizations. Muscle strength, muscle mass, and physical function will be measured at the baseline and 4 months after randomizations. The perceptions of discomfort and effort will be measured during the first and final sessions. DISCUSSION: BFR with LLRT has a similar improvement in clinical outcomes as HLRT. However, cBFR may cause elevated ratings of perceived exertion and local discomfort, compromising patient tolerability and treatment adherence. If iBFR with LLRT could produce improvement in clinical outcomes analogous to those of HLRT and iBFR with LLRT, it could be considered an alternative approach for treating patients with KOA. TRIAL REGISTRATION: Chinese Clinical Trial Registry ChiCTR2300072820. Registered on June 26, 2023.
Assuntos
Terapia de Restrição de Fluxo Sanguíneo , Força Muscular , Osteoartrite do Joelho , Treinamento Resistido , Humanos , Treinamento Resistido/métodos , Osteoartrite do Joelho/fisiopatologia , Osteoartrite do Joelho/terapia , Idoso , Resultado do Tratamento , Terapia de Restrição de Fluxo Sanguíneo/métodos , Feminino , Masculino , Pessoa de Meia-Idade , Estudos de Equivalência como Asunto , Medição da Dor , Fluxo Sanguíneo Regional , Ensaios Clínicos Controlados Aleatórios como Assunto , Recuperação de Função Fisiológica , Fatores de Tempo , Articulação do Joelho/fisiopatologiaRESUMO
BACKGROUND: The comparative effectiveness of volatile anaesthesia and total intravenous anaesthesia (TIVA) in terms of patient outcomes after cardiac surgery remains a topic of debate. METHODS: Multicentre randomised trial in 16 tertiary hospitals in China. Adult patients undergoing elective cardiac surgery were randomised in a 1:1 ratio to receive volatile anaesthesia (sevoflurane or desflurane) or propofol-based TIVA. The primary outcome was a composite of predefined major complications during hospitalisation and mortality 30 days after surgery. RESULTS: Of the 3123 randomised patients, 3083 (98.7%; mean age 55 yr; 1419 [46.0%] women) were included in the modified intention-to-treat analysis. The composite primary outcome was met by a similar number of patients in both groups (volatile group: 517 of 1531 (33.8%) patients vs TIVA group: 515 of 1552 (33.2%) patients; relative risk 1.02 [0.92-1.12]; P=0.76; adjusted odds ratio 1.05 [0.90-1.22]; P=0.57). Secondary outcomes including 6-month and 1-yr mortality, duration of mechanical ventilation, length of ICU and hospital stay, and healthcare costs, were also similar for the two groups. CONCLUSIONS: Among adults undergoing cardiac surgery, we found no difference in the clinical effectiveness of volatile anaesthesia and propofol-based TIVA. CLINICAL TRIAL REGISTRATION: Chinese Clinical Trial Registry (ChiCTR-IOR-17013578).
RESUMO
Drought is one of the natural stresses that greatly impact plants. Castor bean (Ricinus communis L.) is an oil crop with high economic value. Drought is one of the factors limiting castor bean growth. The drought resistance mechanisms of castor bean have become a research focus. In this study, we used castor germinating embryos as experimental materials, and screened genes related to drought resistance through physiological measurements, proteomics and metabolomics joint analysis; castor drought-related genes were subjected to transient silencing expression analysis in castor leaves to validate their drought-resistant functions, and heterologous overexpression and backward complementary expression in Arabidopsis thaliana, and analysed the mechanism of the genes' response to the participation of Arabidopsis thaliana in drought-resistance.Three drought tolerance-related genes, RcECP 63, RcDDX 31 and RcA/HD1, were obtained by screening and analysis, and transient silencing of expression in castor leaves further verified that these three genes corresponded to drought stress, and heterologous overexpression and back-complementary expression of the three genes in Arabidopsis thaliana revealed that the function of these three genes in drought stress response.In this study, three drought tolerance related genes, RcECP 63, RcDDX 31 and RcA/HD1, were screened and analysed for gene function, which were found to be responsive to drought stress and to function in drought stress, laying the foundation for the study of drought tolerance mechanism in castor bean.
Assuntos
Arabidopsis , Secas , Ricinus communis , Sementes , Ricinus communis/genética , Ricinus communis/fisiologia , Sementes/genética , Sementes/fisiologia , Sementes/crescimento & desenvolvimento , Arabidopsis/genética , Arabidopsis/fisiologia , Genes de Plantas , Proteínas de Plantas/genética , Proteínas de Plantas/metabolismo , Regulação da Expressão Gênica de Plantas , Estresse Fisiológico/genética , Resistência à SecaRESUMO
Tris(2-chloroethyl) phosphate (TCEP) and tris(1chloro-2-propyl) phosphate (TCPP) are widely used as chlorinated organophosphate flame retardants (OPFRs) due to their fire-resistance capabilities. However, their extensive use has led to their permeation and pollution in aquatic environments. Using amphibians, which are non-model organisms, to test the toxic effects of OPFRs is relatively uncommon. This study examined the acute and chronic toxicity differences between TCEP and TCPP on Polypedates megacephalus tadpoles and evaluated the potential ecological risks to tadpoles in different aquatic environments using the risk quotient (RQ). In acute toxicity assay, the tadpole survival rates decreased with increased exposure time and concentrations, with TCEP exhibiting higher LC50 values than TCPP, at 305.5 mg/L and 70 mg/L, respectively. In the chronic assay, prolonged exposure to 300 µg/L of both substances resulted in similar adverse effects on tadpole growth, metamorphosis, and hepatic antioxidant function. Based on RQ values, most aquatic environments did not pose an ecological risk to tadpoles. However, the analysis showed that wastewater presented higher risks than rivers and drinking water, and TCPP posed a higher potential risk than TCEP in all examined aquatic environments. These findings provide empirical evidence to comprehend the toxicological effects of OPFRs on aquatic organisms and to assess the safety of aquatic environments.
Assuntos
Anuros , Retardadores de Chama , Larva , Organofosfatos , Compostos Organofosforados , Poluentes Químicos da Água , Animais , Retardadores de Chama/toxicidade , Larva/efeitos dos fármacos , Larva/crescimento & desenvolvimento , Poluentes Químicos da Água/toxicidade , Compostos Organofosforados/toxicidade , Medição de Risco , Organofosfatos/toxicidade , Anuros/crescimento & desenvolvimento , Metamorfose Biológica/efeitos dos fármacos , Testes de Toxicidade Aguda , Dose Letal MedianaRESUMO
INTRODUCTION: Severe septic cardiomyopathy (SCM) is one of the main causes of refractory septic shock (RSS), with a high mortality. The application of venoarterial extracorporeal membrane oxygenation (ECMO) to support the impaired cardiac function in patients with septic shock remains controversial. Moreover, no prospective studies have been taken to address whether venoarterial ECMO treatment could improve the outcome of patients with sepsis-induced cardiogenic shock. The objective of this study is to assess whether venoarterial ECMO treatment can improve the 30-day survival rate of patients with sepsis-induced refractory cardiogenic shock. METHODS AND ANALYSIS: ExtraCorporeal Membrane Oxygenation in the therapy for REfractory Septic shock with Cardiac function Under Estimated is a prospective, multicentre, non-randomised, cohort study on the application of ECMO in SCM. At least 64 patients with SCM and RSS will be enrolled in an estimated ratio of 1:1.5. Participants taking venoarterial ECMO during the period of study are referred to as cohort 1, and patients receiving only conventional therapy without ECMO belong to cohort 2. The primary outcome is survival in a 30-day follow-up period. Other end points include survival to intensive care unit (ICU) discharge, hospital survival, 6-month survival, quality of life for long-term survival (EQ-5D score), successful rate of ECMO weaning, long-term survivors' cardiac function, the number of days alive without continuous renal replacement therapy, mechanical ventilation and vasopressor, ICU and hospital length of stay, the rate of complications potentially related to ECMO treatment. ETHICS AND DISSEMINATION: The trial has been approved by the Clinical Research and Application Institutional Review Board of the Second Affiliated Hospital of Guangzhou Medical University (2020-hs-51). Participants will be screened and enrolled from ICU patients with septic shock by clinicians, with no public advertisement for recruitment. Results will be disseminated in research journals and through conference presentations. TRIAL REGISTRATION NUMBER: NCT05184296.
Assuntos
Oxigenação por Membrana Extracorpórea , Choque Cardiogênico , Choque Séptico , Oxigenação por Membrana Extracorpórea/métodos , Humanos , Choque Séptico/terapia , Choque Séptico/mortalidade , Choque Séptico/complicações , Estudos Prospectivos , Choque Cardiogênico/terapia , Choque Cardiogênico/mortalidade , Cardiomiopatias/terapia , Estudos Multicêntricos como Assunto , Masculino , Unidades de Terapia Intensiva , Feminino , Adulto , Taxa de SobrevidaRESUMO
The stationary phase is the heart of chromatographic separation technology and a critical contributor to the overall separation performance of a chromatographic separation technique. However, traditional silicon-based materials designed for this purpose usually feature complex preparation processes, suboptimal permeability, pronounced mass-transfer resistance, and limited pH-range compatibility. These limitations have spurred ongoing research efforts aimed at developing new chromatographic stationary phases characterized by higher separation efficiency, adaptable selectivity, and a broader scope of applicability. In this context, the scientific community has made significant strides toward the development of new-generation materials suitable for use as chromatographic stationary phases. These materials include carbon-based nanomaterial arrays, carbon quantum dots, and two-dimensional (2D) materials. 2D-materials are characterized by nanometer-scale thicknesses, extensive specific surface areas, distinctive layered structures, and outstanding mechanical properties under standard conditions. Thus, these materials demonstrate excellent utility in various applications, such as electrical and thermal conductivity enhancements, gas storage and separation solutions, membrane separation technologies, and catalysis. Graphene, which is arguably the most popular 2D-material used for chromatographic separation, consists of a 2D-lattice of carbon atoms arranged in a single layer, with a large specific surface area and efficient adsorption properties. Its widespread adoption in research and various industries is a testament to its versatility and effectiveness. In addition to graphene, the scientific community has developed various 2D-materials that mirror the layered structures of graphene, such as boron nitride, transition-metal sulfides, and 2D porous organic frameworks, all of which offer unique advantages. 2D porous organic frameworks, in particular, have received attention because of their nanosheet morphology, one-dimensional pores, and special interlayer forces; thus, these frameworks are considered promising candidate chromatographic stationary phase materials. Such recognition is especially true for 2D-metal organic frameworks (MOFs) and 2D-covalent organic frameworks (COFs), which exhibit low densities, high porosities, and substantial specific surface areas. The modifiability of these materials, in terms of pore size, shape, functional groups, and layer-stacking arrangements allows for excellent separation selectivity, highlighting their promising potential in chromatographic separation. Compared with their three-dimensional counterparts, 2D-MOFs feature a simple pore structure that offers reduced mass-transfer resistance and enhanced column efficiency. These attributes highlight the advantages of 2D-MOF nanosheets as chromatographic stationary phases. Similarly, 2D-COFs, given their high specific surface area and porosity, not only exhibit great thermal stability and chemical tolerance but also support a wide selection of solvents and operational conditions. Therefore, their role in the preparation of chromatographic stationary phases is considered highly promising. This review discusses the latest research developments in 2D porous organic framework materials in the context of gas- and liquid-chromatographic stationary phases. It introduces the synthesis methods for these novel materials, elucidates their retention mechanisms, and describes the applications of other 2D-materials, such as graphene, its derivatives, graphitic carbon nitride, and boron nitride, in chromatography. This review aims to shed light on the promising development prospects and future directions of 2D-materials in the field of chromatographic separation, offering valuable insights into the rational design and application of new 2D-materials in chromatography.
RESUMO
This study developed a rapid, accurate, objective and economic method to identify and evaluate the quality of Alismatis Rhizoma (AR) commodities. Traditionally, the identification of plant species and geographical origins of AR commodities mainly relied on experienced staff. However, the subjectivity and inaccuracy of human identification negatively impacted the trade of AR. Besides, liquid chromatographic methods such as ultra-high-performance liquid chromatography (UPLC) and high-performance liquid chromatography (HPLC), the major approach for the determination of triterpenoid contents in AR was time-consuming, expensive, and highly demanded in manoeuvre specialists. In this study, the combination of near-infrared (NIR) spectroscopy and chemometrics as the method was developed and utilised to address the two common issues of identifying the quality of AR commodities. Through the discriminant analysis (DA), the raw NIR spectroscopy data on 119 batches samples from two species and four origins in China were processed to the best pre-processed data. Subsequently, orthogonal partial least squares-discriminant analysis (OPLS-DA) and random forest (RF) as the major chemometrics were used to analyse the best pre-processed data. The accuracy rates by OPLS-DA and RF were respectively 100% and 97.2% for the two species of AR, and respectively100% and 94.4% for the four origins of AR. Meanwhile, a quantitative correction model was established to rapidly and economically predict the seven triterpenoid contents of AR through combining the partial least squares (PLS) method and NIR spectroscopy, and taking the triterpenoid contents measured by UPLC as the reference value, and carry out spectral pre-processing methods and band selection. The final quantitative model correlation coefficients of the seven triterpenoid contents of AR ranged from 0.9000 to 0.9999, indicating that prediction ability of this model had good stability and applicability.
RESUMO
BACKGROUND: Intronic GAA repeat expansion ([GAA] ≥250) in FGF14 is associated with the late-onset neurodegenerative disorder, spinocerebellar ataxia 27B (SCA27B, GAA-FGF14 ataxia). We aim to determine the prevalence of the GAA repeat expansion in FGF14 in Chinese populations presenting late-onset cerebellar ataxia (LOCA) and evaluate the characteristics of tandem repeat inheritance, radiological features and sympathetic nerve involvement. METHODS: GAA-FGF14 repeat expansion was screened in an undiagnosed LOCA cohort (n = 664) and variations in repeat-length were analyzed in families of confirmed GAA-FGF14 ataxia patients. Brain magnetic resonance imaging (MRI) was used to evaluate the radiological feature in GAA-FGF14 ataxia patients. Clinical examinations and sympathetic skin response (SSR) recordings in GAA-FGF14 patients (n = 16) were used to quantify sympathetic nerve involvement. RESULTS: Two unrelated probands (2/664) were identified. Genetic screening for GAA-FGF14 repeat expansion was performed in 39 family members, 16 of whom were genetically diagnosed with GAA-FGF14 ataxia. Familial screening revealed expansion of GAA repeats in maternal transmissions, but contraction upon paternal transmission. Brain MRI showed slight to moderate cerebellar atrophy. SSR amplitude was lower in GAA-FGF14 patients in pre-symptomatic stage compared to healthy controls, and further decreased in the symptomatic stage. CONCLUSIONS: GAA-FGF14 ataxia was rare among Chinese LOCA cases. Parental gender appears to affect variability in GAA repeat number between generations. Reduced SSR amplitude is a prominent feature in GAA-FGF14 patients, even in the pre-symptomatic stage.
RESUMO
In the current study, bioinformatics analysis of the hepatocellular carcinoma (HCC) dataset was conducted with the hepatoprotective effect of the Fuzheng Huayu (FZHY) capsule against the diethylnitrosamine-induced HCC progression analyzed. Eight cell clusters were defined and tanshinone IIA, arachidonic acid, and quercetin, compounds of the FZHY capsule, inhibit HCC progression-related fibrosis by regulating the expression of PLAU and IGFBP3. Combined with the ameliorative effect of the FZHY capsule against liver dysfunctions and expression of PLAU and IGFBP3, our study confirmed the effect of the FZHY capsule on inhibiting the fibrosis-associated HCC progression via regulating the expression of PLAU and IGFBP3.
RESUMO
Engraftment syndrome (ES) is one of the most common complications in the early phase after autologous hematopoietic stem cell transplantation (ASCT), and we aimed to evaluate the incidence and risk factors for ES patients receiving ASCT in the era of plerixafor-based mobilization. A total of 294 were enrolled, and 16.0% (n = 47) experienced ES after ASCT. The main clinical manifestations were fever (100%), diarrhea (78.7%), skin rash (23.4%), and hypoxemia/pulmonary edema (12.8%). Plerixafor-based mobilization was associated with higher counts of CD3+ cells, CD4+ cells, and CD8+ cells in grafts. In univariate analysis of the total cohort, age ≥60 years, receiving ASCT at complete remission (CR), higher number of mononuclear cell (MNC), CD3+ cell counts, CD4+ cells as well as CD8+ cells transfused and plerixafor-based mobilization were associated with ES after ASCT. Multivariate analysis showed that age ≥60 years (P = .0014), receiving ASCT at CR (P = .002), and higher number of MNC transfused (P = .026) were associated with ES in total cohort. In plasma cell disease subgroup, age ≥60 years (P = .013), plerixafor-based mobilization (P = .036), and receiving ASCT at CR (P = .002) were associated with ES. Patients with more risk factors had a higher risk of ES. The 1-year probabilities of relapse, non-relapse mortality, and survival were comparable between patients with and without ES. Thus, plerixafor-based mobilization may influence the composition of T lymphocytes in grafts and increase the risk of ES, particularly in patients with plasma cell disease.
RESUMO
We aimed to identify the severity and duration of COVID-19 infection on complications after allo-HSCT. Enrolled 179 hospitalized patients with COVID-19 were categorized into long-term infection (> 18 days, n = 90) or short-term infection group (≤ 18 days, n = 89) according to the median duration of COVID-19. The severity of COVID-19 was categorized as asymptomatic infection, mild, moderate, severe, and critical illness according to guidelines of National Institutes of Health. Particularly, severe illness and critical illness were classified as serious infection. Asymptomatic infection, mild illness and moderate illness were classified as non-serious infection. The 150-day probabilities of poor graft function (PGF), cytomegalovirus (CMV) pneumonia and non-relapse mortality (NRM) were significantly higher in long-term infection group. The 150-day probabilities of CMV pneumonia and NRM after COVID-19 were higher in serious infection group. The 150-day probabilities of overall survival (OS) was significantly lower in long-term and serious infection group. In multivariable analysis, the severity of COVID-19 was associated with NRM and OS, and the duration of COVID-19 was associated with PGF. In summary, our data reported that the severity and duration of COVID-19 were associated with several complications and contribute to poor outcomes after allo-HSCT.
Assuntos
COVID-19 , Transplante de Células-Tronco Hematopoéticas , Transplante Homólogo , Humanos , COVID-19/complicações , COVID-19/mortalidade , Transplante de Células-Tronco Hematopoéticas/efeitos adversos , Masculino , Feminino , Pessoa de Meia-Idade , Adulto , Transplante Homólogo/efeitos adversos , SARS-CoV-2/isolamento & purificação , Índice de Gravidade de Doença , Idoso , Infecções por Citomegalovirus/complicações , Estudos Retrospectivos , Adulto JovemRESUMO
BACKGROUND: Previously published meta-epidemiological studies focused on Western medicine have identified some trial characteristics that impact the treatment effect of randomized controlled trials (RCTs). Nevertheless, it remains unclear if similar associations exist in RCTs on Chinese herbal medicine (CHM). Further, Chinese medicine-related characteristics have not been explored yet. OBJECTIVE: To investigate trial characteristics related to treatment effect estimates on CHM RCTs. SEARCH STRATEGY: This meta-epidemiological study searched 5 databases for systematic reviews on CHM treatment published between January 2011 and July 2021. INCLUSION CRITERIA: An eligible systematic review should only include RCTs of CHM and conduct at least one meta-analysis. DATA EXTRACTION AND ANALYSIS: Two reviewers independently conducted data extraction on general characteristics of systematic reviews, meta-analyses and included RCTs. They also assessed the risk of bias of RCTs using the Cochrane risk of bias tool. A two-step approach was used for data analyses. The ratio of odds ratios (ROR) and difference in standardized mean differences (dSMD) with 95% confidence interval (CI) were applied to present the difference in effect estimates for binary and continuous outcomes, respectively. RESULTS: Ninety-one systematic reviews, comprising 1338 RCTs were identified. For binary outcomes, RCTs incorporated with syndrome differentiation (ROR: 1.23; 95 % CI: [1.07, 1.39]), adopting Chinese medicine formula (ROR: 1.19; 95% CI: [1.03, 1.34]), with low risk of bias on incomplete outcome data (ROR: 1.29; 95% CI: [1.06, 1.52]) and selective outcome reporting (ROR: 1.12; 95% CI: [1.01, 1.24]), as well as a trial size ≥ 100 (ROR: 1.23; 95% CI: [1.04, 1.42]) preferred to show larger effect estimates. As for continuous outcomes, RCTs with Chinese medicine diagnostic criteria (dSMD: 0.23; 95% CI: [0.06, 0.41]), judged as high/unclear risk of bias on allocation concealment (dSMD: -0.70; 95% CI: [-0.99, -0.42]), with low risk of bias on incomplete outcome data (dSMD: 0.30; 95% CI: [0.18, 0.43]), conducted at a single center (dSMD: -0.33; 95% CI: [-0.61, -0.05]), not using intention-to-treat analysis (dSMD: -0.75; 95% CI: [-1.43, -0.07]), and without funding support (dSMD: -0.22; 95% CI: [-0.41, -0.02]) tended to show larger effect estimates. CONCLUSION: This study provides empirical evidence for the development of a specific critical appraisal tool for risk of bias assessments on CHM RCTs. Please cite this article as: Wang BH, Lin YL, Gao YY, Song JL, Qin L, Li LQ, Liu WQ, Zhong CCW, Jiang MY, Mao C, Yang XB, Chung VCH, Wu IXY. Trial characteristics and treatment effect estimates in randomized controlled trials of Chinese herbal medicine: A meta-epidemiological study. J Integr Med. 2024; 22(3): 223-234.
Assuntos
Medicamentos de Ervas Chinesas , Medicina Tradicional Chinesa , Ensaios Clínicos Controlados Aleatórios como Assunto , Humanos , Medicamentos de Ervas Chinesas/uso terapêutico , Estudos Epidemiológicos , Resultado do TratamentoRESUMO
Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.