Death of hospitalized neonates of different gestational age in Shaanxi Province: a multi-center survey / 中华围产医学杂志

Objective:To investigate the current status of hospitalized neonatal death of different gestational ages in Shaanxi Province.Methods:All neonatal deaths in six hospitals in Shaanxi Province from 2016 to 2020 were retrospectively analyzed, and the differences in perinatal complications, the causes of death, and the age at death were compared using Chi-square (or Fisher's exact ) test. Results:(1) Totally, 220 488 neonates were delivered in the obstetric department of the six hospitals during the study period; 71 782 out of them were admitted to the neonatal department. While 424 neonatal death was reported, giving the total hospitalized neonates mortality rate of 5.5‰ (394/71 782), which included 152 deaths of transferred patients ( n=9 103, 16.7‰), 226 premature (53.3%), 196 term (46.2%), and two post-term infants (0.5%). (2) Among mothers of dead neonates, 73.6% were found to have at least one perinatal complication. The most common one was fetal distress (146 cases, 34.4%), followed by gestational diabetes mellitus (113 cases, 26.7%), amniotic fluid abnormalities ( n=73, 17.2%), maternal infectious diseases ( n=71, 16.8%), and hypertensive disorders in pregnancy (HDP) ( n=52, 12.3%). The lower the gestational age, the higher the proportion of multiple pregnancies and assisted reproduction technology applied (Fisher exact test, P<0.05). On the contrary, the higher the gestational age, the higher the cesarean section rate ( χ 2=26.69, P<0.001). HDP was more likely to occur in the gestational age of 28-31 +6 and 32-34 +6 weeks ( χ 2=37.16, P<0.001), and amniotic fluid abnormalities were more likely to occur in those over 37 weeks ( χ 2=27.47, P<0.001). (3) The five leading causes of neonatal death were neonatal respiratory distress syndrome (NRDS, n=100, 23.6%), neonatal asphyxia ( n=88, 20.8%), maternal infectious diseases ( n=80, 18.9%), and birth defects ( n=54, 12.7%), and pulmonary hemorrhage ( n=22, 5.2%). The first three causes of death in term and post-term infants were neonatal asphyxia ( n=65, 32.8%), birth defects ( n=42, 21.2%), and infectious diseases ( n=26, 13.1%). NRDS ( n=83, 36.7%), infectious diseases ( n=54, 23.9%), and neonatal asphyxia ( n=23, 10.2%) were the three leading causes of death of premature babies. (4) Out of the 326 (76.9%) neonatal deaths within seven days after birth, 162 (38.2%) died within 24 h after birth and 164 cases (38.7%) between one to seven days after birth. Conclusions:Most neonatal deaths occurred among preterm ones and within seven days after birth, whose mothers suffered perinatal complications. The causes of neonatal death vary among different gestational age groups.

First Nerve-Related Immunoprobe for Guidance of Renal Denervation through Colocalization of NIR-II and Photoacoustic Bioimaging.

Nerve-related fluorophores generally locate in the visible or near-infrared region with shallow penetration depth and easy uptake by surrounding tissues. Prolonging the optical window promotes resolution by minimizing photoscattering and eliminating autofluorescence for NIR-II (second near infrared; 1000-1700 nm) and photoacoustic bioimaging. In addition, combination of the two could help in colocalization of targets at the 3D level. Catheter-based renal sympathetic denervation (RDN), an alternative treatment recently finishing its clinical evaluation for treating resistant hypertension, is highly dependent on experience and in urgent demand for in vivo guidance in locating the nerve over the renal artery. Here, an NIR-II and photoacoustic bioimaging system based on a dye-modified anti-tyrosine-hydroxylase antibody (TH-ICGM) to illustrate the peritoneal sympathetic nerve-related region are combined. With high resolution (0.15 mm) in NIR-II region for both absorbance (λex = 925 nm) and fluorescence (bioimaging in λem ≥ 1300 nm), TH-ICGM succeeds in providing 3D coordinates of procedure position with a precision in 0.1 mm. As the first nerve-related NIR-II immunoprobe, TH-ICGM has great clinical potential as assistance for nerve-related interventions.

A potent SARS-CoV-2 antibody neutralizes Omicron variant by disassembling the spike trimer

The continuous emergence of novel SARS-CoV-2 variants poses new challenges to the fight against the COVID-19 pandemic. The newly emerging Omicron strain caused serious immune escape and raised unprecedented concern all over the world. The development of antibody targeting conserved and universal epitope is urgently needed. A subset neutralizing antibody(nAbs) against COVID-19 from convalescent patients were isolated in our previous study. Here in this study, we investigated the accommodation of these nAbs to SARS-CoV-2 variants of concerns (VOCs), revealing that IgG 553-49 neutralizes pseudovirus of SARS-CoV-2 Omicron variant. In addition, we determined the cryo-EM structure of SARS-CoV-2 spike complexed with three antibodies targeting different epitopes, including 553-49, 553-15 and 553-60. Notably, 553-49 targets a novel conserved epitope and neutralizes virus by disassembling spike trimers. 553-15, an antibody that neutralizes all the other VOCs except omicron, cross-links two spike trimers to form trimer dimer, demonstrating that 553-15 neutralizes virus by steric hindrance and virion aggregation. These findings suggest the potential to develop 49 and other antibody targeting this highly conserved epitope as promising cocktail therapeutics reagent for COVID-19. ImportanceThe newly emergence of Omicron strain caused higher immune escape, raising unprecedented concerns about the effectiveness of antibody therapies and vaccines. In this study, we identified a SARS-CoV-2 Omicron neutralizing antibody 553-49, which neutralizes Omicron variant by targeting a completely conserved novel epitope. Besides, we revealed that IgG 553-15 neutralizes SARS-CoV-2 by crosslinking virions and 553-60 functions by blocking receptor binding. Comparison of different RBD epitopes revealed that the epitope of 553-49 is hidden in the S trimer and keeps high conservation during SARS-CoV-2 evolution, making 553-49 a promising therapeutics reagent to fight against the emerging Omicron and future variant of SARS-CoV-2.

Broad neutralization of SARS-CoV-2 variants by an inhalable bispecific single-domain antibody

The effectiveness of SARS-CoV-2 vaccines and therapeutic antibodies has been limited by the continuous emergence of viral variants, and by the restricted diffusion of antibodies from circulation into the sites of respiratory virus infection. Here, we report the identification of two highly conserved regions on Omicron variant RBD recognized by broadly neutralizing antibodies. Based on this finding, we generated a bispecific single-domain antibody that was able to simultaneously and synergistically bind these two regions on a single Omicron variant RBD as revealed by Cryo-EM structures. This inhalable antibody exhibited exquisite neutralization breadth and therapeutic efficacy in mouse models of SARS-CoV-2 infections. The structures also deciphered an uncommon cryptic epitope within the spike trimeric interface that may have implications for the design of broadly protective SARS-CoV-2 vaccines and therapeutics.

Clinical analysis of extremely premature infants and extremely low birth weight infants / 中华实用儿科临床杂志

Objective:To analyze the complications and outcomes during the hospitalization of extremely premature infants (EPI) and extremely low birth weight infants (ELBWI).Methods:Clinical data of 168 cases of EPI and ELBWI admitted to 4 hospitals of grade three in Shaanxi Province between January 1, 2015 and December 31, 2017 were retrospectively analyzed.The information of general data, prenatal care, complications and outcomes were summarized.Outcomes of different groups were compared according to birth weight and gestational age.Results:A total of 168 cases of EPI and ELBWI were collected.The rate of delivery in tertiary hospitals was 86.9% (146/165 cases), 86 patients (57.7%) received prenatal Dexamethasone.The mean gestational age was (27.9±1.7) weeks, and the mean birth weight was (951.6±148.9) g. The highest rates of pregnancy complications included gestational hypertension (44/149 cases, 29.5%), premature rupture of membranes (43/149 cases, 28.9%) and gestational diabetes (16/149 cases, 10.7%). The first three neonatal complications were neonatal respiratory distress syndrome (16/168 cases, 95.2%), bronchopulmonary dysplasia (73/110 cases, 66.4%) and retinopathy of prematurity (65/110 cases, 59.1%). The survival rate of EP and ELBWI in 168 cases was 61.9% (104/168 cases), the abandonment rate was 27.4% (46/168 cases), and the mortality in hospital was 10.7% (18/168 cases). According to birth weight and gestational age, there were no statistically significant differences in survival, abandonment and hospital mortality among different birth weight groups( χ2=4.361, 5.104, 1.630, all P>0.05), while there were statistically significant differences in survival, abandonment and hospital mortality among different gestational age groups( χ2=21.650, 8.164, 13.490, all P<0.05). Conclusions:There are many complications of EPI and ELBWI and the outcomes are closely related to the gestational age of birth.Improving the perinatal management level and the professional diagnosis and treatment level of neonatology are helpful to improve the survival rate and prognosis.

Investigation on epidemiology of nosocomial sepsis of premature infants with gestational age less than 34 weeks in Shaanxi province:a multicenter study / 中华实用儿科临床杂志

Objective To investigate the epidemiological data of nosocomial sepsis of premature infants with gestational age less than 34 weeks and the distribution characteristics of pathogenic bacteria in Shaanxi province.Methods A retrospective analysis of clinical data of premature infants born with gestational age ＜ 34 weeks born between January 1 and December 30,2018 in Neonatal Intensive Care Units(NICU) in 4 Grade A Class Three hospitals in Shaanxi province was performed.The high risk factors and pathogenic bacteria were analyzed by using chi-square test and t test for statistical analysis.Results Totally 823 infants were included in this study,among whom,73 patients developed nosocomial sepsis,and the incidence was 8.9％.The mean gestational age of the 73 patients with nosocomial sepsis was (30.6 ± 2.2) weeks and mean birth weight was (1 320.3 ± 450.5) g.The rate of invasive ventilator was 23.4％ (52/222 cases).The rate of peripherally inserted central catheter (PICC) was 20.1％ (61/303 cases).The rate of early antibiotic use was 8.1％ (39/481 cases) and breast feeding rate was 9.3％ (63/675 cases).The rate of PICC and ventilator use were statistically different between the non-infection group and the infection group (all P ＜0.05).There were 31 strains of pathogenic bacteria,among which gram-negative bacilli was the most common (22 strains,70.9％),which mainly were klebsiella pneumoniae strains (15 strains,48.4％),and 6 strains (19.4％) of Fungus was detected.Conclusions The incidence of nosocomial sepsis in NICU in Shaanxi province is higher,gram-negative bacilli was the most common pathogenic bacteria,among which,klebsiella pneumoniae was main,it is necessary to strengthen the regular monitoring and analysis of nosocomial infection in NICU in order to reduce the incidence of nosocomial infection and sepsis.

Investigation on epidemiology of nosocomial sepsis of premature infants with gestational age less than 34 weeks in Shaanxi province: a multicenter study / 中华实用儿科临床杂志

Objective@#To investigate the epidemiological data of nosocomial sepsis of premature infants with gestational age less than 34 weeks and the distribution characteristics of pathogenic bacteria in Shaanxi province.@*Methods@#A retrospective analysis of clinical data of premature infants born with gestational age < 34 weeks born between January 1 and December 30, 2018 in Neonatal Intensive Care Units(NICU) in 4 Grade A Class Three hospitals in Shaanxi province was performed.The high risk factors and pathogenic bacteria were analyzed by using chi-square test and t test for statistical analysis.@*Results@#Totally 823 infants were included in this study, among whom, 73 patients developed nosocomial sepsis, and the incidence was 8.9%.The mean gestational age of the 73 patients with nosocomial sepsis was (30.6±2.2) weeks and mean birth weight was (1 320.3±450.5) g. The rate of invasive ventilator was 23.4%(52/222 cases). The rate of peripherally inserted central catheter (PICC) was 20.1% (61/303 cases). The rate of early antibiotic use was 8.1% (39/481 cases) and breast feeding rate was 9.3% (63/675 cases). The rate of PICC and ventilator use were statistically different between the non-infection group and the infection group(all P<0.05). There were 31 strains of pathogenic bacteria, among which gram-negative bacilli was the most common (22 strains, 70.9%), which mainly were klebsiella pneumoniae strains (15 strains, 48.4%), and 6 strains(19.4%) of Fungus was detected.@*Conclusions@#The incidence of nosocomial sepsis in NICU in Shaanxi province is higher, gram-negative bacilli was the most common pathogenic bacteria, among which, klebsiella pneumoniae was main, it is necessary to strengthen the regular monitoring and analysis of nosocomial infection in NICU in order to reduce the incidence of nosocomial infection and sepsis.

Correlation of the Serum Levels of Adiponectin, IGF-Ⅰ, PA with EUGR in Preterm Infants / 现代生物医学进展

Objective:To explore the levels of serum adiponectin,insulin growth factor Ⅰ (IGF-Ⅰ) and prealbumin in preterm infants,and analyze their correlation with preterm EUGR infant.Methods:321 cases of preterm infants who were born in our hospital and transferred to neonatal department in 24 hours from January,2014 to January,2016 were enrolled in the present study.According to the weight at discharge,they were divided into the EUGR group and the non EUGR group,the growth and development as well as the levels of serum adiponectin,IGF-Ⅰ and PA in the two groups were compared.Results:The occurrence rate of EUGR was 55.76％ (179/321) in the 321 cases ofpreterm infants;the weight of EUGR group was significantly lower than that of the non EUGR group at 42 th days and three months after birth(p＜0.05).The SDS of both groups were all negative,and that of EUGR group was significantly lower than non EUGR group (p＜0.05).The levels of serum adiponectin,IGF-Ⅰ and PA of both groups were significantly lower than the control group at seventh days of birth,and the PA level of EUGR group was significantly lower than non EUGR group (p＜0.05).There was no significant difference in the serum adiponectin and PA levels between 7 days and 14 days in EUGR group (P ＞ 0.05),however,the serum adiponectin and PA levels in the non EUGR group was obviously increased and significantly higher than that of the EUGR group (p ＜ 0.05).The level of IGF-Ⅰ in both groups keep unchanged during two weeks (P＞0.05).Conclusion:The lower levels of serum adiponectin,IGF-Ⅰ and PA were closely related to the EUGR of preterm infants,which could be used as biochemical indexes to early diagnosis of EUGR.

The complete mitochondrial genome of Cleithenes herzenstein and its phylogenetic analysis.

The complete mitochondrial genome of Stewartia sinensis was obtained with long PCR approach. Amplification primers were designed according to mitogenome sequences of some other fish species. PCR reactions were according to Kong et al. ( 2009 ). The complete mitochondria sequence of Cleithenes herzenstein was deposited in GenBank under the accession number KT223828. Structural and evolutionary analyses were also performed. The length of the complete mitochondrial DNA sequence was 17 175 bp, consisting of 13 protein-coding genes, 22 tRNA genes, and two rRNA genes. Other than D-loop, another non-coding region named ''OL'' region was found ( Table 1 ). The ''OL'' region (CTTTTTCCCGCCTAGTTTAACCAGTAAAAGGCGGGAA) is 38 bp and has the potential to fold into a stem-loop secondary structure. Most of the genes were encoded on the heavy strand (H strand) except for ND6 and eight tRNA genes ( Table 1 ). The base composition and gene arrangement of C. herzenstein mitogenome was identical to typical vertebrate. For sequence alignment, the mitogenome sequence of C. herzenstein was 96% and 95% similar to that of Platichthys stellatus and Verasper moseri, respectively.

Therapeutics, genomics and epigenomics of retinoblastoma / 中国生化药物杂志

Retinoblastoma is the most common pediatric retinal tumor initiated by biallelic inactivation of the retinoblastoma gene ( RB1 ) , affecting roughly 1 in 15000 children with 1100 new cases each year.In China, RB remains a potentially devastating disease while lack of early diagnosis and aggressive treatment strategies.Moreover, RB patients individually show a variety of drug response to regular systemic chemotherapy since intensive chemotherapy and long-term follow-up are not as readily available.The majority of patients with advanced diseases require enucleation which affects the future quality of children life.Recent studies showed that alterations in genomics and epigenomics of RB play very important roles in RB progress and therapy.We thereby review current understanding changes of genomics and epigenomics in RB as potential prognostic and therapeutic targets.