Management of Meloidogyne incognita with Chemicals and Cultivars in Cotton in a Semi-Arid Environment.

Management of Meloidogyne incognita (root-knot nematode) in cotton in the United States was substantially affected by the decision to stop production of aldicarb by its principle manufacturer in 2011. The remaining commercially available tools to manage M. incognita included soil fumigation, nematicide seed treatments, postemergence nematicide application, and cultivars partially resistant to M. incognita. Small plot field studies were conducted on a total of nine sites from 2011-2013 to examine the effects of each of these tools alone or in combinations, on early season galling, late-season nematode density in soil, yield, and value ($/ha = lint value minus chemical costs/ha). The use of a partially resistant cultivar resulted in fewer galls/root system at 35 d after planting in eight of nine tests, lower root-knot nematode density late in the growing season for all test sites, higher lint yield in eight of nine sites, and higher value/ha in six of nine sites. Galls per root were reduced by aldicarb in three of nine sites and by 1,3-dichloropropene (1,3-D) in two of eight sites, relative to the nontreated control (no insecticide or nematicide treatment). Soil fumigation reduced M. incognita density late in the season in three of nine sites. Value/ha was not affected by chemical treatment in four of nine sites, but there was a cultivar × chemical interaction in four of nine sites. When value/ha was affected by chemical treatment, the nontreated control had a similar value to the treatment with the highest value/ha in seven of eight cultivar-site combinations. The next "best" value/ha were associated with seed treatment insecticide (STI) + oxamyl and aldicarb (similar value to the highest value/ha in six of eight cultivar-site combinations). The lowest valued treatment was STI + 1,3-D. In a semi-arid region, where rainfall was low during the spring for all three years, cultivars with partial resistance to M. incognita was the most profitable method of managing root-knot nematode in cotton.

Irrigation Timing Impacts the Efficacy of Foliar-Applied Fungicides Toward Foliar and Soilborne Pathogens of Peanut.

Fungicides not reaching target organisms result in decreased disease control. In the southeastern United States, foliar-applied fungicides are routinely used to manage peanut (Arachis hypogaea) diseases. Irrigation is often applied to wash fungicides from treated foliage to obtain maximum control of diseases caused by soilborne pathogens. Administering irrigation before fungicide residues have dried may adversely impact foliar disease control. A microplot study was conducted in 2003, 2004, and 2005 to evaluate the redistribution of azoxystrobin, tebuconazole, and flutolanil plus chlorothalonil following different irrigation timings. Standard fungicide regimes were subjected to 1.3-cm of irrigation 0, 6, 12, 24, 48, or 96 h after application, and a nonirrigated control was included. Microplots not receiving irrigation were covered while irrigation treatments were administered. Irrigation timing was significant for the number of early leaf spot (Cercospora arachidicola) lesions per leaf. Leaf spot was more severe when irrigation was administered immediately following fungicide applications, and was significantly reduced with a 6- and 12-h delay prior to an irrigation event, whereas maximum control was obtained when irrigation was delayed for 24 h or later. To further quantify fungicide residue distribution, Sclerotium rolfsii was used to bioassay foliage and pods. Lesion development on leaflets, which was greater for earlier irrigation timings, did not differ for the 12-h and later timings and was generally similar to the nonirrigated controls. Pod colonization for all fungicides increased according to a quadratic function of irrigation timing, with the least colonization occurring at the 0-h timing. Colonization of pods treated with azoxystrobin was similar for all irrigation timings; whereas, suppression was greatest for tebuconazole at earlier irrigation timings. This study demonstrates that irrigation can be used to redistribute fungicides applied to peanut foliage to improve control of soilborne pathogens but administering irrigation within 24 h may decrease leaf spot control.

First Report of Stemphylium botryosum on Spinach in Texas.

During the 2009 to 2010 growing season, symptoms of an unknown leaf spot were observed on spinach (Spinacia oleracea L.) in production fields in southwest Texas. Approximately 500 ha were affected, especially cvs. Rakaia and Viceroy. Disease incidence was 30 and 2% for Rakaia and Viceroy, respectively. Diseased plants exhibited small (1 to 3 mm in diameter), tan, necrotic lesions with a circular to oval shape and were void of any signs of a pathogen. Symptomatic leaves were surface sterilized in 1.5% NaOCl for 1 min, rinsed with sterile water, and air dried. Leaf sections (~1 cm2) were cut and placed on acidified potato dextrose agar (APDA), or APDA supplemented with streptomycin (SAPDA). Fungal mycelia growing from the edges of infected leaf sections were transferred to PDA and incubated at 25°C with a 12-h/12-h light/dark cycle. After 14 days of incubation, dark brown mycelia giving rise to unbranched conidiophores bearing brown, deeply septate, ovoid conidia were observed. Conidia measured 16.8 to 27.3 × 13.1 to 19.6 µm. On the basis of these morphological characteristics, the fungus was identified as Stemphylium botryosum (3). Cultures were transferred to clarified V8 juice agar to obtain inoculum for pathogenicity tests. Eight-week-old plants (n = 20) of spinach cvs. Hybrid 310, Wintergreen, Ashley, and Rakaia were sprayed until runoff with a suspension containing 0.001% Tween 80 and 1 × 104 conidia/ml. Noninoculated plants served as a control treatment. Plants were placed in a growth chamber and incubated in the dark at 25°C and 95% relative humidity. Following 36 h of incubation, plants were transferred to a plastic enclosure and maintained at 23 ± 4°C. After 7 to 10 days, tan, oval-shaped lesions were observed on all inoculated spinach plants. All control plants, with the exception of Rakaia, failed to develop symptoms. Isolates of S. botryosum were recovered on SAPDA from symptomatic leaves, confirming Koch's postulates. Previous reports have shown that S. botryosum can be transmitted from infected seed (1), thus, additional plants of each cultivar (n = 36) were grown in the greenhouse to determine the potential for seedborne contamination. After 8 weeks, leaf spot symptoms identical to those observed on the original plants developed on 75% of the Rakaia plants, while symptom development on the other cultivars was negligible. Isolates of S. botryosum were only recovered from symptomatic Rakaia leaves. Similar field observations were made during the 2001 to 2002 growing season; however, attempts to isolate S. botryosum in that season were unsuccessful. Recent outbreaks of Stemphylium leaf spot have been reported in Arizona (4), California (3), Delaware and Maryland (2), and Washington (1). To our knowledge, this is the first report of S. botryosum on spinach in Texas. While the origin of inoculum causing the disease in Texas is unknown, S. botryosum may have been seedborne (2). The implementation within the past few years of very high density plantings of spinach (1.9 to 3.7 million seeds/ha) may lead to an increase in incidence and severity of this disease in Texas. References: (1) L. J. du Toit and M. L. Derie. Plant Dis. 85:920, 2001. (2) K. L. Everts and D. K. Armentrout. Plant Dis. 85:1209, 2001. (3) S. T. Koike et al. Plant Dis. 85:126, 2001. (4) S. T. Koike et al. Plant Dis. 89:1359, 2005.

First Report of Sclerotinia Stem Rot of Canola Caused by Sclerotinia sclerotiorum in Texas.

During the past several years, canola (Brassica napus L.) has been grown experimentally in different areas of Texas to evaluate its potential as a crop, particularly for use as a biofuel source. In early April 2007, symptoms typical of Sclerotinia stem rot were observed in a canola variety trial that was flowering in Wharton County, Texas. Stems had white mycelia growing on the outside, or a bleached appearance, near the soil surface and plants were lodging. Inside bleached stems, there were spherical to cylindrical, black sclerotia that were 3 to 10 mm. Isolations from surface-disinfested stems onto potato dextrose agar (PDA) consistently yielded white, fluffy colonies with sclerotia typical of Sclerotinia sclerotiorum (Lib.) de Bary (1). Sequence analyses were conducted on two replicates of mycelium by extracting fungal DNA with the Qiagen DNeasy Plant Mini Kit (Valencia, CA). PCR amplification was performed using two primer sequences (92-4 AF377919: TCGCCTCAGAAGAATGTGC/AGCGGGTTACAAGGAGATGG; and 119-4 AF377925: GTAACAAGAGACCAAAATTCGG/TGAACGAGCTGTCATTCCC) (2) that have previously been used to characterize S. sclerotiorum (3). The BLAST search revealed that the sequences were 99 and 98% homologous with S. sclerotiorum Accession Nos. AF377919 and AF377925 over 376 and 377 bp of aligned sequence, respectively. Agar segments (1 cm2) from a 5-day-old culture grown on PDA were placed in the leaf axils of 15 2-month-old canola plants ('Wichita') growing in pots. Plants were placed in a humid chamber under fluorescent lights at 16 to 22°C. After 2 days, water soaking and necrosis occurred on petioles and stems adjacent to the inoculum, but not on plants treated with sterile PDA. S. sclerotiorum was consistently reisolated from symptomatic tissue plated on acidified PDA. The inoculations were repeated once with similar results. To our knowledge, this is the first report of Sclerotinia stem rot of canola in Texas. Currently, there is no significant canola production in Texas; however, interest in biofuels could lead to an increase in planted acres. Sclerotinia stem rot of canola could become a significant disease problem in areas of Texas where canola is planted as a winter crop. References: (1) L. M. Kohn. Phytopathology 69:881, 1979. (2) C. Sirjusingh and L. M. Kohn. Mol. Ecol. Notes 1:267, 2001. (3) J. E. Woodward et al. Plant Dis. 92:1468, 2008.

First Report of Sclerotinia sclerotiorum Infecting Peanut in Texas.

Peanut (Arachis hypogaea L.) is grown extensively in several counties in West Texas. Sclerotinia blight, caused by the soilborne fungus Sclerotinia minor Jagger, is an increasingly important disease throughout this region. In September of 2007, diseased peanut plants (cv. Tamrun OL02) exhibiting symptoms of Sclerotinia blight (2,4) were collected from a commercial farm in Gaines County during a regional survey. Infected stem sections were surface disinfested in 0.5% sodium hypochlorite for 1 min, air dried, and placed in petri dishes containing water agar. Hyphae were subsequently transferred to petri dishes containing potato dextrose agar (PDA) after 3 days of incubation at room temperature. Pure cultures formed abundant, aerial, white mycelia, which later became darkly pigmented. Black, spherical to elongated sclerotia, 3.8 ± 0.8 mm, formed on the outer edge of petri dishes after 1 week. These characteristics are consistent with S. sclerotiorum (Lib.) de Bary (1,2). Pathogenicity tests were conducted by inoculating stems of greenhouse-grown peanut plants (cvs. Tamrun OL02, n = 4 and Flavorrunner 458, n = 4) with PDA plugs containing S. sclerotiorum. Mounting pins were used to create a shallow wound and affix inoculum plugs to stems. Control plants (n = 4) were inoculated with noncolonized PDA plugs. Plants were placed in a dew chamber at 20°C and 95% relative humidity in a randomized complete block design. The experiment was conducted two times. Symptoms identical to those observed on the original plant specimens were observed after 3 days on all inoculated plants; the controls remained healthy. Darkly pigmented cultures of S. sclerotiorum were consistently reisolated from all symptomatic stem sections. Fungal DNA was extracted from mycelia and sclerotia with a Qiagen DNeasy Plant Mini kit (Valencia, CA) and amplified by PCR using three S. sclerotiorum-specific primer pairs (3). PCR products for three replicates (two from mycelia and one from sclerotia) were sequenced and subjected to a NCBI BLAST search of highly similar sequences (megablast). The BLAST search revealed that our sequences are highly similar only with reported sequences of S. sclerotiorum. Sequences generated from three primer pairs in this study were 99, 95, and 95% homologous to S. sclerotiorum Accessions Nos. AF377925.1, AF377919.1, and AF377904.1 over 373, 376, and 300 bp of aligned sequence, respectively. Results from the pathogenicity tests and molecular study confirm that the S. sclerotiorum isolate obtained in this study is capable of inciting Sclerotinia blight of peanut. While S. minor is the primary causal agent of the disease, recent reports indicate that S. sclerotiorum is becoming more prevalent throughout the peanut-producing regions of the United States (2,4), and must therefore be considered in disease diagnosis. References: (1) L. M. Kohn. Phytopathology 69:881, 1979. (2) S. Sanogo and N. Puppala. Plant Dis. 91:1077, 2007. (3) C. Sirjusingh and L. M. Kohn. Mol. Ecol. Notes 1:267, 2001. (4) J. E. Woodward et al. Plant Dis. 90:111, 2006.

First Report of Sclerotinia minor Infecting Ipomoea hederacea and I. coccinea in Texas.

Sclerotinia blight, caused by the soilborne fungus Sclerotinia minor Jagger, is a major disease of peanut (Arachis hypogaea L.) in parts of west Texas. Previous reports have indicated that annual weed species may serve as collateral hosts for S. minor (2). Several Ipomoea spp. are commonly found in peanut fields throughout the region. In September of 2007, Ipomoea hederacea and I. coccinea plants with bleached, shredded stems, and signs of black sclerotia were collected from a field known to be infested with S. minor. Symptomatic stem sections were rinsed in tap water, surface disinfested in 0.5% sodium hypochlorite for 1 min, air dried, and plated on potato dextrose agar (PDA). Pure cultures of S. minor consisting of white, fluffy mycelia and small (<2 mm), black, irregular sclerotia were consistently recovered. Pathogenicity tests were conducted by wound-inoculating healthy I. hederacea and I. coccinea transplants (n = 3) with agar plugs obtained from the edges of actively growing S. minor cultures. Plants were incubated in a dew chamber at 20°C and 95% relative humidity for 5 days. Plants inoculated with sterile PDA plugs served as controls (n = 3). A similar test was conducted using the susceptible peanut cultivar Flavorunner 458. Characteristic symptoms of Sclerotinia blight (3) were observed on all inoculated weed and peanut plants; whereas, the controls remained healthy. Pathogenicity tests were repeated with similar results. Cultures of S. minor were obtained from all symptomatic tissues, fulfilling Koch's postulates. These results indicate that I. hederacea and I. coccinea are additional hosts of S. minor and that sclerotia produced on infected plants can significantly augment soil inoculum. S. minor has been observed to infect I. batatas seedlings in New Jersey (1); however, this to our knowledge is the first report of S. minor infecting Ipomoea spp. in Texas. Therefore, weed management should inevitability be a part of disease management strategies for the control of Sclerotinia blight in peanut. References: (1) Anonymous. Index of Plant Diseases in the United States. USDA Handb. No. 165, 1960. (2) J. E. Hollowell et al. Plant Dis. 87:197, 2003. (3) D. M. Porter and H. A. Melouk. Sclerotinia blight. Page 34 in: Compendium of Peanut Diseases. 2nd ed. N. Kokalis-Burelle et al., eds. The American Phytopathologicial Society, St. Paul, MN, 1997.

Use of Resistant Cultivars and Reduced Fungicide Programs to Manage Peanut Diseases in Irrigated and Nonirrigated Fields.

Field experiments were conducted in 2004 and 2005 to evaluate the response of several peanut cultivars to standard and reduced-input fungicide programs under production systems which differed in the duration of crop rotation, disease history within a field, or in the presence or absence of irrigation. Effects on early leaf spot (caused by Cercospora arachidicola), late leaf spot (caused by Cercosporidium personatum), and southern stem rot (caused by Sclerotium rolfsii), pod yields, and economic returns were assessed. Standard fungicide programs were similar for both sets of experiments and included applications of pyraclostrobin, tebuconazole, azoxystrobin, or chlorothalonil. Reduced-fungicide programs, comprising combinations of the aforementioned fungicides, resulted in two and four applications for the cultivar and irrigation experiment, respectively. Two additional programs (a seven-spray chlorothalonil and a nontreated control) were included in the cultivar experiment. Fungicide programs provided adequate levels of leaf spot suppression, and stem rot incidence was similar among fungicide programs within the two management systems. In the cultivar experiment, returns were significantly lower for the reduced program compared with the full program and seven-spray chlorothalonil program; however, they were significantly higher than the nontreated control. Significant differences in leaf spot, stem rot, and yield were observed among cultivars in both experiments. Overall, leaf spot intensity was lowest for the cvs. Georgia-03L and Georgia-01R and greatest for Georgia Green and Georgia-02C. Georgia-03L, Georgia-02C, and AP-3 consistently had lower incidence of stem rot than the other cultivars. Pod yields for all cultivars were equivalent to or greater than Georgia Green in both experiments; however, the performance of reduced-fungicide programs was inconsistent.

First Report of Sclerotinia Blight Caused by Sclerotinia sclerotiorum on Peanut in Georgia.

Sclerotinia blight is one of the most economically important diseases of peanut (Arachis hypogaea L.) in Oklahoma and Virginia. Yield losses of 10% are common in these areas; however, losses may exceed 50% in highly infested fields (1). While Sclerotinia minor is considered the primary causal agent, S. sclerotiorum may also incite the disease. Symptoms typically appear late in the season and are favored by cool temperatures and high relative humidity (RH). Initial symptoms include wilting and yellowing of main or lateral branches. Dense mats of white mycelium develop on diseased areas, and small water-soaked lesions are apparent near the soil line. Lesions become bleached and infected tissues have a shredded appearance. Sclerotia are produced on and inside infected plant parts (2). During October 2004, following a period of heavy rainfall and cool temperatures, peanut plants (cv. Tifrunner) with these symptoms were observed in a field near Surrency, GA. The field had been planted to cotton (Gossypium hirsutum L.) for many years and peanut was strip-tilled into a heavy rye (Secale cereale L.) cover. Disease foci were found throughout the field and final incidence was 20%. Stem sections were surface disinfested in 0.5% sodium hypochlorite for 1 min and plated on potato dextrose agar (PDA). Cultures of S. sclerotiorum (2) were recovered after incubation at 20°C for 2 weeks. Pathogenicity tests were conducted by inoculating wounded peanut mainstems with PDA plugs either with or without the fungus. Inoculation sites were wrapped with moistened cheesecloth, and plants were incubated in a dew chamber at 20°C and 95% RH. There were a total of four replications and the experiment was repeated once. Symptoms consistent with those observed in the field appeared after 3 days and lesion lengths were measured after 5 days. Average lesion lengths were 1.4 and 1.6 cm for cvs. Georgia Green and Tifrunner, respectively Controls remained symptomless. Sections of symptomatic tissue were plated on PDA, and S. sclerotiorum was reisolated from 100% of symptomatic tissue. Although S. sclerotiorum is a common pathogen of various winter crops and weeds found in the southeast, to our knowledge, this is a first report of Sclerotinia blight on peanut in the region. No other occurrences of the disease have been reported since the initial discovery; however, potential losses could be incurred if peanuts are planted in infested fields and harvest is delayed. References: (1) H. A. Melouk and P. A. Backman. Management of soilborne fungal pathogens. Pages 75-85 in: Peanut Health Management. H. A. Melouk and F. M. Shokes, eds. The American Phytopathologicial Society, St. Paul, MN, 1995. (2) D. M. Porter and H. A. Melouk. Sclerotinia blight. Pages 34-36 in: Compendium of Peanut Diseases. 2nd ed. N. Kokalis-Burelle et al., eds. The American Phytopathologicial Society, St. Paul, MN, 1997.

First Report of Botrytis Blight of Peanut Caused by Botrytis cinerea in Georgia.

Because of the importance of spotted wilt caused by Tomato spotted wilt virus (TSWV), most peanut (Arachis hypogaea L.) breeding programs in the southeastern United States are focusing on developing resistance to TSWV. Many of the cultivars with improved resistance to TSWV are late maturing, requiring 150 days to reach optimum maturity. This factor could greatly impact disease problems at harvest. During November of 2004, an unknown disease was observed on peanut cvs. Georgia 02-C and Hull in a commercial field in Appling County. Symptoms included wilting stems with water-soaked lesions and a dense, gray mold growing on infected tissues. Final disease incidence was less than 5%. For isolation, diseased tissue was surface sterilized by soaking in 0.5% sodium hypochlorite for 1 min, air dried, plated on potato dextrose agar (PDA), and incubated at 20°C. Botrytis cinerea Pers.:Fr., causal agent of Botrytis blight, was isolated from the margins of infected tissue. Mycelia were initially white but became gray after 72 h at which time tall, branched, septate conidiophores formed. Mature, unicellular, ellipsoid, hyaline conidia (8.9 × 10.4 µm) formed in botryose heads (1). Hard, black, irregular-shaped sclerotia formed after 2 weeks. Stems of greenhouse-grown peanut plants (cv. Georgia Green) were inoculated with PDA plugs colonized with either B. cinerea or B. allii Munn. Inoculations were made 3 cm below the last fully expanded leaf on wounded and nonwounded tissue. Noncolonized PDA plugs served as controls (n = 9). Plants were arranged in a dew chamber at 20°C in a randomized complete block design. Lesions and spore masses identical to those observed in the field appeared 3 to 5 days after being inoculated with B. cinerea. The B. allii inoculations caused only superficial lesions. After 5 days, mean lesion lengths for B. cinerea were 59 and 37 mm for wounded and nonwounded inoculations, respectively. B. cinerea was recovered from 100% of the symptomatic tissues. Botrytis blight is considered a late-season disease that occurs in cool, wet weather (3). Symptoms similar to those of Botrytis blight were observed on mature and over-mature peanut in Georgia and have been cited as "unpublished observations" (2); however, to our knowledge, this is the first report of the disease in Georgia. Although Botrytis blight is not considered a major peanut disease, it may become more prevalent at harvest as producers utilize late-maturing cultivars to manage spotted wilt. References: (1) H. L. Barnett and B. B. Hunter. Illustrated Guide of Imperfect Fungi. 4th ed. The American Phytopathological Society, St. Paul, MN, 1998. (2) K. H. Garren and C. Wilson. Peanut Diseases. Pages 262-333 in: The Peanut, the Unpredictable Legume. The National Fertilizer Assoc. Washington D.C. 1951. (3) D. M. Porter. Botrytis blight. Pages 10-11 in: Compendium of Peanut Diseases. 2nd ed. N. Kokalis-Burelle et al., eds. The American Phytopathological Society, St. Paul, MN. 1997.

First Demonstration of Koch's Postulates for Lasiodiplodia theobromae Fruit Spot on Eggplant (Solanum melongena).

During October 2004, diseased eggplant fruit from a commercial farm in Colquitt County, Georgia, developed circular, tan, water-soaked lesions. Gray, septate mycelia quickly covered the fruit. Diseased fruit became shriveled, spongy, and mummified. Disease incidence in the field was approximately 1%. Lasiodiplodia theobromae (Pat.) Griffon & Maubl. (synonym Botryodiplodia theobromae Pat.) (2) was isolated from the margins of lesions and cultured on acidified potato dextrose agar. The fungus produced grayish colonies with aerial hyphae and black ostiolate pycnidia massed into stroma. Mature elliptical conidia (25.8 × 15.6 µm) were brown, had a single septation, and longitudinal striations. Isolates obtained from peanut and pecan were included in the pathogenicity tests. Mature fruit cv. Nightshade were surface disinfested for 30 s in 70% ethanol, followed by 60 s in 0.5% sodium hypochlorite, rinsed twice in sterile distilled water, and allowed to dry. Inoculations were made by placing an agar plug containing L. theobromae mycelial side down on the surface of the fruit or wounding with a sterile toothpick containing mycelium of the fungus. Fruit similarly inoculated with agar plugs or sterile toothpicks served as controls. There were a total of three replicates. Fruit were placed in plastic containers lined with moistened paper towels. Containers were placed in a dew chamber and incubated (28°C, relative humidity >95%) for 3 days, and then evaluated. Symptoms identical to those observed on naturally infected fruit developed on inoculated fruit. Controls remained disease free. L. theobromae was reisolated from all symptomatic tissue, satisfying Koch's postulates. Disease damage on wounded fruit was twice that of nonwounded fruit. However, seven of nine inoculations with agar plugs containing L. theobromae resulted in infection. Lesion lengths from wound inoculations were 9.8, 7.3, and 5.2 cm for isolates from peanut, pecan, and eggplant, respectively. Generally, L. theobromae is considered a facultative wound pathogen or a secondary invader (3). However, this study suggests that direct infection can occur. Although fruit spot has been reported previously on eggplant (1), to our knowledge, this is the first report verifying L. theobromae as the causal agent. References: (1) S. A. Alfieri et al. Index of Plant Diseases in Florida. Fla. Dep. Agric. Consum. Serv. Bull. 11, 1984. (2) H. L. Barnett and B. B. Hunter. Illustrated Guide of Imperfect Fungi. 4th ed. The American Phytopathological Society St. Paul, MN, 1998. (3) P. M. Phipps and D. M. Porter. Plant Dis. 82:1205, 1998.

Differential effects of transferrin receptor blockade on the cellular mechanisms involved in graft rejection.

Since transferrin receptor (TfR) appears on activated T cells following the interaction of the antigen-major histocompatibility complex (MHC) with the T cell receptor (TCR) and the appearance of interleukin (IL)-2R, we therefore hypothesize that in vivo blockade of TfR prolongs allograft survival by altering the cellular mechanisms involved in graft rejection. Previous results in our laboratory have demonstrated that anti-TfR monoclonal antibody (mAb) at 100 microg on days 0 and 1 of transplantation significantly prolonged allograft survival to 25.7 +/- 0.9 days in a murine heterotopic, nonvascularized cardiac allograft model. In the current studies, administration of anti-TfR mAb at the time of maximal TfR expression, on days 2 and 3 post-transplantation, failed to prolong allograft survival (13.0 +/- 0.0 days) compared to the isotype controls (10.5 +/- 0.5 and 10.7 +/- 0.4 days) (p < 0.01, Wilcoxon rank sum). A 4-day course of anti-TfR mAb significantly prolonged allograft survival compared to the isotype controls, but was no more effective than a 2-day course of the mAb. Anti-TfR mAb suppressed the mixed lymphocyte response to donor-specific and third-party alloantigen by 78.7% (p < 0.05) and 80.8% (p < 0.05), respectively, while stimulating the CTL response to donor-specific (16.3%, p < 0.05) and third party (49.3%, p < 0.01) alloantigen. Anti-TfR mAb suppressed IL-15 and increased IL-4 intragraft mRNA expression when compared to the isotype controls. Examination of cell surface receptors important during T cell activation revealed alterations in expression following anti-TfR mAb treatment. Anti-TfR mAb is an effective immunosuppressant prolonging allograft survival by altering cell-mediated immune responses and the intragraft cytokine micro-environment.

Enhanced allograft survival via simultaneous blockade of transferrin receptor and interleukin-2 receptor.

BACKGROUND: Transferrin receptor (TfR) expression follows the induction of interleukin 2 receptor (IL-2R) expression in a sequence that is necessary to initiate cell proliferation in quiescent T lymphocytes. Therefore, we tested the hypothesis that simultaneous blockade of TfR and IL-2R would be more effective in prolonging allograft survival and suppressing T-cell responses to alloantigen than single receptor blockade by modifying T-cell effectors to alloantigen. METHODS: Neonatal C57BL/6 hearts were transplanted to CBA/J recipients in a heterotopic, nonvascularized cardiac allograft model. Anti-TfR and/or anti-IL-2R or isotype-matched control monoclonal antibodies (mAbs) were administered at 100 microg intravenously on days 0 and 1 of transplantation. RESULTS: Anti-TfR mAb (25.7+/-0.9 days) significantly (P<0.01) prolonged cardiac allograft survival compared with anti-IL-2R mAb (12.5+/-0.9 days) or the isotype control (15.7+/-1.2 days, P<0.01, Wilcoxon rank-sum). Anti-TfR plus anti-IL-2R mAbs significantly (P<0.01) prolonged cardiac allograft survival to 50.7+/-2.0 days compared with the isotype control or either agent alone. These agents in combination down-regulated the intragraft T helper (Th)-1 cytokines, IL-2, interferon-gamma, and IL-15, while up-regulating the Th2 cytokine, IL-4, and completely abrogating the antigen-presenting cell IL-12p40 mRNA expression. CONCLUSIONS: Anti-TfR and anti-IL-2R mAbs are potent immunosuppressants. Combined blockade of TfR and IL-2R at the time of antigen presentation seems to be the most effective by shifting the intragraft Th cytokine paradigm.

T-cell alterations in cardiac allograft recipients after B7 (CD80 and CD86) blockade.

BACKGROUND: T-cell activation requires engagement of the T cell receptor with the antigen-MHC and simultaneous ligation of the coreceptor CD28. CD28 binds both the CD80 (B7-1) and CD86 (B7-2) ligands on antigen-presenting cells. The functional role of these costimulatory pathways in transplantation is not completely understood. We tested the hypothesis that in vivo blockade of the CD28 pathway via the anti-CD80 and anti-CD86 monoclonal antibodies (mAbs) would prolong allograft survival. METHODS: Neonatal C57BL/6J (H2b) hearts were transplanted to CBA/J (H2k) recipients in a heterotopic nonvascularized model, with anti-CD80 and/or anti-CD86 mAbs being administered intravenously at the time of allografting (day 0) and on the following day (day 1). RESULTS: Anti-CD80 mAb (29.8+/-1.5 days) and anti-CD86 mAb (30.8+/-0.5 days) alone significantly prolonged allograft survival compared with the isotype control (10.7+/-0.4 days, P < 0.01, Wilcoxon rank sum). The concurrent (days 0 and 1) and sequential administration of anti-CD86 mAb on days 0 and 1 plus anti-CD80 mAb on days 2 and 3 prolonged allograft survival to >80 days. Simultaneous administration of anti-CD80 and anti-CD86 mAbs significantly suppressed donor-specific cytotoxic T lymphocyte responses to alloantigen. Anti-CD86 mAb suppressed intragraft interleukin (IL)-4, IL-10, IL-12 p40, and IL-15 mRNA expression. CONCLUSIONS: Anti-CD80 and/or anti-CD86 mAbs are potent immunosuppressants in prolonging allograft survival. Combined blockade of the B7 (CD80 and CD86) ligands seems to be the most effective in prolonging allograft survival and suppressing donor-specific allogeneic cytotoxic T lymphocyte responses. In vivo blockade of CD86, in comparison to CD80, had the greatest immunosuppressive effect on day 7 intragraft cytokines, suggesting its role on early allogeneic immune responses.

Transferrin receptor in T cell activation and transplantation.

Transferrin receptor (TfR) expression is up-regulated during T cell activation after the interaction of the T cell receptor with the antigen-major histocompatibility complex and the expression of interleukin-2 (IL-2) receptor. We hypothesize that anti-TfR monoclonal antibody (mAb) will prolong allograft survival by altering T cell responses. In a murine heterotopic nonvascularized cardiac allograft model, CBA/J (H-2k) recipients were transplanted with neonatal C57BL/6 (H-2b) donor hearts. Anti-TfR or isotype-matched control mAbs (100 microg) were administered at the time of transplantation and on the following day. Splenocytes from naive CBA/J mice were stimulated in vitro with C57BL/6 alloantigen. Anti-TfR mAb was administered at 5 microg/mL during the initiation of culture. Cytotoxic T lymphocyte (CTL) and mixed lymphocyte responses (MLR) were performed to assess T cell function. After 24 h in culture, cells were harvested, RNA isolated, and semi-quantitative reverse transcriptase-polymerase chain reaction performed. Anti-TfR mAb prolonged allograft survival to 25.7 +/- 0.9 days compared to the isotype control (10.7 +/- 0.4 days, P < 0.01, Wilcoxon rank sum). Anti-TfR mAb completely abrogated the CTL response and suppressed the MLR by 70-86% compared to the isotype controls. Anti-TfR mAb suppressed IL-2, interferon-gamma (IFN-gamma), IL-10, and IL-12 p40 mRNA expression, but had no effect on IL-4, IL-12 p35, and IL-15 mRNA expression. In conclusion, anti-TfR mAb prolongs allograft survival, suppresses T cell function, and alters IL-2, IL-10, IL-12 p40, and IFN-gamma mRNA expression. These data suggest that the down-regulation in IL-12 mRNA by anti-TfR mAb may prevent the development of T helper cells, thereby promoting graft survival and altering cell-mediated immune responses. The partial effect by anti-TfR mAb on cytokine mRNA expression may be due to other contributing factors such as costimulation.

Anti-transferrin receptor monoclonal antibody: a novel immunosuppressant.

BACKGROUND: Transferrin receptor is a widely distributed cell surface receptor present on most proliferating and highly specialized quiescent cells. Expression of transferrin receptor on the surface of immune cells is up-regulated during T-cell activation after the interaction of the antigen-MHC with the T cell receptor. The role of transferrin receptor in T-cell activation has not been well-established. Since transferrin receptor is physically associated with the CD3 zeta-chain, blockade of transferrin receptor has the potential to interfere with the T-cell signals important in transplant rejection. METHODS: Anti-transferrin receptor monoclonal antibody (mAb) was administered in vivo and in vitro to determine whether this agent was effective in prolonging allograft survival and altering cell-mediated immunity. RESULTS: Using donor C57BL/6J (H2b) hearts transplanted to CBA/J (H2k) recipients, anti-transferrin receptor mAb at the time of transplantation prolonged cardiac allograft mean survival time to 25.7+/-0.9 days compared with untreated (13.3+/-0.6 days, P < 0.05) or isotype-matched (10.7+/-0.4 days, P < 0.05) controls. Anti-transferrin receptor mAb administered in vivo failed to suppress the subsequent allogeneic responses. However, when added to culture, anti-transferrin receptor mAb suppressed the allogeneic cytotoxic T lymphocyte response by 79-100% but not the mixed lymphocyte response. CONCLUSIONS: These studies are the first to suggest that transferrin receptor is a potential therapeutic target for clinical transplantation. Future studies will determine the most efficacious dose and time for maximal immunosuppression and the mechanisms responsible for the immunosuppression exhibited by antitransferrin receptor mAb.