NF-kappa B p50-dependent in vivo footprints at Ig S gamma 3 DNA are correlated with mu-->gamma 3 switch recombination.

NF-kappa B has been demonstrated to play critical roles in multiple aspects of immune responses including Ig H chain isotype switching. To better define the specific roles the p50 subunit of NF-kappa B plays in mu-->gamma 3 switch recombination (SR), we systematically evaluated p50-deficient B cells for activities that are strongly correlated with SR. B cell activation with LPS plus anti-IgD-dextran plus IL-5 plus IL-4 plus TGF-beta produced normal levels of proliferation and gamma3 germline transcripts in p50-deficient B cells, but mu-->gamma 3 SR was impaired. In vitro binding studies previously showed that NF-kappa B p50 homodimer binds the switch nuclear B-site protein (SNIP) of the S gamma 3 tandem repeat. Ligation-mediated PCR in vivo footprint analysis demonstrates that the region spanning the SNIP and switch nuclear A-site protein (SNAP) binding sites of the S gamma 3 region are contacted by protein in normal resting splenic B cells. B cells that are homozygous for the targeted disruption of the gene encoding p50 (-/-) show strong aberrant footprints, whereas heterozygous cells (+/-) reveal a partial effect in S gamma 3 DNA. These studies provide evidence of nucleoprotein interactions at switch DNA in vivo and suggest a direct interaction of p50 with S gamma 3 DNA that is strongly correlated with SR competence.

Immunoglobulin switch recombination may occur by a DNA end-joining mechanism.

Immunoglobulin switch recombination is a specialized recombination event that occurs exclusively in B lymphocytes and is focused on tandemly repetitive DNA sequences called switch regions. Switch recombination occurs as an intrachromosomal deletion event in which the deleted genetic material is excised as a circle. Although the developmental profile of this recombination event is well characterized, the underlying mechanism for switch recombination is poorly understood. Recent studies detected the presence of double strand breaks in switch DNA and the dependency of switching on the Ku and DNA-dependent protein kinase proteins which are involved in repair of double strand breaks by nonhomologous end-joining. Taken together these findings strongly suggest that switch recombination is a specialized recombination system that occurs through a DNA end-joining mechanism.

Ku80 is required for immunoglobulin isotype switching.

Isotype switching is the DNA recombination mechanism by which antibody genes diversify immunoglobulin effector functions. In contrast to V(D)J recombination, which is mediated by RAG1, RAG2 and DNA double-stranded break (DSB) repair proteins, little is known about the mechanism of switching. We have investigated the role of DNA DSB repair in switch recombination in mice that are unable to repair DSBs due to a deficiency in Ku80 (Ku80(-/-)). B-cell development is arrested at the pro-B cell stage in Ku80(-/-) mice because of abnormalities in V(D)J recombination, and there are no mature B cells. To reconstitute the B-cell compartment in Ku80(-/-) mice, pre-rearranged VB1-8 DJH2 (mu i) and V3-83JK2 (kappa i) genes were introduced into the Ku80(-/-) background (Ku80(-/-)mu i/+kappa i/+). Ku80(-/-)mu i/+ kappai/+ mice develop mature mIgM+ B cells that respond normally to lipopolysaccharide (LPS) or LPS plus interleukin-4 (IL-4) by producing specific germline Ig constant region transcripts and by forming switch region-specific DSBs. However, Ku80(-/-)mu i/+kappa i/+ B cells are unable to produce immunoglobulins of secondary isotypes, and fail to complete switch recombination. Thus, Ku80 is essential for switch recombination in vivo, suggesting a significant overlap between the molecular machinery that mediates DNA DSB repair, V(D)J recombination and isotype switching.

Ig Sgamma3 DNA-specifc double strand breaks are induced in mitogen-activated B cells and are implicated in switch recombination.

The looping-out and deletion model of switch recombination suggests that double strand breaks (DSBs) may occur in switch regions and participate in the recombination transaction. A DSB assay based on the ligation-mediated PCR method has been devised for the Sgamma3 region. Mitogen-inducible DSBs have been detected in Sgamma3 DNA of normal splenic B cells but not in splenic T cells or thymocytes. The breaks are restricted to the Sgamma3 region and are sequence specific. Examination of the sequence surrounding the DSBs has led to the derivation of a consensus sequence for DSB formation. Induction of Sgamma3-specific DSBs is correlated with the onset of switch recombination. The DSBs flank clusters of Sgamma3 recombination breakpoints, suggesting that processing of the broken ends may occur during the recombination reaction.

Switch recombination breakpoints occur at nonrandom positions in the S gamma tandem repeat.

Ig switch (S) recombination is clearly focused on S regions. It is possible that S-specific DNA binding proteins facilitate the alignment of these regions before recombination. The S gamma 3-specific DNA binding proteins, SNAP and SNIP/NF-kappa B, interact with two discrete regions of the S gamma 3 tandem repeat, the A and B sites. Recombination breakpoints in the S gamma 3 region were found to significantly correlate with the binding sites of the S gamma 3 binding proteins. We now report the conservation of the SNIP and SNAP binding sites in S gamma 2b and S gamma 1 DNA. SNIP/NF-kappa B interacts with its cognate sites in S gamma 2b and S gamma 1 DNA as determined by mobility shift assays, competition binding studies, and supershift analysis using an antiserum specific for the p50 component. SNAP binds specifically to S gamma 2b and S gamma 1 as measured by mobility shift assays and competition binding studies. SNAP is composed of two closely traveling mobilities that do not separate on partial purification. SNIP and SNAP are expressed in nuclear extracts derived from murine splenic B cell cultures stimulated with mitogen or mitogen and IL-4. No new DNA binding proteins specific for S gamma 1 tandem repeats are detectable in nuclear extracts from B cells stimulated with mitogen and IL-4. The sites at which recombination occurs in the S gamma 2b and S gamma 1 regions have been analyzed statistically and found to correlate with the SNIP/NF-kappa B and SNAP binding sites. Distinctions have been found regarding the use of DNA substrates within the tandem repeat between primary (mu-->gamma) and successive (gamma-->x) S recombination.

Switch recombination breakpoints are strictly correlated with DNA recognition motifs for immunoglobulin S gamma 3 DNA-binding proteins.

The deletion looping out model of switch (S) recombination predicts that the intervening DNA between switch regions will be excised as a circle. Circular excision products of immunoglobulin switch recombination have been recently isolated from lipopolysaccharide (LPS)-stimulated spleen cells. The recombination breakpoints in these large circles were found to fall within switch regions. Since switch recombination is clearly focused on switch regions, we hypothesized that some DNA-binding protein factor might be involved in specifically recognizing and facilitating the alignment of switch regions before recombination. Two DNA-binding proteins that specifically interact with two discrete regions of the S gamma 3 tandem repeat have been identified in crude and partially purified nuclear extracts derived from LPS- and dextran sulfate (DxS)-activated splenic B cells. The first factor has been found indistinguishable from NF-kappa B by mobility shift assays, methylation interference, competition binding studies, and supershift analysis using an antiserum specific for the p50 component. The second appears to be composed of two closely traveling mobilities that do not separate upon partial purification. This second complex is unique and specific for S gamma 3 by methylation interference assays and competition-binding analysis. The sites at which recombination occurs in the S gamma 3 switch region have been analyzed and found to strictly correlate with the binding sites of the S gamma 3 switch binding proteins.

Detection of an immunoglobulin switch region-specific DNA-binding protein in mitogen-stimulated mouse splenic B cells.

We have detected a nuclear protein from lipopolysaccharide- and dextran sulfate-stimulated mouse splenic B cells which binds specifically to the immunoglobulin switch mu (S mu) sequence. We have termed the binding protein NF-S mu. DNA containing the S mu repeated sequence, GAGCTGGGGTGAGCTGAGCTGAGCT, was used as a probe in electrophoretic mobility shift assays. Methylation interference analysis indicated that binding centers on the run of four guanine residues. Competitions with mutated S mu sequences confirmed the importance of the run of G residues and revealed that optimal binding occurs when they are flanked by GAGCT. The kinetics of the expression of NF-S mu in splenic B cells treated with lipopolysaccharide and dextran sulfate parallels the induction of recombinational activity at S mu in these cells. On the basis of these data, we suggest that NF-S mu may be an effector of switch recombination.