Glucose affects cell viability, migration, angiogenesis and cellular adhesion of human retinal capillary endothelial cells via SPARC.

The expression of secreted protein acidic and rich in cysteine (SPARC) has been recently identified to be associated with the pathology of diabetic retinopathy. Therefore, the present study aimed to evaluate the regulatory role of SPARC in human retinal capillary endothelial cells (HRCECs), following exposure to a high glucose environment in vitro. The cell viability, migration, angiogenesis, permeability and SPARC expression levels of HRCECs were measured following treatment with different concentrations of glucose (25, 50 or 100 mM). Lentiviral vectors (LV185-pL_shRNA_mKate2-SPARC-543; target sequence, GGATGAGGACAACAACCTTCT) that inhibit the expression of SPARC were constructed, and HRCECs were evaluated when infected by viruses carrying the lentiviral vectors. Cell viability was examined using the Cell Counting Kit-8 assay. The expression of SPARC in HRCECs increased as the concentration of glucose in the culture medium increased. Relatively high concentrations of glucose significantly inhibited cell proliferation (P<0.05), migration (P<0.05), angiogenesis (P<0.01), and the expression of ZO, occludin, claudin and JAM1 in tight junctions (P<0.01), gap junctions (Cx37 and Cx43; P<0.01) and adherens junctions (VE-cadherin, CTNNA1 and CTNNB1; P<0.05). However, when SPARC was downregulated by lentiviral vectors, the inhibitions induced by high concentrations of glucose were partially reversed. To conclude, the inhibitory effects on cell viability, migration, angiogenesis and cellular adhesion of HRCECs induced by high concentrations of glucose were reversed once the expression of SPARC was inhibited. These findings suggest that SPARC may serve an important role in pathogenesis of diabetic retinopathy.

[Regulatory effect of Smad7 gene on MAPK signal pathway in malignant transformation of immortalized human bronchial epithelial BEP2D cells].

BACKGROUND & OBJECTIVE: Smad7 is an inhibitor of transforming growth factor-beta (TGF-beta) signal pathway. TGF-beta could induce the expression of several genes through activating SMAD and ras/MEK/ERK pathways. This study was to determine whether Smad7 is involved in regulating mitogen-activated protein kinase (MAPK) signal pathway with TGF-beta in malignant transformation of human bronchial epithelial BEP2D cells. METHODS: Immortalized BEP2D cells and malignant BERP35T2 cells were co-transfected with full-length Smad7 cDNA constructed pCISmad7.neo or Smad7 siRNA, transactivator vector pTet-Elk or pTet-Jun, and reporter vector pTRE-Luc, and stimulated with TGF-beta. The regulatory effect of Smad7 on MAPK signal pathway was investigated by standard luciferase assay. RESULTS: In BEP2D cells, when treated with TGF-beta1, phosphorylated activities of Elk and Jun were up-regulated (P(Elk)=0.033, P(Jun)=0.016); after co-transfection of Elk or Jun with pCISmad7.neo, phosphorylated activity of Elk was increased, and that of Jun was decreased (P(Elk)=0.017, P(Jun)=0.028); after co-transfection of Elk or Jun with Smad7 siRNA, phosphorylated activity of Elk was decreased, and that of Jun was increased (P(Elk)=0.018, P(Jun)=0.005). In BERP35T2 cells, when treated with TGF-beta1, phosphorylated activity of Elk was up-regulated (P=0.006); after co-transfection of Elk and Smad7 siRNA, phosphorylated activity of Elk was decreased (P=0.000); no activity of Jun was detected in BERP35T2 cells. CONCLUSIONS: In the process of malignant transformation of BEP2D cells, the intervention of Smad7 in MAPK signal pathway leads to the activity imbalance between extracellular signal-related protein kinase (ERK) and c-Jun NH2-terminal kinase (JNK), which in turn promotes cell proliferation. All these could contribute to further malignant transformation of these cells.

[Effect of overexpression of Smad7 gene on cell proliferation].

OBJECTIVE: To study the effect of overexpression of Smad7 gene on cell proliferation in human bronchial epithelial cell lines. METHODS: Human bronchial epithelial cell lines, BEP2D and BERP35T2 cells, were cotransfected with the mammalian expression vectors PCISmad7.neo and pMyc-SEAP, the latter was ac-myc cis-acting enhancer element fused with alkaline phosphatase (SEAP) reporter gene. Expression of c-myc, p15 and p21 mRNA was detected by RT-PCR before and after stable transfection of Smad7 into BEP2D and BERP35T2 cells in order to study the regulation of TGF-beta-mediated growth inhibition. RESULTS: After BEP2D and BERP35T2 cells transfected with Smad7, the transcriptional activity of c-myc was significantly increased. Smad7 overexpressing cells showed upregulation of c-myc expression and downregulation of p15 and p21 expression, which contributed to the loss of TGF-beta responses in these cells. CONCLUSION: Overexpression of Smad7 may facilitate cell proliferation by antagonizing TGF-beta-mediated antiproliferative gene responses.

[Proteomics-based identification of Maspin differential expression in bronchial epithelial immortalized cells and malignant transformation cells].

BACKGROUND & OBJECTIVE: Maspin, a serepin inhibitor, plays a key role in tumor growth and metastasis. The aim of this study was to identify the differential expression of Maspin in malignant transformation process of bronchial epithelial cells by proteomics. METHODS: Functional proteomics analysis of Maspin on bronchial epithelial immortalized cells and malignant transformation cells was carried out using immobilized pH gradient (IPG) two-dimensional electrophoresis, peptide mass fingerprinting (PMF), and post source decay (PSD) of bio-mass spectrometry. RESULTS: Nearly 1500 expressed proteins profile on bronchial epithelial immortalized cells and malignant transformation cells were obtained in the range of MW 14.4-94 kDa, PI 3-10. Image analysis showed that Maspin was down-regulated in malignant transformation cells compared with that in immortalized cells. Northern blot analysis showed that the mRNA abundance of Maspin in malignant transformation cells was much lower than that in immortalized cells. CONCLUSION: Alteration expression of Maspin at transcription and translation levels might be involved in carcinogenesis of lung.

Proteome analysis on an early transformed human bronchial epithelial cell line, BEP2D, after alpha-particle irradiation.

To probe the mechanism of carcinogenesis of lung cancer at the molecular level and to find potential protein markers involved in the early phase of tumorgenesis, differential proteome analysis on primary passage cell line R15H, and early transformed cell line R15H20 derived from (238)Pu alpha-particle irradiation of human papillomavirus (HPV) 18-immortalized human bronchial epithelial cell line (BEP2D), was carried out using two-dimensional electrophoresis (2-DE) and peptide mass fingerprinting (PMF) with matrix-assisted laser desorption/ionisation-time of flight mass spectrometry. Image analysis and Student's t-test (p < 0.05) showed that three protein spots were only expressed in R15H, intensities of 43 protein spots on the gels were altered between R15H and R15H20. Two of the three spots that were only expressed in R15H were identified as high mobility group protein 1. Two proteins decreased in abundance in R15H20 were identified as maspin precursor, a tumor suppressor and aminoacylase-1. Ornithine aminotransferase and peptidyl-prolyl cis-trans isomerase A that were increased in R15H20, were also identified. Relationships between these differentially expressed proteins and the carcinogenesis mechanism of lung cancer are discussed. The protein expression profile of the R15H cell line was also constructed during the study as a reference map for further comparative proteome analysis of the irradiation induced BEP2D cell line. Of the 90 spots analyzed with PMF in the 2-DE gel of R15H cell line, 50 proteins were identified by searching the nonredundant protein database SWISS-PROT/TrEMBL.

[Regulation of Smad7 gene by TGF-beta 1 in process of malignant transformation].

BACKGROUND & OBJECTIVE: Escape from transforming growth factor-beta(TGF-beta)-induced inhibition of growth and proliferation may contribute to tumorigenesis. Smad7 is inhibitory Smads of TGF-beta s signal transduction pathway and prevents TGF-beta signaling. The disorder of Smad7 may lead to the perturbation of TGF-beta signal pathway. In this study, The authors analyzed the expression of Smad7 mRNA and the regulation of Smad7 gene by TGF-beta 1 in the process of malignant transformation of BEP2D cells to investigate the mechanism of cells malignant transformation. METHODS: Cells were cultured and stimulated with TGF-beta 1 followed by RNA extraction. Purified total RNA from TGF-beta 1 treated cells and untreated controls and performed an expression analysis with a human Smad7-specific probe applying Northern blot. As a loading control for the Northern experiment, the membrane was hybridized with a human glyceraldehyde-3-phosphate dehydrogenase(GAPDH) probe. Proteins were extracted from BEP2D and BERP35T-2 cells, then perform Western blot to examine the expression level of TGF-beta 1. RESULTS: Before stimulation with TGF-beta 1, the expression level of Smad7 in the BERP35T-2 cells were higher than that in the BEP2D cells. When stimulated with TGF-beta 1, Smad7 expression levels was upregulated evidently in BEP2D cells, but not significant in BERP35T-2 cells. The expression level of endogenetic TGF-beta 1, BERP35T-2 cells was a little higher than BEP2D cells. CONCLUSION: Over expression of Smad7 mRNA and down-regulation of the cells' responsiveness to TGF-beta 1 in human lung cancer cell line which induced by alpha-particles should be one of the mechanism of radiation induced lung cancer.