Glucose metabolism profile recorded by flash glucose monitoring system in patients with hypopituitarism during prednisone replacement.

BACKGROUND: Commonly used glucocorticoids replacement regimens in patients with hypopituitarism have difficulty mimicking physiological cortisol rhythms and are usually accompanied by risks of over-treatment, with adverse effects on glucose metabolism. Disorders associated with glucose metabolism are established risk factors of cardiovascular events, one of the life-threatening ramifications. AIM: To investigate the glycometabolism profile in patients with hypopituitarism receiving prednisone (Pred) replacement, and to clarify the impacts of different Pred doses on glycometabolism and consequent adverse cardiovascular outcomes. METHODS: Twenty patients with hypopituitarism receiving Pred replacement [patient group (PG)] and 20 normal controls (NCs) were recruited. A flash glucose monitoring system was used to record continuous glucose levels during the day, which provided information on glucose-target-rate, glucose variability (GV), period glucose level, and hypoglycemia occurrence at certain periods. Islet ß-cell function was also assessed. Based on the administered Pred dose per day, the PG was then regrouped into Pred > 5 mg/d and Pred ≤ 5 mg/d subgroups. Comparative analysis was carried out between the PG and NCs. RESULTS: Significantly altered glucose metabolism profiles were identified in the PG. This includes significant reductions in glucose-target-rate and nocturnal glucose level, along with elevations in GV, hypoglycemia occurrence and postprandial glucose level, when compared with those in NCs. Subgroup analysis indicated more significant glucose metabolism impairment in the Pred > 5 mg/d group, including significantly decreased glucose-target-rate and nocturnal glucose level, along with increased GV, hypoglycemia occurrence, and postprandial glucose level. With regard to islet ß-cell function, PG showed significant difference in homeostasis model assessment (HOMA)-ß compared with that of NCs; a notable difference in HOMA-ß was identified in Pred > 5 mg/d group when compared with those of NCs; as for Pred ≤ 5 mg/d group, significant differences were found in HOMA-ß, and fasting glucose/insulin ratio when compared with NCs. CONCLUSION: Our results demonstrated that Pred replacement disrupted glycometabolic homeostasis in patients with hypopituitarism. A Pred dose of > 5 mg/d seemed to cause more adverse effects on glycometabolism than a dose of ≤ 5 mg/d. Comprehensive and accurate evaluation is necessary to consider a suitable Pred replacement regimen, wherein, flash glucose monitoring system is a kind of promising and reliable assessment device. The present data allows us to thoroughly examine our modern treatment standards, especially in difficult cases such as hormonal replacement mimicking delicate natural cycles, in conditions such as diabetes mellitus that are rapidly growing in worldwide prevalence.

Liquorice-induced severe hypokalemic rhabdomyolysis with Gitelman syndrome and diabetes: A case report.

BACKGROUND: Licorice-induced severe hypokalemic rhabdomyolysis is clinically rare. Gitelman syndrome (GS) is the most common inherited renal tubular disease, while diabetes is one of the most prevalent diseases in the world. Recently, some studies have found that GS patients had higher diabetic morbidity. However, the coexistence of these three diseases has yet to be reported. CASE SUMMARY: We report the case of a 62-year-old Chinese man who was admitted with weakness in the extremities, muscle pain, and dark-colored urine. He had consumed liquorice water daily for seven days prior to admission. The laboratory tests revealed a serum potassium level of 1.84 mmol/L, magnesium 0.68 mmol/L, creatinine phosphokinase (CK) 10117 IU/L, and marked hemoglobinuria. Fractional chloride excretion and fractional magnesium excretion were increased. Plasma renin activity and aldosterone concentration were within the normal ranges. Sequence analysis of the SLC12A3 gene revealed that he had compound heterozygous mutations. The diagnosis of liquorice-induced severe hypokalemic rhabdomyolysis with GS and diabetes was thus genetically confirmed. Serum potassium and CK quickly improved with potassium replacement therapy, hydration, and discontinuation of liquorice ingestion. Upon follow-up at 3 mo, the levels of CK, myoglobin, and potassium remained normal, and magnesium was above 0.6 mmol/L. CONCLUSION: This case emphasizes that liquorice consumption and GS should be considered causes of hypokalemia and that the diabetic status of GS patients should be noted in the clinic.

A novel 55-basepair deletion of hydroxymethylbilane synthase gene found in a Chinese patient with acute intermittent porphyria and her family: A case report.

RATIONALE: Acute intermittent porphyria (AIP) is caused by hydroxymethylbilane synthase (HMBS) gene mutation. PATIENT CONCERNS: A Chinese female patient with very typical AIP symptoms of severe abdominal pain, seizures, hypertension, and tachycardia, accompanied with hyponatremia, anemia, and hyperbilirubinemia. DIAGNOSES: She was diagnosed as AIP based on positive result of urine porphobilinogen and her clinical syndrome. INTERVENTIONS: The proband was treated with intravenous glucose (at least 250 g per day) for 4 days. HMBS mutation was investigated in this family by Sanger sequencing. OUTCOMES: A heterozygous mutation of the HMBS gene was identified in the proband and 7 other family members. Genetic sequencing showed a deletion of 55 basepairs (C.1078_1132delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT) including the stop codon position, leading to frameshift mutation. The mutation has not been documented in current gene databases. Further prediction of mutated protein structure suggests that the mutation is likely to produce prolonged peptide with structural change and less stability. LESSONS: Physicians should pay attention to AIP attack in patients with suspected symptoms and make use of genetic testing to increase identification of mutated HMBS gene carriers for further preventive strategy.

Sucrose reward promotes rats' motivation for cocaine / 生理学报

Caloric diet, such as fat and sugar intake, has rewarding effects, and has been indicated to affect the responses to addictive substances in animal experiments. However, the possible association between sucrose reward and the motivation for addictive drugs remains to be elucidated. Thus, we carried out behavioral tests after sucrose self-administration training to determine the effects of sucrose experience on rats' motivation for cocaine, locomotor sensitivity to cocaine, basal locomotor activity, anxiety level, and associative learning ability. The sucrose-experienced (sucrose) group exhibited higher lever press, cocaine infusion and break point, as well as upshift of cocaine dose-response curve in cocaine self-administration test, as compared with the control (chow) group. Additionally, despite similar locomotor activity in open field test and comparable score in cocaine-induced conditioned place preference, the sucrose group showed higher cocaine-induced locomotor sensitivity as compared with the chow group. The anxiety level and the performance in vocal-cue induced fear memory were similar between these two groups in elevated plus maze and fear conditioning tests, respectively. Taken together, our work indicates that sucrose experience promotes the rats' motivation for cocaine.