RESUMO
Heavy metal poisoning of soil from oil spills causes serious environmental problems worldwide. Various causes and effects of heavy metal pollution in the soil environment are discussed in this article. In addition, this study explores new approaches to cleaning up soil that has been contaminated with heavy metals as a result of oil spills. Furthermore, it provides a thorough analysis of recent developments in remediation methods, such as novel nano-based approaches, chemical amendments, bioremediation, and phytoremediation. The objective of this review is to provide a comprehensive overview of the removal of heavy metals from oil-contaminated soils. This review emphasizes on the integration of various approaches and the development of hybrid approaches that combine various remediation techniques in a synergistic way to improve sustainability and efficacy. The study places a strong emphasis on each remediation strategy that can be applied in the real-world circumstances while critically evaluating its effectiveness, drawbacks, and environmental repercussions. Additionally, it discusses the processes that reduce heavy metal toxicity and improve soil health, taking into account elements like interactions between plants and microbes, bioavailability, and pollutant uptake pathways. Furthermore, the current study suggests that more research and development is needed in this area, particularly to overcome current barriers, improve our understanding of underlying mechanisms, and investigate cutting-edge ideas that have the potential to completely transform the heavy metal clean up industry.
RESUMO
Objective: This cross-sectional study aimed to determine the epidemiology of olfactory and gustatory dysfunctions related to COVID-19 in China. Methods: This study was conducted by 45 tertiary Grade-A hospitals in China. Online and offline questionnaire data were obtained from patients infected with COVID-19 between December 28, 2022, and February 21, 2023. The collected information included basic demographics, medical history, smoking and drinking history, vaccination history, changes in olfactory and gustatory functions before and after infection, and other postinfection symptoms, as well as the duration and improvement status of olfactory and gustatory disorders. Results: Complete questionnaires were obtained from 35,566 subjects. The overall incidence of olfactory and taste dysfunction was 67.75%. Being female or being a cigarette smoker increased the likelihood of developing olfactory and taste dysfunction. Having received four doses of the vaccine or having good oral health or being a alcohol drinker decreased the risk of such dysfunction. Before infection, the average olfactory and taste VAS scores were 8.41 and 8.51, respectively; after infection, they decreased to 3.69 and 4.29 and recovered to 5.83 and 6.55 by the time of the survey. The median duration of dysosmia and dysgeusia was 15 and 12 days, respectively, with 0.5% of patients having symptoms lasting for more than 28 days. The overall self-reported improvement rate was 59.16%. Recovery was higher in males, never smokers, those who received two or three vaccine doses, and those that had never experienced dental health issues, or chronic accompanying symptoms. Conclusions: The incidence of dysosmia and dysgeusia following infection with the SARS-CoV-2 virus is high in China. Incidence and prognosis are influenced by several factors, including sex, SARS-CoV-2 vaccination, history of head-facial trauma, nasal and oral health status, smoking and drinking history, and the persistence of accompanying symptoms.
RESUMO
PURPOSE: Subcutaneous seroma formation (SF) is commonly seen after axillary bromhidrosis surgeries and its treatment can be challenging and long. Current prevention methods are not consistent, and the treatment includes repeated aspirations and drains, both are associated with higher risk for infections. The purpose of this article is to present a novel and simple technique of intraoperative hypertonic saline irrigation (IHSI) to axillary bromhidrosis subcutaneous dead space, which prevents postoperative SF and enables early drain removal due to reduced secretions. METHODS: From 2015 to 2022, we performed the intraoperative irrigation of the cavity through normal saline in 100 patients with primary axillary bromhidrosis. Through an incision approximately 3 cm long at the central axillary crease, the entire subcutaneous tissues containing apocrine glands were initially dissected with straight scissors within the axillary area, and then, the undermined apocrine glands were removed with curved scissors. The skin was defatted to become a full-thickness skin flap. Any suspected hemorrhagic spots were immediately coagulated electrosurgically. Negative pressure drains were placed, and intraoperative irrigation of the cavity through the drains with 20 ml of NaCl 0.9% or NaCl 10% left at site for 10 min applies different saline solutions in the same patients. RESULTS: The volume of drainage on the 1st postoperative day was 6.54±0.36 mL for the group B, which was significantly less than 15.23±0.42 mL for the group A (p < 0.05). The time of drain removal for the group B was 24 h, which was shorter than 48 h for the group A. In group B, 4 percent of axillae showed significant SF postoperatively, which was lower than the 20 percent of axillae associated with the group A (p < 0.05). The rate of incision infection for the group B was 2 percent, which was significantly lower than the 6 percent of axillae in the group A (p < 0.05). Two percent of axillae showed skin edge necrosis postoperatively in the group B, which was lower than the 10 percent of axillae associated with the group A (p < 0.05). CONCLUSIONS: IHSI enhances adhesion formation and reduces secretion rate in subcutaneous dissection space after axillary bromhidrosis surgeries, therefore enables early drain removal and prevents SF, incision infection and skin edge necrosis. As a result, reducing the pain of patients, decreasing inconveniency and cost saving of multiple outpatient visits or additional surgery. LEVEL OF EVIDENCE II: This journal requires that authors assign a level of evidence to each article. For a full description of these Evidence-Based Medicine ratings, please refer to the Table of Contents or the online Instructions to Authors www.springer.com/00266 .
RESUMO
BACKGROUND AND PURPOSE: This phase Ib study was designed to assess the safety/tolerability and preliminary antitumor activity of neoadjuvant low-dose radiotherapy (LDRT) plus durvalumab and chemotherapy for potentially resectable stage III non-small-cell lung cancer (NSCLC). MATERIALS AND METHODS: Eligible patients received dose-escalated radiotherapy (10 Gy in 5 fractions [cohort 1], 20 Gy in 10 fractions [cohort 2], and 30 Gy in 15 fractions [cohort 3]) according to a 3 + 3 design, with concurrent durvalumab plus standard chemotherapy for two cycles. Primary objective was safety/tolerability. Secondary objectives included major pathological response (MPR), pathological complete response (pCR), event-free survival (EFS), and exploratory biomarker analysis. RESULTS: Nine patients were enrolled and completed the planned neoadjuvant therapy. No dose-limiting toxicity was recorded. Grade 3-4 treatment-related adverse events were observed in three (33.3 %) patients. Seven (77.8 %) patients successfully converted to resectable cases with R0 resection. No treatment-related surgical delay or death was reported. The MPR and pCR rates were both 33.3 % % (1/3) for cohort 1, 66.7 % (2/3) and 0.0 % for cohort 2, and 100.0 % (3/3), and 66.7 % (2/3) for cohort 3. At data cutoff, the 12 month-EFS rates were 33.3 %, 66.7 %, and 100 % for three cohorts, respectively. By biomarker analysis, TMB values were higher in either pathologically or radiologically responders than in others (all p > 0.05). CONCLUSION: Neoadjuvant LDRT plus durvalumab and chemotherapy was well-tolerated in potentially resectable stage III NSCLC. The preliminary efficacy supports this combined regimen's potential, the optimal radiotherapy dosage was determined to be 30 Gy in 15 fractions, warranting further clinical investigation.
Assuntos
Anticorpos Monoclonais , Carcinoma Pulmonar de Células não Pequenas , Neoplasias Pulmonares , Terapia Neoadjuvante , Humanos , Carcinoma Pulmonar de Células não Pequenas/patologia , Carcinoma Pulmonar de Células não Pequenas/terapia , Carcinoma Pulmonar de Células não Pequenas/mortalidade , Masculino , Feminino , Pessoa de Meia-Idade , Neoplasias Pulmonares/patologia , Neoplasias Pulmonares/terapia , Neoplasias Pulmonares/mortalidade , Neoplasias Pulmonares/tratamento farmacológico , Anticorpos Monoclonais/uso terapêutico , Anticorpos Monoclonais/administração & dosagem , Idoso , Estadiamento de Neoplasias , Protocolos de Quimioterapia Combinada Antineoplásica/uso terapêutico , Quimiorradioterapia , Dosagem RadioterapêuticaRESUMO
BACKGROUND: Psoriasis is a long-lasting, inflammatory, continuous illness caused through T cells and characterized mainly by abnormal growth and division of keratinocytes. Currently, corticosteroids are the preferred option. However, prolonged use of traditional topical medication can lead to adverse reactions and relapse, presenting a significant therapeutic obstacle. Improved alternative treatment options are urgently required. Formononetin (FMN) is a representative component of isoflavones in Huangqi (HQ) [Astragalus membranaceus (Fisch.) Bge.]. It possesses properties that reduce inflammation, combat oxidation, inhibit tumor growth, and mimic estrogen. Although FMN has been shown to ameliorate skin barrier devastation via regulating keratinocyte apoptosis and proliferation, there are no reports of its effectiveness in treating psoriasis. OBJECTIVE: Through transcriptomics clues and experimental investigation, we aimed to elucidate the fundamental mechanisms underlying FMN's action on psoriasis. MATERIALS AND METHODS: Cell viability was examined using CCK8 assay in this study. The results of analysis of differentially expressed genes (DEGs) between FMN-treated HaCaT cells and normal HaCaT cells using RNA-sequencing (RNA-seq) were presented on volcano plots and heatmap. Enrichment analysis was conducted on DEGs using Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO), and results were validated through RT-qPCR verification. After 12 days of FMN treatment in psoriasis mouse model, we gauged the PASI score and epidermis thickness. A variety of techniques were used to assess FMN's effectiveness on inhibiting inflammation and proliferation related to psoriasis, including RT-qPCR, HE staining, western blot, and immunohistochemistry (IHC). RESULTS: The findings indicated that FMN could suppress the growth of HaCaT cells using CCK8 assay (with IC50 = 40.64 uM) and 20 uM FMN could reduce the level of tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6) to the greatest extent. FMN-treated HaCaT cells exhibited 985 up-regulated and 855 down-regulated DEGs compared to normal HaCaT cells. GO analysis revealed that DEGs were linked to interferon (IFN) signaling pathway. Furthermore, FMN improved pathological features, which encompassed decreased erythema, scale, and thickness scores of skin lesions in psoriasis mouse model. In vivo experiments confirmed that FMN down-regulated expression of IFN-α, IFN-ß, IFN-γ, decreased secretion of TNF-α and IL-17 inflammatory factors, inhibited expression of IFN-related chemokines included Cxcl9, Cxcl10, Cxcl11 and Cxcr3 and reduced expression of transcription factors p-STAT1, p-STAT3 and IFN regulatory factor 1 (IRF1) in the imiquimod (IMQ) group. CONCLUSIONS: In summary, these results suggested that FMN played an anti-inflammatory and anti-proliferative role in alleviating psoriasis by inhibiting IFN signaling pathway, and FMN could be used as a potential therapeutic agent.
Assuntos
Células HaCaT , Isoflavonas , Psoríase , Transdução de Sinais , Isoflavonas/farmacologia , Psoríase/tratamento farmacológico , Animais , Transdução de Sinais/efeitos dos fármacos , Humanos , Camundongos , Interferons , Sobrevivência Celular/efeitos dos fármacos , Queratinócitos/efeitos dos fármacos , Inflamação/tratamento farmacológico , Astragalus propinquus/química , Camundongos Endogâmicos BALB C , Masculino , Modelos Animais de DoençasRESUMO
BACKGROUND: Comminuted fractures of the anterior skull base can easily cause dural damage, leading to cerebrospinal fluid leakage and retrograde infection. Skull base reconstruction is essential. This study aimed to present a novel and simple technique for repairing skull base defects using a self-made fascia-bone fragments-fascia "sandwich" structure made by fascia, fracture fragments, and sutures. METHOD: From 2018 to 2023, we performed self-made sandwich structures for skull reconstruction in 10 patients with anterior skull base comminuted fractures. After debridement, the intracranial bone fragments of the surgical patient were safely removed. In vitro, the bone fragments were spread between two layers of temporal or broad fascia to form a sandwich structure similar to the size of the bone defect, and the periphery was firmly sutured with sutures. The self-made structure was then filled to the defect and fixed with fibrin glue. The periosteum at the top of the forehead was also turned over to the repair area for covering and fixation. Meanwhile, a facial skin cosmetic suture was performed. Finally, we evaluate the feasibility and efficacy of this technique. RESULTS: All 10 patients underwent reconstructive surgery using the self-made fascia-fracture fragments-fascia sandwich structure. Five patients with open wounds on the face also underwent cosmetic revisions. No cerebrospinal fluid leakage occurred in all the patients at discharge as well as 3 months later. CONCLUSIONS: For patients with comminuted fracture of the anterior skull base, the fascia-bone fragments-fascia structure could repair the skull base and prevent the occurrence of cerebrospinal fluid leakage.
Assuntos
Fraturas Cominutivas , Procedimentos de Cirurgia Plástica , Base do Crânio , Humanos , Masculino , Procedimentos de Cirurgia Plástica/métodos , Feminino , Adulto , Pessoa de Meia-Idade , Base do Crânio/cirurgia , Base do Crânio/lesões , Fraturas Cominutivas/cirurgia , Resultado do Tratamento , Fraturas Cranianas/cirurgia , Adulto Jovem , Fáscia/transplante , IdosoRESUMO
A novel sample preparation method based on polarity grouping was developed for the comprehensive determination of 315 undesirable low-weight organic pollutants ranging from polar to weakly polar in wolfberry. The method involves the swelling of the sample in ammonium acetate buffer, two-phase extraction, three-phase extraction, and dispersive solid phase extraction (D-SPE) with the assistance of low-temperature centrifugation and analysis by ultrahigh performance liquid chromatography coupled with electrospray ionization tandem mass (UHPLC-ESI-MS-MS) by using the multiple reaction monitoring mode. The recoveries of the analytes with wide range of polarity were satisfactory. The matrix-fortified standard calibration curves were compared for quantification. The results of linearity were satisfactory with linear regression coefficients (R) ranging from 0.9901 to 1.000. The limits of quantification ranged from 1 µg/kg to 10.0 µg/kg, indicating the compliance of products with legal tolerances. The average recoveries for spiked wolfberry were in the range of 69.3 %-145.2 % with RSD values of 0.2 %-28.6 %. The inter-day precision was in the range of 0.2 %-27.0 %. For over 90 % of the analytes, the recoveries were 70 %-120 % with RSD values below 20 %. The application of this method in routine monitoring programs would imply a drastic reduction of both effort and time.
Assuntos
Lycium , Praguicidas , Praguicidas/análise , Espectrometria de Massas em Tandem/métodos , Cromatografia Líquida , Extração em Fase Sólida , Cromatografia Líquida de Alta Pressão/métodosRESUMO
The mitfa gene is a well-known transcription factor associated with microphthalmia and is essential for early melanophore development. However, little is known about how mitfa affects the immune system. Here, we generated a novel mitfa knock-out zebrafish line using the CRISPR/Cas9 system. The mitfa-/- zebrafish exhibited reduced melanin levels compared to the nacre mutant. We investigated the impact on the immune system after exposure to Edwardsiella tarda and bifenazate in zebrafish larvae, and observed that the macrophage numbers were reduced in both treated groups. Remarkably, the expression levels of immune-related genes exhibited significant increases after bacterial challenge or bifenazate exposure in the mitfa-/- zebrafish, except for tlr4 and rela. Furthermore, we conducted xenograft experiments using mouse B16 melanoma cells. Notably, the cancer cells didn't show a high cell migration ratio, implying that the immune system was highly activated after the loss of mifta. Taken together, our findings suggest that mitfa-/- zebrafish serve as a valuable model for investigating the relationship between the immune system and melanocytes, providing new insights into the role of mitfa in immune responses.
Assuntos
Proteínas de Peixe-Zebra , Peixe-Zebra , Animais , Camundongos , Peixe-Zebra/genética , Peixe-Zebra/metabolismo , Proteínas de Peixe-Zebra/metabolismo , Fator de Transcrição Associado à Microftalmia/genética , Carbamatos/metabolismoRESUMO
Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.
Assuntos
Neoplasias da Mama , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , Humanos , Feminino , Ribonucleoproteína Nuclear Heterogênea A1/genética , Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Neoplasias da Mama/genética , Isoformas de Proteínas/genética , Isoformas de Proteínas/metabolismo , Processamento Alternativo , Éxons/genética , Proteínas de Membrana/genética , Proteínas de Membrana/metabolismo , Proteínas Supressoras de Tumor/metabolismoRESUMO
Previous studies indicate differences in short-term postoperative outcomes depending on the surgical starting time of the day, but long-term data are lacking. The aim of this study was to clarify if surgical starting time of the day influences long-term survival in gastric cancer patients. This cohort study consecutively included 2728 patients who underwent curatively intended gastrectomy for gastric cancer in 2011-2015 at a high-volume hospital in China, with follow-up until June 2019. Cox regression provided hazard ratios (HRs) with 95% confidence intervals (CIs) for 3-year all-cause mortality, adjusted for age, sex, health insurance, pathological tumor stage, surgical approach, neoadjuvant therapy, and weekday of surgery. Compared with patients with early starting time of gastrectomy (08:00-09:29), the point estimates for 3-year all-cause mortality were modestly increased in patients with a starting time in the middle of day (09:30-13:29; HR 1.15, 95% CI 0.97 to 1.37) and later (13:30-21:25; HR 1.10, 0.91 to 1.32). The corresponding HRs were increased particularly in patients who underwent laparoscopic gastrectomy (HR 1.54, 1.10 to 2.14 and HR 1.59, 1.12 to 2.25, respectively) and in those with stage II tumors (HR 1.74, 1.11 to 2.73 and HR 1.60, 1.00 to 2.58, respectively). Our study indicated that in patients who underwent laparoscopic gastrectomy and in those who with stage II tumors, starting surgery in the early morning might be associated with better long-term survival.
Assuntos
Neoplasias Gástricas , Humanos , Neoplasias Gástricas/patologia , Estudos de Coortes , Estudos Retrospectivos , Modelos de Riscos Proporcionais , Gastrectomia , Resultado do TratamentoRESUMO
In order to explore the pollution characteristics and sources of atmospheric volatile organic compounds (VOCs) in winter in Kaifeng City, based on the atmospheric VOCs component data obtained from the online monitoring station of the Kaifeng Ecological and Environmental Bureau (Urban Area) from December 2021 to January 2022, the pollution characteristics of VOCs and secondary organic aerosol formation potential (SOAP) were discussed, and the sources of VOCs were analyzed by using the PMF model. The results showed that the average mass concentration of VOCs in winter in Kaifeng City was (104.71±48.56) µg·m-3, and alkanes (37.7%) had the highest proportion of mass concentrations, followed by that of halohydrocarbons (23.5%), aromatics (16.8%), OVOCs (12.6%), alkenes (6.9%), and alkynes (2.6%). The averaged total SOAP contributed by VOCs was 3.18 µg·m-3, of which aromatics contributed as much as 83.8%, followed by alkanes (11.5%). The largest anthropogenic source of VOCs in winter in Kaifeng City was solvent utilization (17.9%), followed by fuel combustion (15.9%), industrial halohydrocarbon emission (15.8%), motor vehicle emission (14.7%), organic chemical industry (14.5%), and LPG emission (13.3%); solvent utilization contributed 32.2% of the total SOAP, followed by motor vehicle emission (22.8%) and industrial halohydrocarbon emission (18.9%). It was found that reducing VOCs emissions from solvent utilization, motor vehicle emission, and industrial halohydrocarbon emission was important to control the formation of secondary organic aerosols in winter in Kaifeng City.
RESUMO
BACKGROUND: Sex hormones may influence the development of gastrointestinal cancer, but evidence is inconsistent. METHODS: We systematically searched MEDLINE and Embase databases to identify prospective studies examining associations between prediagnostic circulating levels of sex hormones and risk of five gastrointestinal cancers: esophageal, gastric, liver, pancreatic, and colorectal cancer. Pooled ORs and 95% confidence intervals (95% CI) were calculated using random-effects models. RESULTS: Among 16,879 identified studies, 29 were included (11 cohort, 15 nested case-control, and three case-cohort studies). Comparing the highest versus lowest tertiles, levels of most sex hormones were not associated with the studied tumors. Higher levels of sex hormone binding globulin (SHBG) were associated with increased risk of gastric cancer (OR = 1.35; 95% CI, 1.06-1.72), but such associations were restricted in men only (OR = 1.43; 95% CI, 1.10-1.85) when stratified by sex. Higher SHBG levels were associated with increased risk of liver cancer (OR = 2.07; 95% CI, 1.40-3.06). Higher testosterone levels were associated with increased risk of liver cancer overall (OR = 2.10; 95% CI, 1.48-2.96), particularly in men (OR = 2.63; 95% CI, 1.65-4.18), Asian populations (OR = 3.27; 95% CI, 1.57-6.83), and in hepatitis B surface antigen-positive individuals (OR = 3.90; 95% CI, 1.43-10.64). Higher levels of SHBG and testosterone were associated with decreased risk of colorectal cancer in men (OR = 0.89; 95% CI, 0.80-0.98 and OR = 0.88; 95% CI, 0.80-0.97, respectively) but not in women. CONCLUSIONS: Circulating levels of SHBG and testosterone may influence the risk of gastric, liver, and colorectal cancer. IMPACT: Further clarifying the role of sex hormones in the development of gastrointestinal cancer may unravel future novel targets for prevention and treatment.
Assuntos
Neoplasias Colorretais , Neoplasias Gastrointestinais , Neoplasias Hepáticas , Masculino , Humanos , Feminino , Estudos Prospectivos , Fatores de Risco , Hormônios Esteroides Gonadais , Testosterona , Neoplasias Gastrointestinais/epidemiologia , Neoplasias Gastrointestinais/etiologia , Globulina de Ligação a Hormônio Sexual/análise , EstradiolRESUMO
The effect of aerobic glycolysis remains elusive in pediatric T-cell acute lymphoblastic leukemia (T-ALL). Increasing evidence has revealed that dysregulation of deubiquitination is involved in glycolysis, by targeting glycolytic rate-limiting enzymes. Here, we demonstrated that upregulated deubiquitinase ubiquitin-specific peptidase 1 (USP1) expression correlated with poor prognosis in pediatric primary T-ALL samples. USP1 depletion abolished cellular proliferation and attenuated glycolytic metabolism. In vivo experiments showed that USP1 suppression decreased leukemia progression in nude mice. Inhibition of USP1 caused a decrease in both mRNA and protein levels in lactate dehydrogenase A (LDHA), a critical glycolytic enzyme. Moreover, USP1 interacted with and deubiquitinated polo-like kinase 1 (PLK1), a critical regulator of glycolysis. Overexpression of USP1 with upregulated PLK1 was observed in most samples of patients with T-ALL. In addition, PLK1 inhibition reduced LDHA expression and abrogated the USP1-mediated increase of cell proliferation and lactate level. Ectopic expression of LDHA can rescue the suppressive effect of USP1 silencing on cell growth and lactate production. Pharmacological inhibition of USP1 by ML323 exhibited cell cytotoxicity in human T-ALL cells. Taken together, our results demonstrated that USP1 may be a promising therapeutic target in pediatric T-ALL.
Assuntos
L-Lactato Desidrogenase , Leucemia-Linfoma Linfoblástico de Células T Precursoras , Animais , Criança , Humanos , Camundongos , Linhagem Celular Tumoral , Progressão da Doença , Glicólise/genética , L-Lactato Desidrogenase/genética , Lactato Desidrogenase 5/metabolismo , Lactatos , Camundongos Nus , Leucemia-Linfoma Linfoblástico de Células T Precursoras/genética , Linfócitos T/metabolismo , Proteases Específicas de Ubiquitina/metabolismo , Quinase 1 Polo-LikeRESUMO
BACKGROUND: The authors aimed to produce a prediction model for survival at any given date after surgery for esophageal cancer (conditional survival), which has not been done previously. MATERIALS AND METHODS: Using joint density functions, the authors developed and validated a prediction model for all-cause and disease-specific mortality after surgery with esophagectomy, for esophageal cancer, conditional on postsurgery survival time. The model performance was assessed by the area under the receiver operating characteristic curve (AUC) and risk calibration, with internal cross-validation. The derivation cohort was a nationwide Swedish population-based cohort of 1027 patients treated in 1987-2010, with follow-up throughout 2016. This validation cohort was another Swedish population-based cohort of 558 patients treated in 2011-2013, with follow-up throughout 2018. RESULTS: The model predictors were age, sex, education, tumor histology, chemo(radio)therapy, tumor stage, resection margin status, and reoperation. The medians of AUC after internal cross-validation in the derivation cohort were 0.74 (95% CI: 0.69-0.78) for 3-year all-cause mortality, 0.76 (95% CI: 0.72-0.79) for 5-year all-cause mortality, 0.74 (95% CI: 0.70-0.78) for 3-year disease-specific mortality, and 0.75 (95% CI: 0.72-0.79) for 5-year disease-specific mortality. The corresponding AUC values in the validation cohort ranged from 0.71 to 0.73. The model showed good agreement between observed and predicted risks. Complete results for conditional survival any given date between 1 and 5 years of surgery are available from an interactive web-tool: https://sites.google.com/view/pcsec/home . CONCLUSION: This novel prediction model provided accurate estimates of conditional survival any time after esophageal cancer surgery. The web-tool may help guide postoperative treatment and follow-up.
Assuntos
Neoplasias Esofágicas , Humanos , Estudos de Coortes , Reoperação , Neoplasias Esofágicas/cirurgia , Neoplasias Esofágicas/patologia , Período Pós-OperatórioRESUMO
BACKGROUND: Viola philippica Cav. is the only source plant of "Zi Hua Di Ding", which is a Traditional Chinese Medicine (TCM) that is utilized as an antifebrile and detoxicant agent for the treatment of acute pyogenic infections. Historically, many Viola species with violet flowers have been misused in "Zi Hua Di Ding". Viola have been recognized as a taxonomically difficult genera due to their highly similar morphological characteristics. Here, all common V. philippica adulterants were sampled. A total of 24 complete chloroplast (cp) genomes were analyzed, among these 5 cp genome sequences were downloaded from GenBank and 19 cp genomes, including 2 "Zi Hua Di Ding" purchased from a local TCM pharmacy, were newly sequenced. RESULTS: The Viola cp genomes ranged from 156,483 bp to 158,940 bp in length. A total of 110 unique genes were annotated, including 76 protein-coding genes, 30 tRNAs, and four rRNAs. Sequence divergence analysis screening identified 16 highly diverged sequences; these could be used as markers for the identification of Viola species. The morphological, maximum likelihood and Bayesian inference trees of whole cp genome sequences and highly diverged sequences were divided into five monophyletic clades. The species in each of the five clades were identical in their positions within the morphological and cp genome tree. The shared morphological characters belonging to each clade was summarized. Interestingly, unique variable sites were found in ndhF, rpl22, and ycf1 of V. philippica, and these sites can be selected to distinguish V. philippica from samples all other Viola species, including its most closely related species. In addition, important morphological characteristics were proposed to assist the identification of V. philippica. We applied these methods to examine 2 "Zi Hua Di Ding" randomly purchased from the local TCM pharmacy, and this analysis revealed that the morphological and molecular characteristics were valid for the identification of V. philippica. CONCLUSIONS: This study provides invaluable data for the improvement of species identification and germplasm of V. philippica that may facilitate the application of a super-barcode in TCM identification and enable future studies on phylogenetic evolution and safe medical applications.
Assuntos
Genoma de Cloroplastos , Viola , Teorema de Bayes , Medicina Tradicional Chinesa , Filogenia , Viola/genéticaRESUMO
BACKGROUND: To investigate if anti-androgenic medications 5α-reductase inhibitors (5-ARIs) decrease the risk of developing oesophageal and gastric tumours, analysed by histological type and anatomical sub-site. METHODS: A Swedish population-based cohort study between 2005 and 2018 where men using 5-ARIs were considered exposed. For each exposed participant, ten male age-matched non-users of 5-ARIs (non-exposed) were included. Multivariable Cox regression provided hazard ratios (HR) with 95% confidence intervals (CI) adjusted for age, calendar year, smoking, non-steroidal anti-inflammatory drugs/aspirin use, and statins use. Further adjustments were made depending on the tumour analysed. RESULTS: The cohort included 191,156 users of 5-ARIs and 1,911,560 non-users. Overall, the use of 5-ARIs was not associated with any statistically significantly reduced risk of oesophageal or cardia adenocarcinoma (adjusted HR 0.92, 95% CI 0.82-1.02) or gastric non-cardia adenocarcinoma (adjusted HR 0.90, 95% CI 0.80-1.02). However, the use of 5-ARIs indicated a decreased risk of oesophageal or cardia adenocarcinoma among obese or diabetic participants (adjusted HR 0.55, 95% CI 0.39-0.80) and a reduced risk of oesophageal squamous cell carcinoma (adjusted HR 0.49, 95% CI 0.37-0.65). CONCLUSION: Users of 5-ARIs may have a decreased risk of developing oesophageal or cardia adenocarcinoma among those obese or diabetic, and a decreased risk of oesophageal squamous cell carcinoma.
Assuntos
Adenocarcinoma , Diabetes Mellitus , Neoplasias Esofágicas , Carcinoma de Células Escamosas do Esôfago , Neoplasias Gástricas , Inibidores de 5-alfa Redutase/uso terapêutico , Antagonistas de Androgênios/efeitos adversos , Estudos de Coortes , Neoplasias Esofágicas/epidemiologia , Neoplasias Esofágicas/etiologia , Humanos , Masculino , Obesidade , Oxirredutases , Fatores de Risco , Neoplasias Gástricas/epidemiologia , Neoplasias Gástricas/etiologiaRESUMO
The purpose of this study was to investigate the correlation between the expression of cystathionine ß-synthase (CBS) in lung squamous cell carcinoma (LUSC) and the microvascular density (MVD) and clinicopathological features. Firstly, the expression status of CBS in diffuse carcinoma and LUSC was searched through the public bioinformatics database. Subsequently, immunohistochemical staining and scoring were performed on tumor tissues and matched normal tissues from 108 LUSC patients to assess CBS expression; the MVD of tumor tissues was also detected. The results showed that CBS was overexpressed in some tumor tissues, including LUSC. Immunohistochemical results showed that the positive expression rate of CBS in tumor tissues (63.0%) was higher than that in normal tissues (17.6%). The expression of CBS was correlated with T (p=0.01), N (p=0.004), TNM (p=0.011) stages, and tumor differentiation degrees (p<0.001), with the increase of T, N, and TNM stages or the decrease of differentiation, the expression level of CBS also increased. In addition, the expression level of CBS was positively correlated with MVD (r=0.6997, p<0.0001). Survival analysis showed that the survival rate of the CBS negative expression group was better than that of the positive expression group (p=0.004). Cox multivariate analysis showed that CBS expression status (p<0.001), T stages (p=0.020), and TNM stages (p=0.021) were independent factors affecting the prognosis of LUSC. In conclusion, the high expression of CBS affects tumor development and is associated with the poor prognosis of LUCS, which may be used as a biomarker to evaluate prognosis and find a new direction for the treatment of LUSC.
Assuntos
Carcinoma Pulmonar de Células não Pequenas , Carcinoma de Células Escamosas , Neoplasias Pulmonares , Biomarcadores Tumorais , Carcinoma de Células Escamosas/genética , Cistationina beta-Sintase/genética , Regulação Neoplásica da Expressão Gênica , Humanos , Pulmão/patologia , Neoplasias Pulmonares/genética , PrognósticoRESUMO
The prognosis of patients with T-cell acute lymphoblastic leukemia (T-ALL) has been largely lacked behind than that of patients with B-cell ALL, especially in refractory or relapsed cases. Here, we describe a 4.7-year-old male child with TCF-SPI1-postitve T-ALL who developed refractoriness disease after a seven drugs-conventional therapy. Several studies have suggested the therapeutic potential of dasatinib in refractory T-ALL. Actually, dasatinib-included therapy dramatically reduces the leukemic burden and re-induces this patient into complete remission without systemic adverse events. Although this is a single exceptional case, the translational potential evidence of dasatinib in specific T-ALL subtype should not be under-estimated.
Assuntos
Leucemia-Linfoma Linfoblástico de Células T Precursoras , Criança , Pré-Escolar , Dasatinibe/uso terapêutico , Humanos , Masculino , Leucemia-Linfoma Linfoblástico de Células T Precursoras/tratamento farmacológico , Prognóstico , Indução de Remissão , Fator 1 de Transcrição de Linfócitos T , Linfócitos TRESUMO
Achnatherum pekinense belongs to Poaceae. The complete chloroplast genome of A. pekinense was reported in this study. The chloroplast genome was 137,837 bp in size with a canonical quadripartite structure, including two inverted repeat regions (IR) of 21,635 bp for each, a large single-copy (LSC) region of 81,787 bp in length, and a small single-copy (SSC) region of 12,780 bp in length. The overall guanine-cytosine (GC) content of this chloroplast genome was 38.8%, and the corresponding values of the LSC, SSC, and IR regions were 36.9%, 33.1%, and 44.1%, respectively. A total of 113 unique genes were annotated in this chloroplast genome, including four rRNA genes, 31 tRNA genes, and 78 protein-coding genes. The phylogenetic analysis showed that A. pekinense was clustered with A. inebrians.