RESUMO
Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.
Assuntos
Neoplasias da Mama , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , Humanos , Feminino , Ribonucleoproteína Nuclear Heterogênea A1/genética , Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Neoplasias da Mama/genética , Isoformas de Proteínas/genética , Isoformas de Proteínas/metabolismo , Processamento Alternativo , Éxons/genética , Proteínas de Membrana/genética , Proteínas de Membrana/metabolismo , Proteínas Supressoras de Tumor/metabolismoRESUMO
Steroid receptor RNA activator 1 (SRA1) has been described as a novel transcriptional co-activator that affects the migration of cancer cells. Through RT-PCR, we identified that skipping exon 3 of SRA1 produces two isoforms, including the truncated short isoform, SRA1-S, and the long isoform, SRA1-L. However, the effect of these two isomers on the migration of HCC cells, as well as the specific mechanism of exon 3 skipping remain unclear. In this study, we found up regulated expression of SRSF1 and SRA1-L in highly metastatic HCCLM3, as well as in HCCs with SRSF1 demonstrating the strongest correlation with SRA1-L. In contrast, we observed a constitutively low expression of SRA1-S and SRSF1 in lowly metastatic HepG2 cells. Overexpression of SRSF1 or SRA1-L promoted migration and invasion by increasing the expression of CD44, while SRA1-S reversed the effect of SRSF1 and SRA1-L in vitro. In addition, lung metastasis in mice revealed that, knockdown of SRSF1 or SRA1-L inhibited the migration of HCC cells, while SRA1-L overexpression abolished the effect of SRSF1 knockout and instead promoted HCC cells migration in vivo. More importantly, RNA immunoprecipitation and Cross-link immunoprecipitation analyses showed that SRSF1 interacts with exon 3 of SRA1 to up regulate the expression of SRA1-L in HCC cells. RNA pull-down results indicated that SRSF1 could also bind to exon 3 of SRA1 in vitro. Finally, minigene -MS2 mutation experiments showed that mutation of the SRA1 exon 3 binding site for SRSF1 prevented the binding of SRA1 pre-mRNA. In summary, our results provide experimental evidence that SRA1 exon 3 inclusion is up regulated by SRSF1 to promote tumor invasion and metastasis in hepatocellular carcinoma.