Postoperative haemoglobin and anaemia-associated ischaemic events after major noncardiac surgery: A sex-stratified cohort study.

STUDY OBJECTIVE: To determine the sex-specific associations between postoperative haemoglobin and mortality or complications reflecting ischaemia or inadequate oxygen supply after major noncardiac surgery. DESIGN: A retrospective cohort study with prospective validation. SETTING: A large university hospital health system in China. PATIENTS: Men and women undergoing elective major noncardiac surgery. INTERVENTIONS AND MEASUREMENTS: The primary exposure was nadir haemoglobin within 48 h after surgery. The outcome of interest was a composite of postoperative mortality or ischaemic events including myocardial injury, acute kidney injury and stroke within hospitalisation. MAIN RESULTS: The study included 26,049 patients (15,757 men and 10,292 women). Low postoperative haemoglobin was a strong predictor of the composite outcome in both sexes, with the risk progressively increasing as the nadir haemoglobin concentration dropped below 130 g l-1 in men and 120 g l-1 in women (adjusted odds ratio [OR] 1.43, 95% CI 1.37-1.50 in men, and OR 1.45, 95% CI 1.35-1.55 in women, per 10 g l-1 decrease in postoperative nadir haemoglobin). Above these sex-specific thresholds, the change of nadir haemoglobin was no longer associated with odds of the composite outcome in either men or women. There was no significant interaction between patient sex and the association between postoperative haemoglobin and the composite outcome (Pinteraction = 0.673). Validation in an external prospective cohort (n = 2120) with systematic postoperative troponin and creatinine measurement confirmed our findings. CONCLUSIONS: Postoperative haemoglobin levels following major noncardiac surgery were nonlinearly associated with ischaemic complications or mortality, without any clinically important interaction with patient sex.

Association between cumulative duration of deep anesthesia and postoperative acute kidney injury after noncardiac surgeries: a retrospective observational study.

BACKGROUND: Bispectral index (BIS) is a processed electroencephalography monitoring tool and is widely used in anesthetic depth monitoring. Deep anesthesia exposure may be associated with multiple adverse outcomes. However, the relationship between anesthetic depth and postoperative acute kidney injury (AKI) remains unclear. We sought to determine the effect of BIS-based deep anesthesia duration on postoperative AKI following noncardiac surgery. METHODS: This retrospective study used data from the Vital Signs DataBase, including patients undergoing noncardiac surgeries with BIS monitoring. The BIS values were collected every second during anesthesia. Restricted cubic splines and logistic regression were used to assess the association between the cumulative duration of deep anesthesia and postoperative AKI. RESULTS: 4774 patients were eligible, and 129 (2.7%) experienced postoperative AKI. Restricted cubic splines showed that a cumulative duration of BIS < 45 was nonlinearly associated with postoperative AKI (P-overall = 0.033 and P-non-linear = 0.023). Using the group with the duration of BIS < 45 less than 15 min as the reference, ORs of postoperative AKI were 2.59 (95% confidence interval [CI]:0.60 to 11.09, p = 0.200) in the 15-100 min group, and 4.04 (95%CI:0.92 to 17.76, p = 0.064) in the ≥ 100 min group after adjusting for preoperative and intraoperative covariates in multivariable logistic regression. CONCLUSIONS: The cumulative duration of BIS < 45 was independently and nonlinearly associated with the risk of postoperative AKI in patients undergoing noncardiac surgery.

Are there dedicated neural mechanisms for imitation? A study of grist and mills.

Are there brain regions that are specialized for the execution of imitative actions? We compared two hypotheses of imitation: the mirror neuron system (MNS) hypothesis predicts frontal and parietal engagement which is specific to imitation, while the Grist-Mills hypothesis predicts no difference in brain activation between imitative and matched non-imitative actions. Our delayed imitation fMRI paradigm included two tasks, one where correct performance was defined by a spatial rule and another where it was defined by an item-based rule. For each task, participants could learn a sequence from a video of a human hand performing the task, from a matched "Ghost" condition, or from text instructions. When participants executed actions after seeing the Hand demonstration (compared to Ghost and Text demonstrations), no activation differences occurred in frontal or parietal regions; rather, activation was localized primarily to occipital cortex. This adds to a growing body of evidence which indicates that imitation-specific responses during action execution do not occur in canonical mirror regions, contradicting the mirror neuron system hypothesis. However, activation differences did occur between action execution in the Hand and Ghost conditions outside MNS regions, which runs counter to the Grist-Mills hypothesis. We conclude that researchers should look beyond these hypotheses as well as classical MNS regions to describe the ways in which imitative actions are implemented by the brain.

Superhydrophilic nanocomposite adsorbents modified via nitrogen-rich phosphonate-functionalized ionic liquid linkers: enhanced phosphopeptide enrichment and phosphoproteome analysis of tau phosphorylation in the hippocampal lysate of Alzheimer's transgenic mice.

In this study, new graphene-based IMAC nanocomposites for phosphopeptide enrichment were prepared according to the guideline of our new design strategy. Superhydrophilic polyethyleneimine (PEI) was introduced, to which a phosphonate-functionalized ionic liquid (PFIL) was covalently bound, to form superhydrophilic and cationic surface layers with high densities of nitrogen atoms, phosphonate functional groups, and high-loading metal ions. Due to the combined features of superhydrophilicity, flexibility, highly dense metal binding sites, large surface area and excellent size-exclusion effect, the fabricated nanocomposite G@mSiO2@PEI-PFIL-Ti4+ exhibits superior detection sensitivity to enrich phosphopeptides (tryptic ß-casein digest, 0.1 fmol), and extraordinary enrichment specificity to enrich phosphopeptides from a digest mixture of ß-casein and bovine serum albumin (BSA) (molar ratio, 1 : 12 000). The excellent size-exclusion effect was also observed, and 27 endogenous phosphopeptides were identified in human saliva. All these results could be attributed to the unique superhydrophilic nanocomposite structure with a high density of a cationic linker modified with phosphonate functionality. Moreover, G@mSiO2@PEI-PFIL-Ti4+ adsorbents were used to extract phosphopeptides from the tryptic digests of hippocampal lysates for quantitative phosphoproteome analysis. The preliminary results indicate that 1649 phosphoproteins, 3286 phosphopeptides and 4075 phosphorylation sites were identified. A total of 13 Alzheimer's disease (AD)-related phosphopeptides within tau proteins were detected with a wide coverage from p-Thr111 to p-Ser404, in which the amounts of some phoshopeptides at certain sites in AD transgenic mice were found statistically higher than those in wild type littermates. Besides, phosphorylated neurofilament heavy chains, a potential biomarker for amyotrophic lateral sclerosis and traumatic brain injury, were also identified. Finally, the adsorbent was applied to human cerebrospinal fluid (CSF) and blood samples. 5 unique phosphopeptides of neuroendocrine specific VGF were identified in the CSF, while many phosphopeptides originated from the nervous system were found in the blood sample. All these results suggest that our new IMAC materials exhibit unbiased enrichment ability with superior detection sensitivity and specificity, allowing the global phosphoproteome analysis of complicated biological samples more convincible and indicating the potential use in disease diagnosis.

Identification of genetic polymorphisms in unexplained recurrent spontaneous abortion based on whole exome sequencing.

Background: The precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA. Methods: Genomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA. Results: In 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup). Conclusions: These pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

High Expression of PIGC Predicts Unfavorable Survival in Hepatocellular Carcinoma.

PURPOSE: The effects of phosphatidylinositol glycan anchor biosynthesis, class C (PIGC), in the progression of liver cancer are unknown. In this study, we attempted to clarify the clinical significance and mechanism of PIGC in hepatocellular carcinoma (HCC). PATIENTS AND METHODS: To explore the expression profiles, DNA methylation, mutation status, clinical relevance, and prognostic value of PIGC in patients with HCC, a series of bioinformatic databases and websites were searched. Moreover, numerous vitro experiments were performed to investigate the mechanism of PIGC in the regulation of cancerous liver cells. RESULTS: Expression of PIGC mRNA and protein was upregulated in cancerous liver specimens compared with normal liver tissues. High expression of PIGC mRNA was related to higher tumor grade, lymphatic metastasis, advanced TNM stage, and TP53 mutation. High expression of PIGC mRNA predicted more unfavorable overall survival (OS) (HR=1.7, P=0.0028) and disease-free survival (DFS) (HR=1.5, P=0.0067) in patients with liver cancer. The mutation rate of PIGC was 10%, and amplification was the most common mutant type. Expression of PIGC mRNA was negatively regulated by its DNA methylation (r=-0.398, P<0.0001). Moreover, silencing of PIGC in HepG2 cell line inhibited the proliferation and migration and led to cell cycle arrest at G0/G1 stage by reducing cyclinD1, CDK2, CDK4, and CDK6 expression, while overexpression of PIGC in Hcclm3 cell line revealed the opposite effect. CONCLUSION: PIGC is related to aggressive clinical features, and overexpression of PIGC signifies worse survival in patients with HCC. PIGC promotes proliferation and migration of cancerous liver cells through the regulation of the cell cycle.

Construction of breast cancer gene regulatory networks and drug target optimization.

OBJECTIVE: The purpose of this study was to construct the breast cancer gene regulatory networks through the high-throughput techniques and optimize the drug target genes of breast cancer using bioinformatics analysis, and thus accelerate the process of drug development and improve the cure rate of breast cancer. METHODS: The gene expression profile data of breast cancer were downloaded from GEO database and the transcriptional regulation data were obtained from UCSC database. Then we identified the differentially expressed genes (DEGs) by SAM algorithm and built gene regulatory networks by the supervised algorithm SIRENE. Finally, the drug targets of the DEGs with changed regulation relations were optimized based on the CancerResource database. RESULTS: A total of 584 DEGs were identified and the gene regulatory networks in the normal state and tumorous state were constructed. By comparing the new predicted regulatory relation in cancer state and normal state, the regulatory relation of 18 genes was found to be changed in the two states, showing the possibility to be applied as drug target genes. After the searches in the CancerResources, 7 genes were screened as the drug target genes, such as PFKFB3. CONCLUSION: Our present findings shed new light on the molecular mechanism of breast cancer and provide some drug targets which have the potential to be used in clinic for the treatment of breast cancer in future.

Endostar combined with radiotherapy increases radiation sensitivity by decreasing the expression of TGF-ß1, HIF-1α and bFGF.

The aim of the present study was to determine how Endostar inhibits tumor angiogenesis and increases radiation sensitivity when combined with radiotherapy. In vitro studies were conducted to analyze the expression levels of transforming growth factor-ß1 (TGF-ß1), hypoxia-inducible factor 1 (HIF-1α) and basic fibroblast growth factor (bFGF) in lung adenocarcinoma A549 cells, using the antiangiogenesis drug Endostar combined with radiotherapy. In addition, lung adenocarcinoma A549 cell apoptosis was detected via Hoechst staining. The combination of Endostar with radiotherapy was investigated and the results indicated that this combination significantly inhibited tumor cell proliferation and TGF-ß1, HIF-1α and bFGF expression. Changes in gene expression were found to promote apoptosis, thus, enhancing the inhibition of tumor angiogenesis and ultimately inhibiting tumor cell growth, invasion and metastasis.

Cytotoxicity of 5-Aza-2'-deoxycytidine against gastric cancer involves DNA damage in an ATM-P53 dependent signaling pathway and demethylation of P16(INK4A).

The DNA methylation inhibitor 5-Aza-2'-deoxycytidine (5-Aza-CdR) has increasingly attracted worldwide attention for its antineoplastic potential. The cytotoxitic mechanisms, however, especially, the relative contribution of silenced genes reactivation by demethylation and enzyme-DNA adduct formation to the efficacy of 5-Aza-CdR is still a crucial unresolved question. In this investigation, we demonstrated that 5-Aza-CdR treatment resulted in growth suppression in a concentration and time-dependent manner and G2 phrase arrest - hallmarks of a DNA damage response in gastric cancer AGS cells. Formation of DNA double-strand breaks, as monitored by comet assay was examined in an ATM (ataxia-telangiectasia mutated)-dependent manner based on the fact that PI3K inhibitor Wortmannin abolished the action of cytotoxicity of 5-Aza-CdR. Upon treatment with 5-Aza-CdR, ATM activation was clearly associated with P53 phosphorylation at Ser(15), which was directly responsible for 5-Aza-CdR modified P21(Waf1/Cip1) expression. Further exploration revealed that demethylation of P16(INK4A) correlated with the strikingly down-regulated expressions of DNA methyltransferase 3A as well as 3B was, at least in part, attributed to the cytotoxicity of 5-Aza-CdR in AGS cells. Conclusively, these results greatly enhance our understanding of the mechanisms of cytotoxicity of 5-Aza-CdR and strongly provide the preclinical rationale for an assessment of 5-Aza-CdR to ameliorate patient outcome with gastric cancer.

5-Aza-2'-deoxycytidine induces cytotoxicity in BGC-823 cells via DNA methyltransferase 1 and 3a independent of p53 status.

The DNA methylation inhibitor 5-aza-2'-deoxycytidine (5-Aza-CdR) has therapeutic value for the treatment of cancer. However, the mechanism by which 5-Aza-CdR induces antineoplastic activity is not clear. The efficacy of 5-Aza-CdR on the contribution of gene reactivation by demethylation and enzyme-DNA adduct formation is an important unresolved question. The aim of this study was to explore the mechanism of the effect of 5-Aza-CdR on human gastric cancer growth. Human BGC-823 cells were treated with different concentrations of 5-Aza-CdR for different durations. Cell viability, DNA damage and gene expression were determined. The results showed that 5-Aza-CdR at low concentrations induced inhibition of gastric cancer BGC-823 cell proliferation as well as increased apoptosis caused by DNA damage. For the first time, we demonstrated that 5-Aza-CdR-induced cytotoxicity against BGC-823 cells was predominantly regulated via upregulation of DNA methyltransferase 1, 3a and partially via reactivation of RUNX3, which was independent of p53 status and its ability to activate p21Waf1/Cip1 expression. To our knowledge, this is the first demonstration of p53-independent 5-Aza-CdR action on DNA methyltransferases and demethylation. These results strongly provide the preclinical rationale for the clinical evaluation of 5-Aza-CdR to improve patient outcome in gastric cancer.

Synergistic gastric cancer inhibition by chemogenetherapy with recombinant human adenovirus p53 and epirubicin: an in vitro and in vivo study.

This study was designed to investigate the in vitro and in vivo antitumor effect on SGC-7901 gastric cancer cells by chemogenetherapy. SGC-7901 cells were treated by chemogenetherapy with Gendicine, a recombinant human Ad-p53 injection (rAd-p53), and epirubicin hydrochloride (EPI), a cytotoxic chemotherapy agent. Compared with blank control, rAd-p53, EPI, and combined therapy achieved SGC-7901 growth inhibition by 32.26, 35.48, 43.44%, respectively on day 1 and 70.62, 78.82, 87.15%, respectively on day 2 (rAd-p53, EPI VS control, p<0.01; rAd-p53+EPI VS either alone, p<0.05). Flow cytometry study confirmed that rAd-p53 and/or EPI mainly inhibit the cell cycle at S phase. SGC-7901 cells were subcutaneously injected into the nude mice to form xenograft models, which were treated with rAd-p53 and EPI. Compared with the blank control, treatment with rAd-p53 at the dose of 10 µl of 10(12) vp/ml and EPI at the dose of 1.25 mg/kg, 7 times in 3 weeks, resulted in 80 and 60% of tumor growth inhibition, respectively. No animal death was observed, although 2 nude mice in rAd-p53 group developed liver toxicity and 1 nude mouse in EPI group developed cardiac toxicity. rAd-p53 and EPI have synergistic tumor inhibition effect on gastric cancer cells.

[Association of MLH1 gene 415G/C polymorphism with colorectal cancer in Chinese].

OBJECTIVE: To study the possible etiological role of MLH1 gene 415G/C polymorphism in sporadic Chinese colorectal cancer (CRC) patients. METHODS: Ninety-seven sporadic CRC patients and 138 normal controls were collected from Hubei Provincial Cancer Hospital and the People's Hospital of Wuhan University. In addition, five CRC families including 6 patients and their 19 first-degree relatives were also recruited. Genomic DNA was extracted from peripheral blood samples. Gene mutation was analyzed by PCR-RFLP. MLH1 mRNA expression in colorectal mucosa was analyzed by RT-PCR. RESULTS: The frequency of MLH1 gene CC genotype was significantly higher in sporadic CRC patients than that in controls (P=0.035, OR=5.29, 95% CI: 1.07-26.04). In the CRC families, the C allele frequency of CRC patients and their relatives was increased, compared with sporadic CRC patients and normal controls, respectively (P=0.003 and P=0.006). MLH1 mRNA expression of colorectal mucosa was similar in different genotypes. CONCLUSION: MLH1 gene 415G/C polymorphism might be a risk factor to sporadic CRC in Chinese. The mutation does not affect the MLH1 mRNA expression. For first-degree relatives from CRC families, carriers of MLH1 415C allele have a high risk to CRC.