RESUMO
The stressed environment of the inclined coal seam roadway is complex and changeable, and the damage degree of surrounding rock increases, threatening the safe mining of coal mines. In order to take targeted support measures to control the stability of roadway surrounding rock, it is very important to study the stress and deformation characteristics of roadway surrounding rock in inclined coal seam. Therefore, this paper analyzes the deformation and failure law of inclined coal seam roadway according to the theory of complex variable function. It optimizes the solution process and accuracy of the mapping function coefficient and deduces the analytical solution of surrounding rock stress and deformation inclined coal seam roadway. The deformation and failure mechanism of surrounding rock in inclined coal seam roadway is revealed theoretically, and further use numerical simulation and physical simulation tests for supplementary analysis and verification. The results show that the stress and deformation of roadway surrounding rock in inclined coal seam show obvious asymmetric distribution characteristics. The stress and deformation of roadway surrounding rock on the right side are greater than on the left side. The two sides of the roadway, the right side of the roof and the roof angle of the right side, are the key positions of roadway stress concentration and deformation. According to the variation law of stress and deformation distribution of roadway surrounding rock, roadway cyclic deformation and failure theory is put forward. The numerical simulation and physical simulation tests show that the deformation and failure law of roadway is consistent with the theoretical analysis results, and there are differences in numerical values. The cyclic deformation and failure mechanism of roadway in inclined coal seam is verified, which can provide theoretical guidance for roadway support design.
RESUMO
A 23-year-old woman had dry cough, fever and chest tightness for 1 months. Through thoracic CT scan and serological examination, the patient was clinically diagnosed as disseminated tuberculosis. she was given anti-tuberculosis therapy combined with autologous cytokine-induced killer (CIK) immunotherapy. Through the close follow-ups we found that after immunotherapy Her condition would have a swift improvement and she do not appear liver damage after a large doses of antibiotic therapy. In conclusion, adjuvant autologous CIK immunotherapy is an effective approach for disseminated tuberculosis.
Assuntos
Células Matadoras Induzidas por Citocinas/transplante , Imunoterapia Adotiva/métodos , Qualidade de Vida , Tuberculose Miliar/diagnóstico por imagem , Tuberculose Miliar/terapia , Autoenxertos , Células Matadoras Induzidas por Citocinas/imunologia , Feminino , Seguimentos , Humanos , Medição de Risco , Índice de Gravidade de Doença , Tomografia Computadorizada por Raios X/métodos , Resultado do Tratamento , Tuberculose Miliar/fisiopatologia , Adulto JovemRESUMO
ObjectiveTo established a cell line that expresses hBD1 stably,and detected the antimicrobial activity of the hBD1 to the muhidrug resistant bacterial strains.MethodsRecombinant plasmid was introduced into COS-7 cells by lipofectamine,cells were selected in culture medium containing G418 to acquired the monoclonal cell lines,total RNA were extracted from the cultured cells,expression levels of hBD1 mRNA was identified by RT-PCR,collected the supernatant solution of the cultured cell,expression levels of protein was identified by Western blot.Put the expression products and resistant organisms mixed together,after incubation in different times in 37℃,coating the mixtures in LB flat,then obtained the ratios between colonies number of experimental groups and colonies number of control groups,put those ratios as the survival rate of the drug resistance bacterias.Results The monoclonal cell lines had obtained after screened with G418,the hBD1 gene could be detected both at transcriptional and protein levels,Under the influence of expression product hBD1,survival rate of muhidrug-resistant Acinetobacter baumannii,multidrug-resistant Escherichia coli and multidrug-resistant Klebsiella pneumoniae could reduced to 9%,22% and 50%,but survival rate of multidrug-resistant Stenotrophomonas maltophilia is not have apparente difference with the control group.ConclusionThe stably-transfected cell line of hBD1 was successfully constructed,and the expression products of hBD1 showed the antimicrobial activity toward multidrug resistant bacterial strains.
RESUMO
AIM: To investigate the developmental regulation of β-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P1: TTCAGTCATGAGGATCCATT AC; P2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS: Rat β-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION: The rat β-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that β-defensin-2 may play a role in the lung innate defense against infection.
RESUMO
AIM: To study the regulation of rat ?-defensin-2 gene expression by bacteria.METHODS: E.coli ML-35 p and pseudomonas aeruginosa were injected into rat trachea. Total RNA was isolated from lung tissue after 24 h inoculation. RT-PCR and Northern blot were performed to detect ?-defensin-2 ( rBD-2 ) mRNA expression.RESULTS: The expression of rBD-2 gene was inhibited in the lung tissue by E.coli infection, but not by pseudomonas aeruginosa. CONCLUSION: These results indicated that E.coli infection could down-regulate rBD-2 gene expression in the rat lung tissues.
RESUMO
AIM: To investigate the developmental regulation of ?-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P 1: TTCAGTCATGAGGATCCATT AC; P 2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS: Rat ?-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION: The rat ?-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that ?-defensin-2 may play a role in the lung innate defense against infection.