Nanocrystalline cellulose-fullerene: Novel conjugates.

The covalent grafting of two amino-fullerene C60 derivatives (C60-LC-NH2 and C60-SC-NH2, LC=long chain and SC=short chain) onto the surface of TEMPO oxidized nanocrystalline cellulose (NCC-COOH) has been reported for the first time. These hybrids (NCC-LC-C60 and NCC-SC-C60) form stable colloidal suspensions at concentrations up to 0.5mg/mL and act as effective photosensitizers for singlet oxygen production as demonstrated by the oxidation of L-methionine-methyl ester to the corresponding sulphoxide. Using the same approach, in a one-pot reaction both a fluorescent target molecule (FITC-LC-NH2) and the C60-LC-NH2 derivative have been successfully attached covalently onto the NCC-COOH surface. These hybrids, which showed no cytotoxicity on MCF-7 human breast cancer cells could be good candidates in photodynamic cancer therapy.

Lipid-modified G4-decoy oligonucleotide anchored to nanoparticles: delivery and bioactivity in pancreatic cancer cells.

KRAS is mutated in >90% of pancreatic ductal adenocarcinomas. As its inactivation leads to tumour regression, mutant KRAS is considered an attractive target for anticancer drugs. In this study we report a new delivery strategy for a G4-decoy oligonucleotide that sequesters MAZ, a transcription factor essential for KRAS transcription. It is based on the use of palmitoyl-oleyl-phosphatidylcholine (POPC) liposomes functionalized with lipid-modified G4-decoy oligonucleotides and a lipid-modified cell penetrating TAT peptide. The potency of the strategy in pancreatic cancer cells is demonstrated by cell cytometry, confocal microscopy, clonogenic and qRT-PCR assays.

The chlorophyll catabolite pheophorbide a as a photosensitizer for the photodynamic therapy.

Pheophorbide a is a clorophyll catabolite that recently has drawn the attention of several investigators for its potential in photodynamic therapy. In this review we summarize its photophysical properties, phototoxicity, cellular localization, biodistribution and PDT activity as a free or conjugated molecule.

The effect of INA [(R)-1-O-(1-pyrenylmethyl)glycerol] insertions on the structure and biological activity of a G-quadruplex from a critical KRAS G-rich sequence.

Quadruplex-forming oligonucleotides containing INA [(R)-1-O-(1-pyrenylmethyl)glycerol] insertions have been designed and studied for their capacity to inhibit the expression of the KRAS oncogene in pancreatic adenocarcinoma cells. It is found that INA can influence the folding topology of the G-quadruplex. The oligonucleotides forming the most stable G-quadruplex (ODN-637) is found to exhibit the highest bioactivity.

Transcription inhibition of oncogenic KRAS by a mutation-selective peptide nucleic acid conjugated to the PKKKRKV nuclear localization signal peptide.

Mutations in the Kirsten ras (KRAS) gene are present in almost all pancreatic adenocarcinomas, and one common mutation is at codon 12: GGT (Gly) is transformed into GAT (Asp). In this work we have targeted the KRAS coding sequence embracing the GAT mutation with a sense PNA molecule (P14), with the aim of downregulating the expression of the mutant allele. P14 was designed with a 15-base sequence complementary to the antisense strand of KRAS at the GAT (Asp) mutation and conjugated to the nuclear localization signal peptide PKKKRKV. CD spectra as a function of temperature show that P14 (2 microM) binds to the antisense strand of the GAT target in the mutated allele with a T(M) of 78 degrees C and to the antisense strand of the GGT target in the wild-type allele with a T(M) of 69 degrees C, in 50 mM Tris-HCl, pH 7.4, and 1 M NaCl. Moreover, P14 showed a high capacity to enter and accumulate in the nuclei of pancreatic cells (Panc-1 and BxPC3), whereas the nonconjugated analogue did not. Quantitative RT-PCR showed that 1 microM P14 was able to specifically suppress KRAS transcription in Panc-1 cells, which harbor mutant KRAS, but not in BxPC3 cells, which contain only wild-type KRAS. However, P14 inhibited KRAS transcription also in BxPC3 cells when used at concentrations of 5 and 10 microM. Following a single PNA treatment, changes in protein level were evident only in Panc-1 cells. As we found that all three genes of the ras family are expressed in the pancreatic cells, we designed PNA-NLS conjugates (P16 and P17) to target also HRAS and NRAS. The binding of each PNA conjugate to the ras genes was assayed by electrophoresis, and their capacity to inhibit transcription was measured by RT-PCR. All of the data obtained, both in vivo and in vitro, are discussed in terms of sequence specificity in the binding between PNA-NLS molecules and genomic DNA.

Anti-gene strategies to down-regulate gene expression in mammalian cells.

A current goal in molecular medicine is the development of new strategies for the selective inhibition of cancer-critical genes. Triplex-forming oligonucleotides and peptide nucleic acids bind to the double helix of DNA in a sequence-specific manner and with great affinity. Because of these properties, these molecules have been proposed as anti-gene therapeutic drugs. This review summarizes recent results on the use of oligonucleotides and peptide nucleic acids to downregulate gene expression in cultured cells. The data are discussed from the perspective of the recent literature on new molecular strategies with potential therapeutic applications.

Targeting neighbouring poly(purine.pyrimidine) sequences located in the human bcr promoter by triplex-forming oligonucleotides.

Most poly(purine.pyrimidine) [poly(R.Y)] sequences in eukaryotic genomes are interrupted by one or more base pair inversions. When the inversions are centrally located, the poly(R.Y) sequences can be regarded as the sum of two abutting sites, each potentially capable of forming a triple helix. Employing band-shift, footprinting and modeling methods we examined the formation of triple helices at a critical 27 bp poly(R.Y) sequence interrupted by two adjacent CG inversions, and located in the promoter of the human bcr gene at transcription initiation. We designed several 13-mer and 14-mer triplex-forming oligonucleotides (TFOs) capable of binding the bcr abutting sites, thereby generating different base juxtapositions at the triple helical junction, to examine whether triplex formation occurs in a cooperative manner. It is found that in 50 mM Tris/HCl, pH 7.4, 10 mM MgCl2, 2 mM spermine, 37 degrees C, the 13-and the 14-mer TFOs bind to one half of the bcr site with Delta G between -30 and -35 kJ x mol-1. However, when different 13-mer/14-mer combinations of TFOs were directed against the abutting poly(R x Y) sites, triplex formation has been found to be enhanced only for the triple helical junction formed by the 5'-A-T-3' base juxtaposition, in keeping with a partial stacking suggested from modeling analysis. On the other hand, a longer 24-mer TFO, binding noncooperatively to the same abutting sites, forms a much more stable triplex (Delta G = -51 kJ x mol-1), notwithstanding the two T x CG triads in the middle. Modeling investigations reveal that there is no continuity or propagation of base stacking involving adjacent bases of the third strand at the site of base inversion as well as on the 5' side. The data indicate that the entropy penalty of forming a triplex with two oligonucleotides is much higher than the energy gained from base stacking interactions at the triplex junction formed between the two TFOs.

Formation of triple helices at irregular poly (R.Y) sites located in critical positions in the human bcr promoter.

Two polypurine sequences interrupted respectively by one and two adjacent pyrimidines have been identified in the promoter of the human bcr gene. Although these targets are irregular they are recognised and tightly bound by AG and GT motif triplex-forming oligonucleotides. Thermodynamic and kinetic data are presented.

Reduction of mdr1 gene amplification in human multidrug-resistant LoVo DX cell line is promoted by triple helix-forming oligonucleotides.

We have demonstrated previously that the GT triplex-forming oligodeoxyribonucleotide (TFO) d(TGTGTTTTTGTTTTGTTGGTTTTGTTT), named TFO ID, targeted to a polypyrimidine-polypurine coding sequence located within human multidrug-resistance mdrl gene, specifically and significantly reduced mdrl mRNA levels in the drug-resistant T-leukemic CEM-VLB100 cell line. In this article, we demonstrate that TFO 1D is effective at inhibiting not only transcription but also replication of mdrl genes, leading to a loss of amplified gene copies in the drug-resistant colon adenocarcinoma LoVo DX cell line. In contrast, TFO ID does not alter replication of the constitutive mdrl gene copy in the corresponding parental sensitive LoVo 109 cell line. A specific reduction in mdrl gene amplification levels was also obtained with the pyrimidine TFO d(CTTTTTCTTTTCTTCCTTTTCTTT), named TFO 24TC, directed against the same polypyrimidine-polypurine sequence of the mdrl gene. We suggest that triple helix-forming oligonucleotides might affect the replication of unstable chromosomal elements as amplicons in actively replicating cells by causing a local impairment of DNA polymerase activity. This study lends support to the notion that TFO may be used to reduce gene amplification aiming to control neoplastic progression in cancer cells bearing amplified oncogenes.

Effect of cations on purine.purine.pyrimidine triple helix formation in mixed-valence salt solutions.

The effect of various monovalent, divalent and oligovalent cations on the reaction of triplex formation by GT and AG motif triplex-forming oligonucleotides, designed to bind to biologically relevant polypurine-polypyrimidine sequences occurring in the promoters of the murine Ki-ras and human bcr genes, has been investigated by means of electrophoresis mobility shift assays (EMSA) and DNase I footprinting experiments. We found that in the presence of 10 mm MgCl2 the triple helices were progressively destabilized by adding increasing amounts of NaCl, from 20 to 140 mm, to the solution. We also observed that, while the total monovalent-ion concentration was constant at 100 mm, the exchange of sodium with potassium, but not lithium, results in a further destabilization of the triple helices, due to self-association equilibria involving the G-rich triplex-forming oligonucleotides. Potassium was found to destabilize triplex DNA even when the triple helices are preformed in the absence of K+. However, footprinting experiments also showed that the inhibitory effect of K+ on triplex DNA is partially compensated for by millimolar amounts of divalent transition metal ions such as Mn2+ and Ni2+, which upon coordinating to N7 of guanine are expected to enhance hydrogen-bond formation between the target and the third strand, and to reduce the assembly in quadruple structures of G-rich triplex-forming oligonucleotides. Triplex enhancement in the presence of potassium was also observed, but to a lesser extent, when spermine was added to the reaction mixture. Here, the ion effect on triplex DNA is rationalized in terms of competition among the different valence cations to bind to triplex DNA, and differential cation stabilization of unusual quadruplex structures formed by the triplex-forming oligonucleotides.

Widespread presence in mammals and high binding specificity of a nuclear protein that recognises the single-stranded telomeric motif (CCCTAA)n.

We have recently identified a protein in HeLa nuclear extracts which recognises the single-stranded telomeric sequence (CCCTAA)n in vertebrates [Marsich, E., Piccini, A., Xodo, L. E. & Manzini, G. (1996) Nucleic Acids Res. 24, 4029-4033]. In this paper we provide further experimental evidence, using electrophoretic mobility shift assays, SDS/PAGE after ultraviolet cross-linking, and gel permeation chromatography techniques, that: (a) this protein displays remarkably stringent requirements for the telomeric motif sequence, as (CCCTAAA)n, (CCCCAA)n and (TCCCAA)n are tightly bound, but (CCTAA)n is not; (b) it requires at least four CCC-block repeats properly spaced to bind strongly to DNA, e.g. the polypurine stretch of the murine Ki-ras promoter d(CTCCCTCCCTCCCTCCTTCCCTCCCTCCC), the CarG-motif-containing sequence d(CCATTTCCTAATTAGGTAAAAG), and d(C)22 are not recognised by this protein; (c) it is present in nuclear extracts from several vertebrate sources including human, rat, pig, hamster and chicken; (d) its molecular mass is about 40 kDa, as determined by SDS/ PAGE and non-denaturing gel permeation chromatography, suggesting that this protein is monomeric under native conditions.

Formation of stable DNA triple helices within the human bcr promoter at a critical oligopurine target interrupted in the middle by two adjacent pyrimidines.

Antigene strategies based on the use of triplex-forming oligonucleotides (TFO) as artificial repressors are constrained by the need for genomic targets with a polypurine-polypyrimidine [poly (R.Y)] DNA motif. In this study, we demonstrate that both A/G and G/T motif oligonucleotides recognize and bind strongly to a critical polypurine sequence interrupted in the middle by two adjacent cytosines and located in the promoter of the human bcr gene at the transcription initiation. The interaction between the designed TFO and this irregular poly (R.Y) target has been studied using a number of techniques, including electrophoretic mobility shift assay (EMSA), circular dichroism (CD), DNase I, and dimethyl sulfate (DMS) footprinting. Although CD shows that the 24-mer TFO self-aggregate in solution, they bind to the bcr target at 37 degrees C, forming stable triplexes that do not dissociate during electrophoretic runs performed up to 50 degrees C in 50 mM Tris-acetate, pH 7.4, 10 mM MgCl2, 50 mM NaCl (buffer A). We used EMSA to determine the equilibrium dissociation constants (Kd) for the reaction T <==> D + TFO at 37 degrees C, either in buffer A or in 50 mM Tris-acetate, pH 7.4, 10 mM MgCl2, 5 mM NaCl (buffer B). The triplexes were found to be more stable in buffer B, a behavior that can be rationalized in terms of monovalent and divalent cation competition for binding to DNA. Footprinting experiments showed that the TFO interact with the irregular poly (R.Y) target in a highly sequence-specific way and that the A/G motif oligonucleotide, juxtaposing T to the double CG inversions of the target, formed the most stable triplex (e.g., 1 microM TFO promoted strong footprints at 37 degrees C). These triplexes, except the one containing two A.C.G mismatched triads, are not destabilized under near physiologic conditions, that is, in 50 mM Tris-acetate, pH 7.4, 80 mM KCl, 20 mM NaCl, 2 mM spermidine. Moreover, we found that guanine N7 in T.C.G and guanine N7 in A.C.G are both accessible to DMS and that the first is less reactive than the second. In conclusion, the results of this study indicate that a critical sequence in the human ber promoter may be used as a potential binding site for TFO designed to repress artificially the transcription of the fused bcr/abl gene expressed in leukemia cells.

A kinetic study of triple-helix formation at a critical R x Y sequence of the murine c-Ki-ras promoter by (A,G)- and (G,T) oligonucleotides.

The kinetics of triplex formation between the oligonucleotides d(AGGGAGG-GAGGAAGGGAGGG) (20AG), d(TGGGTGGGTGGTTGGGTGGG) (20GT) and a 29-bp polypurine-polypyrimidine sequence located in the c-Ki-ras promoter (D) was studied by electrophoretic experiments in 50 mM Tris/acetate, pH 7.4, 50 mM NaCl, 5 mM MgCl2. Rates of triplex formation were determined at three different temperatures (20 degrees C, 37 degrees C and 45 degrees C), under pseudo-first order conditions obtained by using the triplex-forming oligonucleotide (TFO) 500-fold in excess over the target duplex (5 nM). Measurements at TFO/target ratios of 20 and 100 were also carried out. At 37 degrees C the pseudo first-order constants, k(obs), were 18.9 x 10(-5) s(-1) for 20AG and 13.0 x 10(-5) s(-1) for 20GT, yielding association half-lives of 1 h and 1.5 h, respectively. Second-order association constants were found to be in the order of 10(2) M(-1) s(-1): these are slightly lower if compared with those measured for triplex formation by polypyrimidine (C,T) oligonucleotides (10(3) M(-1) s(-1)) [Maher, L. J., Dervan, P. B. & Wolf, B. J. (1990) Biochemistry 29, 8820-8826; Xodo, L. E. (1995) Eur. J. Biochem. 228, 918-926; Bates, P. J., Dosanjh, H. S., Jenkins, T. C., Laughton, C. A. & Neidle, S. (1995) Nucleic Acids Res. 23, 3627-3632] but dramatically lower when compared with duplex recombination from complementary strands (10(6) M(-1) s(-1)) [Craig, M. E., Crothers, D. M. & Doty, P. (1971) J. Mol. Biol. 62, 383-401; Pörschke, D. & Eigen, M. (1971) J. Mol. Biol. 62, 361-381]. Dissociation rate constants, k(-1), were indirectly obtained from equilibrium constants (Kd) and found to be, at 37 degrees C, 6.7 x 10(-7) s(-1) and 5.4 x 10(-6) s(-1) for 20AG and 20GT, respectively. From the rate constants obtained at 20 degrees C, 37 degrees C and 45 degrees C we estimated activation energies of triplex formation between D plus 20AG and D plus 20GT of respectively 134 +/- 29 and 88 +/- 21 kJ/mol. Moreover, the activation energies for the reaction of triplex dissociation were 385 +/- 50 kJ/mol for 20AG and 330 +/- 42 kJ/mol for 20GT. Decreasing the TFO/target ratio from 500 to 100 or 20, we observed a concomitant decrease of the association rate, in keeping with the finding that triplex formation occurs through a bimolecular process. We found that the effect of salt on triplex formation is rather complex, as, the addition of 2 mM spermidine boosted the binding rate of 20GT, but slightly reduced that of 20AG; the increase of NaCl from 50 mM to 100 mM or 150 mM decreased the rate of triplex formation. Finally, the biological implications of the kinetic behaviour exhibited by the two triplex-forming oligonucleotides specific for the c-Ki-ras promoter are discussed.

(A,G)-oligonucleotides form extraordinary stable triple helices with a critical R.Y sequence of the murine c-Ki-ras promoter and inhibit transcription in transfected NIH 3T3 cells.

The promoter of the murine c-Ki-ras proto-oncogene contains a critical homopurine-homopyrimidine sequence which is recognized by a protein factor and is a potential site for triplex-forming oligonucleotides (TFOs). The TFOs designed to bind this critical c-Ki-ras target have either an AG or a GT sequence motif. Of the two types, the first is found to form triplexes with extraordinarily high stability. For instance, both d(AGGGAGGGAGGAAGGGAGGG) (20AG) and d(GGGAGGGAGGGAAGGAGGGAGGGAGGGAGC) (30AG) are able to bind the c-Ki-ras target at 65 degrees C and to resist a polyacrylamide gel temperature of 55 degrees C. By contrast, the triplex formed by d(TGGGTGGGTGGTTGGGTGGG) (20GT) is largely dissociated at a gel temperature of 55 degrees C. The affinity constants of the TFOs at 37 degrees C, 50 mM Tris-HCl, pH 7.4, 50 mM NaCl, 5 mM MgCl2 (standard buffer) were determined through band-shift experiments and found to be respectively 1.0 x 10(6), 4.0 x 10(6), and 2.5 x 10(7) M-1 for 20GT, 30AG, and 20AG. The AG-triplexes exhibit in standard buffer monophasic melting profiles (Tm approximately 75 degrees C) and circular dichoroism spectra showing the typical negative ellipticity at 212 nm, which is a hallmark for triplex DNA. The rate at which the TFOs bind to the c-Ki-ras target at 37 degrees C was examined under pseudo-first-order conditions. When the TFOs are in excess over the target and in the micromolar concentration range, the kinetics of triplex formation are slow, characterized by association half-lives of about 1 h. The ability of the TFOs to act as artificial transcription repressors was examined in a cellular system employing transient transfection experiments. Cultured NIH 3T3 fibroblast cells were cotransfected with a DNA mixture composed by a TFO and plasmid pKRS-413 containing the chloramphenicol acetyltransferase (CAT) gene driven by the c-Ki-ras promoter. It was found that the CAT activity is specifically inhibited by the TFOs in a dose-dependent manner. As expected, stronger CAT repression is obtained with 20AG, the oligonucleotide which forms the more stable triplex. These data suggest that (A,G)-oligonucleotides may provide a valuable means for the selective repression of the c-Ki-ras gene expression.

Evidence for a HeLa nuclear protein that binds specifically to the single-stranded d(CCCTAA)n telomeric motif.

In recent years several telomere binding proteins from eukaryotic organisms have been identified that are able to recognise specifically the duplex telomeric DNA repeat or the G-rich 3'-ending single strand. In this paper we present experimental evidence that HeLa nuclear extracts contain a protein that binds with high specificity to the single-stranded complementary d(CCCTAA)n repeat. Electrophoretic mobility shift assays show that the oligonucleotide d(CCCTAACCCTAACCCTAACCCT) forms a stable complex with this protein in the presence of up to 1000-fold excesses of single-stranded DNA and RNA competitors, but is prevented from doing so in the presence of its complementary strand. SDS-PAGE experiments after UV cross-linking of the complex provide an estimate of 50 kDa for the molecular weight of this protein.

Guanine-rich oligonucleotides targeted to a critical R . Y site located in the Ki-ras promoter. The effect of competing self-structures on triplex formation.

The promoter of the murine Ki-ras proto-oncogene contains a (C+G)-rich homopurine . homopyrimidine (R . Y) sequence that is essential for transcription activity. We have designed two G-rich oligonucleotides, d(TGGGTGGGTGGTTGGGTGGG) (20GT) and d(AGGGAGGGAGGAAGGGAGGG) (20AG), that have the potential to bind the critical Ki-ras sequence via triplex-helix formation. Band-shift experiments have shown that 20GT binds the Ki-ras R . Y duplex with a delta G value of -40 +/- 5 kJ/mol, while 20AG appeared to have a lower affinity under the experimental conditions adopted: 50 mM Tris/HCl, pH 7.4, 50 mM NaCl, 5 mM MgCl2, 25 degrees C. In the absence of Mg2+, 20GT did not bind to the Ki-ras R . Y target, while 20AG exhibited the same affinity observed in the magnesium-containing buffer. To gain insight into the solution properties of 20GT and 20AG, we have performed several experiments including polyacrylamide gel electrophoresis (PAGE), hydroxyapatite chromatography, ultraviolet absorption melting and circular dichroism (CD). We found that 20AG rapidly self-associates into presumably a duplex, even at low concentration (< 1 microM), while 20GT forms aggregates slowly, a process favoured by high oligonucleotide concentrations (> 25 microM). The critical Ki-ras sequence was inserted in Bluescript KS+, downstream from the T7 promoter, to investigate to what extent 20AG and 20GT, which are directed against the R . Y target, are able to inhibit T7 RNA polymerase transcription, under near-physiological conditions. Transcription experiments conducted in vitro at pH 7.4 have shown that oligonucleotide 20GT produced a remarkable repression of T7 RNA polymerase activity in the concentration range (10-25 microM), whereas 20AG had little effect on transcription. In conclusion, the results of this work together with other data reported in the literature [Olivas, W. M. & Maher, L. J. III (1995) Biochemistry 34, 278-284; Noonberg, S. B., François, J.-C., Garestier, T. & Hélène, C. (1995) Nucleic Acids Res. 23, 1956-1963], demonstrate that G-rich oligonucleotides, in particular (G,A)-sequences, may raise problems for in vivo application due to self-aggregation.

Characterization of the DNA triplex formed by d(TGGGTGGGTGGTTGGGTGGG) and a critical R.Y sequence located in the promoter of the murine Ki-ras proto-oncogene.

The binding of the G-rich oligonucleotide d(TGGGTGGGTGGTTGGGTGGG) to a critical homopurine-homopyrimidine sequence located in the promoter of the murine Ki-ras proto-oncogene has been investigated. The duplex and the oligonucleotide form a triple helix as evidenced by band-shift electrophoresis, hydroxyapatite (HA) chromatography, UV-melting and circular dichroism (CD) experiments. Upon thermal denaturation in 50 mM Tris-acetate, pH 7.4, 50 mM NaCl, 10 mM MgCl2, 0.1 mM spermine the triplex exhibits two cooperative transitions: one of these is attributed to the triplex-to-duplex transformation, the other to the duplex-to-coil transformation. The thermodynamic parameters of triplex formation have been determined by a van't Hoff analysis of the UV-melting curves which provided values of delta H = 79 +/- 8 kcal/mol, delta S = 224 +/- 22 e.u., delta G298 = 12.2 +/- 1.2 kcal/mol. These data are compared with those reported for the YRY triplex motif.

Kinetic analysis of triple-helix formation by pyrimidine oligodeoxynucleotides and duplex DNA.

The kinetics of triple-helix formation by the pyrimidine oligonucleotide d(CTTTCCTTCTTCTTTCCC) (TFO) and the homopurine.homopyrimidine (R.Y) duplex, whose purine strand is d(TGAAAAAGAAAGGAAGAAAGGG), (D), was studied using ultraviolet absorbance decay measurements, in 50 mM Tris/acetate, pH 6, 50 mM NaCl, 10 mM MgCl2. The decay curves were obtained by a static method, measuring as a function of time the hypochromicity at 270 nm produced by D and TFO after mixing under conditions favorable for triplex formation. This approach allowed direct measurement of triplex formation as it proceeded. The kinetic experiments were carried out at temperatures below the tm of the triplex, i.e. at 17-33 degrees C, and at two different D:TFO ratios, 1:1 and 1:10. When D and TFO were mixed in equimolar amounts, 1.7 microM each, the kinetics of triplex formation were characterized by half-decay times, t1/2, of 150-390 s. By contrast, when TFO was in tenfold excess [14 (mumol TFO).l-1] over D [1.4 (mumol D).l-1], the kinetics were faster and the t1/2 decreased to 19-26 s. Different rate equations have been used to describe the kinetics of triplex formation under these two different conditions. Both sets of experiments provided second-order rate constants, k1, of approximately 10(3) l.(mol TFO)-1.s-1 which showed a slight decrease with temperature. The rate of triplex formation appeared to be about three order of magnitude slower than the rate of duplex recombination, whose rate constant is in the order of 10(6) l.(mol oligomer)-1.s-1 [Craig, M. E., Crother, D. M. & Doty, P. (1971) J. Mol. Biol. 62, 383-401; Pörschke, D. & Eigen, M. (1971) J. Mol. Biol. 62, 361-381; Nelson, J. W. & Tinoco, I, Jr (1982) Biochemistry 21, 5289-5295]. The apparent activation energy associated with the rate constants of triplex formation was small and negative (E1 = -26 +/- 15 kJ/mol). The first-order rate constants of triplex dissociation, k-1, strongly dependent on temperature and were in the range 10(-7) s-1 (at 20 degrees C) to 10(-5) s-1 (at 33 degrees C), with an apparent activation energy that was large and positive (E-1 = 355 +/- 33 kJ/mol). The rate of triplex formation also showed a significant dependence on the ionic strength (I) of the buffer solution. A decrease of I from 130 M to 57 M resulted in a sixfold decrease of the association constant, from 2.16 x 10(3) to 0.36 x 10(3) l.(mol TFO)-1.s-1, at 22.5 degrees C.(ABSTRACT TRUNCATED AT 400 WORDS)

Inhibition of T7 RNA polymerase transcription by phosphate and phosphorothioate triplex-forming oligonucleotides targeted to a R.Y site downstream from the promoter.

The effect of triplex-forming oligonucleotides (TFO) on the transcription activity of T7 RNA polymerase has been investigated by an in vitro assay. The TFOs, either containing only phosphate (PO2) or phosphate and phosphorothioate (POS) internucleotide linkages, were targeted to a 30-bp homopurine. homopyrimidine (R.Y) site cloned in plasmid Bluescript KS+ about four helical turns downstream from the T7 RNA promoter. Band-shift and ultraviolet absorption melting experiments showed that the designed pyrimidine PO2 and POS TFOs form stable triple-helical complexes with the R.Y target duplex (the delta GTFO values of triplex formation vary from -42 to -63 kJ/mol). The triple-helical complexes resulting from POS oligonucleotides were less stable (by 4-12 kJ/mol) than those obtained with PO2 analogues, the magnitude of destabilization being dependent on the number of POS groups present in the third strand. The designed TFOs were shown to efficiently repress bacteriophage T7 RNA polymerase transcription under different experimental conditions. The repression depended on pH, TFO concentration and temperature. When the TFO/template ratio was fixed to 100, a strong repressive effect was observed with normal and phosphorothioate pyrimidine TFOs, also under physiological conditions. In contrast, a purine-rich oligonucleotide containing 44% of guanine residues promoted only a weak transcription inhibition, even at a TFO/template ratio as high as 750. Both PO2- and POS-containing pyrimidine TFOs produced their strong repressive effect on T7 RNA polymerase transcription even when they were added to the reaction mixture simultaneously with the polymerase. A mechanism of transcription repression is discussed. The data reported in this paper are useful for designing oligonucleotides acting as artificial repressors in the antigene strategy and indicate that the R.Y target need not to be precisely confined to the promoter.

Evidence for intramolecularly folded i-DNA structures in biologically relevant CCC-repeat sequences.

The structural behaviour of repetitive cytosine DNA is examined in the oligodeoxynucleotide sequences of (CCCTAA)3CCCT (HTC4), GC(TCCC)3TCCT(TCCC)3 (KRC6) and the methylated (CCCT)3TCCT(CCCT)3C (KRM6) by circular dichroism (CD), gel electrophoresis (PAGE), and ultra violet (UV) absorbance studies. All the three sequences exhibit a pH-induced cooperative structural transition as monitored by CD. An intense positive CD band around 285 nm develops on lowering the pH from 8 to slightly acidic condition, indicative of the formation of base pairs between protonated cytosines. The oligomers are found to melt in a fully reversible and cooperative fashion, with a melting temperature (Tm) of around 50 degrees C at pH 5.5. The melting temperatures are independent from DNA concentration, indicative of an intramolecular process involved in the structural formation. PAGE experiments performed with 32P-labeled samples as well as with normal staining procedures show a predominantly single band migration for all the three oligomers suggestive of a unimolecular structure. From pH titrations the number of protons required for generating the structures formed by HTC4, KRC6 and KRM6 results to be around six. These findings strongly suggest that all the three sequences adopt an intramolecular i-motif structure. The demonstration of i-motif structure for KRC6, a critical functional stretch of the c-ki-ras promoter proto-oncogene, besides the human telomeric sequence HTC4, may be suggestive of larger significance in the functioning of DNA.