Evaluating the Impact of an Organic Trace Mineral mix on the Redox Homeostasis, Immunity, and Performance of Sows and their Offspring.

The objective of the study was to evaluate the effects of trace mineral supplementation in sows during gestation and lactation on the performance and health status of sows and their offspring. Sows (n = 30; Landrace × Yorkshire; avg parity = 3.9) were randomly allocated into two dietary treatments. Sows received a basal diet supplemented with 12 mg/kg Cu, 30 mg/kg Fe, 90 mg/kg Zn, 70 mg/kg Mn, 0.30 mg/kg Se, and 1.5 mg/kg I from an inorganic trace mineral source (ITM) or a blend of hydroxychloride and organic trace mineral source (HOTM) from day 1 of gestation until the end of the lactation period at day 21. Compared to the ITM, the HOTM supplementation increased (P < 0.05) both litter birth weight and individual piglet birth weight. Although not statistically significant, HOTM tended to increase (P = 0.069) the level of lactose in colostrum. HOTM increased (P < 0.05) the concentration of Mn and Se in the colostrum, milk, and serum of sows and/or piglets. Notably, the Zn concentration in the serum of sows was higher in sows supplemented with ITM compared to HOTM. Moreover, HOTM increased (P < 0.05) the activities of GPX and SOD in gestating sows and piglets, as well as increased (P < 0.05) cytokines (IL-1ß, TNF-α, and IL-10) in the serum of sows. The immunoglobulins (IgA, IgG, and IgM) also increased in sows and/or piglets at certain experimental time points. In conclusion, HOTM supplementation positively affected piglet development and improved the health status of sows and piglets potentially by regulating redox homeostasis and immunity.

Pulsatilla decoction alleviates DSS-induced UC by activating FXR-ASBT pathways to ameliorate disordered bile acids homeostasis.

Ethnopharmacological relevance: Pulsatilla decoction (PD) is a classical prescription for the treatment of ulcerative colitis. Previous studies have demonstrated that the therapeutic efficacy of PD is closely associated with the activation of Farnesoid X receptor (FXR). The activity of FXR is regulated by apical sodium-dependent bile acid transporter (ASBT), and the FXR-ASBT cascade reaction, centered around bile acid receptor FXR, plays a pivotal role in maintaining bile acid metabolic homeostasis to prevent the occurrence and progression of ulcerative colitis (UC). Aim of the study: To elucidate the underlying mechanism by which PD exerts its proteactive effects against Dextran Sulfate Sodium Salt (DSS)-induced ulcerative colitis, focusing on the modulation of FXR and ASBT. Materials and methods: To establish a model of acute ulcerative colitis, BALB/C mice were administered 3.5% DSS in their drinking water for consecutive 7 days. The disease activity index (DAI) was employed to evaluate the clinical symptoms exhibited by each group of mice. Goblet cell expression in colon tissue was assessed using glycogen schiff periodic acid-Schiff (PAS) and alcian blue staining techniques. Inflammatory cytokine expression in serum and colonic tissues was examined through enzyme-linked immunosorbent assay (ELISA). A PCR Array chip was utilized to screen 88 differential genes associated with the FXR-ASBT pathway in UC treatment with PD. Western blotting (WB) analysis was performed to detect protein expression levels of differentially expressed genes in mouse colon tissue. Results: The PD treatment effectively reduced the Disease Activity Index (DAI) score and mitigated colon histopathological damage, while also restoring weight and colon length. Furthermore, it significantly alleviated the severity of ulcerative colitis (UC), regulated inflammation, modulated goblet cell numbers, and restored bile acid balance. Additionally, a PCR Array analysis identified 21 differentially expressed genes involved in the FXR-ASBT pathway. Western blot results demonstrated significant restoration of FXR, GPBAR1, CYP7A1, and FGF15 protein expression levels following PD treatment; moreover, there was an observed tendency towards increased expression levels of ABCB11 and RXRα. Conclusion: The therapeutic efficacy of PD in UC mice is notable, potentially attributed to its modulation of bile acid homeostasis, enhancement of gut barrier function, and attenuation of intestinal inflammation.

Frontiers and hotspots in comorbid epilepsy and depression: a bibliometric analysis from 2003 to 2023.

Background: Epilepsy ranks among the most common neurological disorders worldwide, frequently accompanied by depression as a prominent comorbidity. This study employs bibliometric analysis to reveal the research of comorbid epilepsy and depression over the past two decades, aiming to explore trends and contribute insights to ongoing investigations. Methods: We conducted a comprehensive search on the Web of Science Core Collection database and downloaded relevant publications on comorbid epilepsy and depression published from 2003 to 2023. VOSviewer and CiteSpace were mainly used to analyze the authors, institutions, countries, publishing journals, reference co-citation patterns, keyword co-occurrence, keyword clustering, and other aspects to construct a knowledge atlas. Results: A total of 5,586 publications related to comorbid epilepsy and depression were retrieved, with a general upward trend despite slight fluctuations in annual publications. Publications originated from 121 countries and 636 institutions, with a predominant focus on clinical research. The United States led in productivity (1,529 articles), while Melbourne University emerged as the most productive institution (135 articles). EPILEPSY & BEHAVIOR was the journal with the highest publication output (1,189 articles) and citation count. Keyword analysis highlighted emerging trends, including "recognitive impairment" and "mental health," indicating potential future research hotspots and trends. Conclusion: This study is one of the first to perform a bibliometric analysis of the 20-year scientific output of comorbid epilepsy and depression. While research has trended upwards, ambiguity in pathogenesis and the absence of standardized diagnostic guidelines remain concerning. Our analysis offers valuable guidance for researchers, informing that this might be a strong area for future collaborations.

Perceptible landscape patterns reveal invisible socioeconomic profiles of cities.

Urban landscape is directly perceived by residents and is a significant symbol of urbanization development. A comprehensive assessment of urban landscapes is crucial for guiding the development of inclusive, resilient, and sustainable cities and human settlements. Previous studies have primarily analyzed two-dimensional landscape indicators derived from satellite remote sensing, potentially overlooking the valuable insights provided by the three-dimensional configuration of landscapes. This limitation arises from the high cost of acquiring large-area three-dimensional data and the lack of effective assessment indicators. Here, we propose four urban landscapes indicators in three dimensions (UL3D): greenness, grayness, openness, and crowding. We construct the UL3D using 4.03 million street view images from 303 major cities in China, employing a deep learning approach. We combine urban background and two-dimensional urban landscape indicators with UL3D to predict the socioeconomic profiles of cities. The results show that UL3D indicators differs from two-dimensional landscape indicators, with a low average correlation coefficient of 0.31 between them. Urban landscapes had a changing point in 2018-2019 due to new urbanization initiatives, with grayness and crowding rates slowing, while openness increased. The incorporation of UL3D indicators significantly enhances the explanatory power of the regression model for predicting socioeconomic profiles. Specifically, GDP per capita, urban population rate, built-up area per capita, and hospital count correspond to improvements of 25.0%, 19.8%, 35.5%, and 19.2%, respectively. These findings indicate that UL3D indicators have the potential to reflect the socioeconomic profiles of cities.

Targeted delivery of CEBPA-saRNA for the treatment of pancreatic ductal adenocarcinoma by transferrin receptor aptamer decorated tetrahedral framework nucleic acid.

Pancreatic cancer, predominantly pancreatic ductal adenocarcinoma (PDAC), remains a highly lethal malignancy with limited therapeutic options and a dismal prognosis. By targeting the underlying molecular abnormalities responsible for PDAC development and progression, gene therapy offers a promising strategy to overcome the challenges posed by conventional radiotherapy and chemotherapy. This study sought to explore the therapeutic potential of small activating RNAs (saRNAs) specifically targeting the CCAAT/enhancer-binding protein alpha (CEBPA) gene in PDAC. To overcome the challenges associated with saRNA delivery, tetrahedral framework nucleic acids (tFNAs) were rationally engineered as nanocarriers. These tFNAs were further functionalized with a truncated transferrin receptor aptamer (tTR14) to enhance targeting specificity for PDAC cells. The constructed tFNA-based saRNA formulation demonstrated exceptional stability, efficient saRNA release ability, substantial cellular uptake, biocompatibility, and nontoxicity. In vitro experiments revealed successful intracellular delivery of CEBPA-saRNA utilizing tTR14-decorated tFNA nanocarriers, resulting in significant activation of tumor suppressor genes, namely, CEBPA and its downstream effector P21, leading to notable inhibition of PDAC cell proliferation. Moreover, in a mouse model of PDAC, the tTR14-decorated tFNA-mediated delivery of CEBPA-saRNA effectively upregulated the expression of the CEBPA and P21 genes, consequently suppressing tumor growth. These compelling findings highlight the potential utility of saRNA delivered via a designed tFNA nanocarrier to induce the activation of tumor suppressor genes as an innovative therapeutic approach for PDAC.

A novel Alisma orientale extract alleviates non-alcoholic steatohepatitis in mice via modulation of PPARα signaling pathway.

Non-alcoholic fatty liver disease (NAFLD), particularly advanced non-alcoholic steatohepatitis (NASH), leads to irreversible liver damage. This study investigated the therapeutic effects and potential mechanism of a novel extract from traditional Chinese medicine Alisma orientale (Sam.) Juzep (AE) on free fatty acid (FFA)-induced HepG2 cell model and high-fat diet (HFD) + carbon tetrachloride (CCl4)-induced mouse model of NASH. C57BL/6 J mice were fed a HFD for 10 weeks. Subsequently, the mice were injected with CCl4 to induce NASH and simultaneously treated with AE at daily doses of 50, 100, and 200 mg/kg for 4 weeks. At the end of the treatment, animals were fasted for 12 h and then sacrificed. Blood samples and liver tissues were collected for analysis. Lipid profiles, oxidative stress, and histopathology were examined. Additionally, a polymerase chain reaction (PCR) array was used to predict the molecular targets and potential mechanisms involved, which were further validated in vivo and in vitro. The results demonstrated that AE reversed liver damage (plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), hepatocyte ballooning, hepatic steatosis, and NAS score), the accumulation of hepatic lipids (TG and TC), and oxidative stress (MDA and GSH). PCR array analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis revealed that AE protects against NASH by regulating the adipocytokine signaling pathway and influencing nuclear receptors such as PPARα. Furthermore, AE increased the expression of peroxisome proliferator-activated receptor gamma coactivator-1α (PPARGC1α) and reversed the decreased expression of PPARα in NASH mice. Moreover, in HepG2 cells, AE reduced FFA-induced lipid accumulation and oxidative stress, which was dependent on PPARα up-regulation. Overall, our findings suggest that AE may serve as a potential therapeutic approach for NASH by inhibiting lipid accumulation and reducing oxidative stress specifically through the PPARα pathway.

Discovery of new cyclopropane sulfonamide derivatives as EGFR inhibitors to overcome C797S-mediated resistance and EGFR double mutation.

The C797S mutation of EGFR leads to Osimertinib resistance by blocking the covalent binding of Cys797. To develop new agents that can overcome EGFR mutation resistance, thirty seven new cyclopropane sulfonamide derivatives were synthesized and evaluated as EGFRL858R/T790M/C797S or EGFRDel19/T790M/C797S inhibitors by structure-based screening. Most of the synthesized compounds exhibit good to excellent anti proliferation activity against to BaF3-EGFR L858R/T790M/C797S and BaF3-C797S/Del19/T790M cancer cell lines. Representative compounds 8l showed inhibitory activity against the two cancer cell lines with the IC50 values of 0.0012 and 0.0013 µM, respectively. Another compound 8h, exhibited slightly lower activity (0.0042 and 0.0034 µM of the IC50 values) to both of the two tri-mutation cell lines, but excellent activities against H1975 and PC9 cells with IC50 values of 13 and 19 nM, respectively. Considering the acquired drug resistance of tumors is a gradual process, we chose 8h for further in vivo and mechanism study. 8h was demonstrated significantly inhibited tumor growth with 72.1 % of the TGI in the BaF3/EGFR-TM xenograft tumor model and 83.5 % in the H1975-DM xenograft tumor model. Compound 8h was confirmed to be safe with no significant side effects as showed by the results of in vitro assay of human normal cells and the sections of animals major organs. Mechanism studies showed that in addition to inhibiting EGFR mutations, 8h can also target the tumor microenvironment and induce tumor cell apoptosis. All these results indicate that 8h deserves further investigation as an EGFR inhibitor to overcome C797S-mediated resistance.

Research on the mechanism of Guanyu Zhixie Granule in intervening gastric ulcers in rats based on network pharmacology and multi-omics.

Objective: Guanyu Zhixie Granule (GYZXG) is a traditional Chinese medicine compound with definite efficacy in intervening in gastric ulcers (GUs). However, the effect mechanisms on GU are still unclear. This study aimed to explore its mechanism against GU based on amalgamated strategies. Methods: The comprehensive chemical characterization of the active compounds of GYZXG was conducted using UHPLC-Q/TOF-MS. Based on these results, key targets and action mechanisms were predicted through network pharmacology. GU was then induced in rats using anhydrous ethanol (1 mL/200 g). The intervention effects of GYZXG on GU were evaluated by measuring the inhibition rate of GU, conducting HE staining, and assessing the levels of IL-6, TNF-α, IL-10, IL-4, Pepsin (PP), and epidermal growth factor (EGF). Real-time quantitative PCR (RT-qPCR) was used to verify the mRNA levels of key targets and pathways. Metabolomics, combined with 16S rRNA sequencing, was used to investigate and confirm the action mechanism of GYZXG on GU. The correlation analysis between differential gut microbiota and differential metabolites was conducted using the spearman method. Results: For the first time, the results showed that nine active ingredients and sixteen targets were confirmed to intervene in GU when using GYZXG. Compared with the model group, GYZXG was found to increase the ulcer inhibition rate in the GYZXG-M group (p < 0.05), reduce the levels of IL-6, TNF-α, PP in gastric tissue, and increase the levels of IL-10, IL-4, and EGF. GYZXG could intervene in GU by regulating serum metabolites such as Glycocholic acid, Epinephrine, Ascorbic acid, and Linoleic acid, and by influencing bile secretion, the HIF-1 signaling pathway, and adipocyte catabolism. Additionally, GYZXG could intervene in GU by altering the gut microbiota diversity and modulating the relative abundance of Bacteroidetes, Bacteroides, Verrucomicrobia, Akkermansia, and Ruminococcus. The differential gut microbiota was strongly associated with serum differential metabolites. KEGG enrichment analysis indicated a significant role of the HIF-1 signaling pathway in GYZXG's intervention on GU. The changes in metabolites within metabolic pathways and the alterations in RELA, HIF1A, and EGF mRNA levels in RT-qPCR experiments provide further confirmation of this result. Conclusion: GYZXG can intervene in GU induced by anhydrous ethanol in rats by regulating gut microbiota and metabolic disorders, providing a theoretical basis for its use in GU intervention.

The synergistic anti-nociceptive effects of nefopam and gabapentinoids in inflammatory, osteoarthritis, and neuropathic pain mouse models.

Pain is a common public health problem and remains as an unmet medical need. Currently available analgesics usually have limited efficacy or are accompanied by many adverse side effects. To achieve satisfactory pain relief by multimodal analgesia, new combinations of nefopam and gabapentinoids (pregabalin/gabapentin) were designed and assessed in inflammatory, osteoarthritis and neuropathic pain. Isobolographic analysis was performed to analyze the interactions between nefopam and gabapentinoids in carrageenan-induced inflammatory pain, mono-iodoacetate-induced osteoarthritis pain and paclitaxel-induced peripheral neuropathic pain in mice. The anti-inflammatory effect and motor performance of monotherapy or their combinations were evaluated in the carrageenan-induced inflammatory responses and rotarod test, respectively. Nefopam (1, 3, 5, 10, 30 mg/kg, p.o.), pregabalin (3, 6, 12, 24 mg/kg, p.o.) or gabapentin (25, 50, 75, 100 mg/kg, p.o.) dose-dependently reversed mechanical allodynia in three pain models. Isobolographic analysis indicated that the combinations of nefopam and gabapentinoids exerted synergistic anti-nociceptive effects in inflammatory, osteoarthritis, and neuropathic pain mouse models, as evidenced by the experimental ED50 (median effective dose) falling below the predicted additive line. Moreover, the combination of nefopam-pregabalin/gabapentin alleviated carrageenan-induced inflammation and edema, and also prevented gabapentinoids-related sedation or ataxia by lowering their effective doses. Collectively, the co-administration of nefopam and gabapentinoids showed synergistic analgesic effects and may result in improved therapeutic benefits for treating pain.

The synthesis and evaluation of novel ALK inhibitors containing the sulfoxide structure.

With ceritinib as the lead, a series of novel compounds containing the sulfoxide structure were synthesized and evaluated as anaplastic lymphoma kinase inhibitors. Among them, compounds 18a-d exhibited excellent anti-proliferation activities on H2228 EML4-ALK cancer cell lines with 14-28 nM of the IC50 values. In xenograft mouse models, 18a-d inhibited tumor growth with an excellent inhibitory rate of 75.0% to 86.0% at the dosage of 20 mg kg-1 as compared to 72.0% of the reference ceritinib. Using 18d as a representative, which exhibited the best in vivo results, we carried out mechanistic studies such as anti-colony formation, induced tumor cell apoptosis, ALK kinase protein phosphorylation in H2228 tumor cells, and molecular docking. All these results indicate that compound 18d is a good anti-tumor lead compound and worthy of further study.

METTL3-mediated pre-miR-665/DLX3 m6A methylation facilitates the committed differentiation of stem cells from apical papilla.

Methyltransferase-like 3 (METTL3) is a crucial element of N6-methyladenosine (m6A) modifications and has been extensively studied for its involvement in diverse biological and pathological processes. In this study, we explored how METTL3 affects the differentiation of stem cells from the apical papilla (SCAPs) into odonto/osteoblastic lineages through gain- and loss-of-function experiments. The m6A modification levels were assessed using m6A dot blot and activity quantification experiments. In addition, we employed Me-RIP microarray experiments to identify specific targets modified by METTL3. Furthermore, we elucidated the molecular mechanism underlying METTL3 function through dual-luciferase reporter gene experiments and rescue experiments. Our findings indicated that METTL3+/- mice exhibited significant root dysplasia and increased bone loss. The m6A level and odonto/osteoblastic differentiation capacity were affected by the overexpression or inhibition of METTL3. This effect was attributed to the acceleration of pre-miR-665 degradation by METTL3-mediated m6A methylation in cooperation with the "reader" protein YTHDF2. Additionally, the targeting of distal-less homeobox 3 (DLX3) by miR-665 and the potential direct regulation of DLX3 expression by METTL3, mediated by the "reader" protein YTHDF1, were demonstrated. Overall, the METTL3/pre-miR-665/DLX3 pathway might provide a new target for SCAP-based tooth root/maxillofacial bone tissue regeneration.

Unraveling the efficacy of verbascoside in thwarting MRSA pathogenicity by targeting sortase A.

In the fight against hospital-acquired infections, the challenge posed by methicillin-resistant Staphylococcus aureus (MRSA) necessitates the development of novel treatment methods. This study focused on undermining the virulence of S. aureus, especially by targeting surface proteins crucial for bacterial adherence and evasion of the immune system. A primary aspect of our approach involves inhibiting sortase A (SrtA), a vital enzyme for attaching microbial surface components recognizing adhesive matrix molecules (MSCRAMMs) to the bacterial cell wall, thereby reducing the pathogenicity of S. aureus. Verbascoside, a phenylethanoid glycoside, was found to be an effective SrtA inhibitor in our research. Advanced fluorescence quenching and molecular docking studies revealed a specific interaction between verbascoside and SrtA, pinpointing the critical active sites involved in this interaction. This molecular interaction significantly impedes the SrtA-mediated attachment of MSCRAMMs, resulting in a substantial reduction in bacterial adhesion, invasion, and biofilm formation. The effectiveness of verbascoside has also been demonstrated in vivo, as shown by its considerable protective effects on pneumonia and Galleria mellonella (wax moth) infection models. These findings underscore the potential of verbascoside as a promising component in new antivirulence therapies for S. aureus infections. By targeting crucial virulence factors such as SrtA, agents such as verbascoside constitute a strategic and potent approach for tackling antibiotic resistance worldwide. KEY POINTS: • Verbascoside inhibits SrtA, reducing S. aureus adhesion and biofilm formation. • In vivo studies demonstrated the efficacy of verbascoside against S. aureus infections. • Targeting virulence factors such as SrtA offers new avenues against antibiotic resistance.

Potential efficacy and safety of Xiyanping injection as adjuvant therapy in treatment of suppurative acute tonsillitis: a meta-analysis, trial sequential analysis, and certainty of evidence.

Background: Antibiotic resistance has emerged as a global concern. Xiyanping injection (XYP), a traditional Chinese medicine injection, has been extensively utilized for the treatment of suppurative acute tonsillitis (SAT) in China, exhibiting clinical efficacy. Consequently, there is a need for further evaluation of the potential effectiveness and safety of this treatment. This meta-analysis consolidated data from multiple independent studies to assess the overall treatment efficacy of XYP as adjuvant therapy in patients with SAT. Methods: The search for randomized controlled trials (RCTs) encompassed databases from their inception to 1 April 2024, including the Cochrane Library, PubMed, Embase, SinoMed, CNKI, Wanfang, VIP, and CBM. Data extraction, methodological quality assessment, and meta-analysis were performed independently by two researchers. Review Manager 5.4 was used for data analysis. Various tools were employed for assessment, including forest plots to visualize results, funnel plots to detect publication bias, trial sequential analysis to estimate sample size, and GRADE to evaluate evidence quality. Results: A comprehensive analysis of 32 RCTs involving 4,265 cases was conducted. When compared to conventional treatments (CTs; ß-lactams/clindamycin hydrochloride injection/ribavirin) alone, the combination of XYP with CTs demonstrated significant reductions in symptom duration. This included sore throat (MD = -21.08, 95% CI: -24.86 to -17.29, p < 0.00001), disappearance of tonsillar redness and swelling (mean difference [MD] = -20.28, 95% confidence interval [CI]: -30.05 to -10.52, p < 0.0001), tonsil purulent discharge (MD = -22.40, 95% CI: -28.04 to -16.75, p < 0.00001), and normalization of temperature (MD = -19.48, 95% CI: -22.49 to -16.47, p < 0.00001). Furthermore, patients receiving CTs combined with XYP exhibited lower levels of interleukin-6 (MD = -7.64, 95% CI: 8.41 to -6.87, p < 0.00001) and interleukin-8 (MD = -5.23, 95% CI: -5.60 to -4.86, p < 0.00001) than those receiving CTs alone. Additionally, the combination therapy significantly improved the recovery rate (relative risk [RR] = 1.55, 95% CI: 1.37 to 1.77, p < 0.00001), white blood cell count recovery rate (RR = 1.13, 95% CI: 1.04 to 1.23, p = 0.004), and disappearance rate of tonsillar redness and swelling (RR = 0.51, 95% CI: 1.14 to 1.38, p < 0.00001), with no significant increase in adverse events (RR = 0.47, 95% CI: 0.20 to 1.10, p = 0.08). Conclusion: The current systematic review and meta-analysis tentatively suggest that the combination of XYP and CTs yields superior clinical outcomes for patients with SAT compared to CTs alone, with a favorable safety profile. Nonetheless, these findings warrant further confirmation through more rigorous RCTs, given the notable heterogeneity and publication bias observed in the included studies. Systematic Review Registration: https://www.crd.york.ac.uk/PROSPERO/display_record.php?RecordID=296118, identifier CRD42022296118.

Viruses contribute to microbial diversification in the rumen ecosystem and are associated with certain animal production traits.

BACKGROUND: The rumen microbiome enables ruminants to digest otherwise indigestible feedstuffs, thereby facilitating the production of high-quality protein, albeit with suboptimal efficiency and producing methane. Despite extensive research delineating associations between the rumen microbiome and ruminant production traits, the functional roles of the pervasive and diverse rumen virome remain to be determined. RESULTS: Leveraging a recent comprehensive rumen virome database, this study analyzes virus-microbe linkages, at both species and strain levels, across 551 rumen metagenomes, elucidating patterns of microbial and viral diversity, co-occurrence, and virus-microbe interactions. Additionally, this study assesses the potential role of rumen viruses in microbial diversification by analyzing prophages found in rumen metagenome-assembled genomes. Employing CRISPR-Cas spacer-based matching and virus-microbe co-occurrence network analysis, this study suggests that the viruses in the rumen may regulate microbes at strain and community levels through both antagonistic and mutualistic interactions. Moreover, this study establishes that the rumen virome demonstrates responsiveness to dietary shifts and associations with key animal production traits, including feed efficiency, lactation performance, weight gain, and methane emissions. CONCLUSIONS: These findings provide a substantive framework for further investigations to unravel the functional roles of the virome in the rumen in shaping the microbiome and influencing overall animal production performance. Video Abstract.

Aberrant cortical morphology patterns are associated with cognitive impairment in patients with chronic heart failure.

A mounting body of evidences suggests that patients with chronic heart failure (HF) frequently experience cognitive impairments, but the neuroanatomical mechanism underlying these impairments remains elusive. In this retrospective study, 49 chronic HF patients and 49 healthy controls (HCs) underwent brain structural MRI scans and cognitive assessments. Cortical morphology index (cortical thickness, complexity, sulcal depth and gyrification) were evaluated. Correlations between cortical morphology and cognitive scores and clinical variables were explored. Logistic regression analysis was employed to identify risk factors for predicting 3-year major adverse cardiovascular events. Compared with HCs, patients with chronic HF exhibited decreased cognitive scores (p < .001) and decreased cortical thickness, sulcal depth and gyrification in brain regions involved cognition, sensorimotor, autonomic nervous system (family-wise error correction, all p values <.05). Notably, HF duration and New York Heart Association (NYHA) demonstrated negative correlations with abnormal cortex morphology, particularly HF duration and thickness in left precentral gyrus (r = -.387, p = .006). Cortical morphology characteristics exhibited positive associations with global cognition, particularly cortical thickness in left pars opercularis (r = .476, p < .001). NYHA class is an independent risk factor for adverse outcome (p = .001). The observed correlation between abnormal cortical morphology and global cognition suggested that cortical morphology may serve as a promising imaging biomarker and provide insights into neuroanatomical underpinnings of cognitive impairment in patients with chronic HF.

[Mechanism of Tougu Xiaotong Capsules in delaying degeneration of osteoarthritis by regulating cholesterol metabolism in chondrocytes through lncRNA MALAT1].

From the perspective of lncRNA MALAT1 regulating cholesterol metabolism in chondrocytes, this paper explores the effect and mechanism of Tougu Xiaotong Capsules(TGXTC) in delaying the degeneration of osteoarthritis. After one week of adaptive feeding, 48(8-week-old) C57BL/6 mice were randomly divided into a blank group(12 mice) and a model group(36 mice) by random number table method. The mice in the model group were anesthetized by inhalation of 5% isoflurane, and the OA model was induced by Hulth method. The experiment randomly divided the mice into a model group(12 mice), a drug-positive group(taururso-deoxycholic acid)(12 mice), and a TGXTC group(12 mice). The drug-positive group was given 500 mg·kg~(-1) taurodeoxycholic acid by intragastric administration. TGXTC group was given TGXTC 368 mg·kg~(-1) by gavage. The blank group and model group were given the same amount of normal saline for four weeks. After the intervention, the mice in each group were killed under anesthesia, and the knee cartilage tissue was separated and collected. The morphologic changes of knee cartilage were observed. The level of lncRNA MALAT1 in the cartilage tissue was detected by real-time PCR. The protein expressions of ABCA1, ApoA1, LXRß, CHOP, and caspase-3 in mouse articular cartilage were detected by Western blot. Lentivirus-coated plasmid was used to transfect mouse chondrocytes with sh-MALAT1. The gene levels of lncRNA MALAT1 in mouse chondrocytes transfected with sh-MALAT1 were detected by real-time PCR. Western blot was used to detect the effect of TGXTC on the protein content of ABCA1, ApoA1, LXRß, CHOP, and caspase-3 in thapsigargin(TG)-induced mouse chondrocytes after lncRNA MALAT1 knockdown. Flow cytometry was used to detect the effect of TGXTC on apoptosis of TG-induced mouse chondrocytes after lncRNA MALAT1 knockdown. The results of HE and saffranine O staining showed that compared with the model group, the structure of the cartilage layer was basically intact; the damage degree of joint structure was significantly improved, and the cartilage matrix was significantly enhanced by saffranine O staining in the TGXTC group and drug-positive group. Compared with the model group, the lncRNA MALAT1 level was significantly decreased in the TGXTC group and drug-positive group. Compared with the model group, the protein content of ABCA1, ApoA1, and LXRß was significantly increased, while that of CHOP and caspase-3 in the TGXTC group and drug-positive group significantly decreased. Compared with the TG group, the lncRNA MALAT1 level in the TG+sh-MALAT1 group was decreased. The lncRNA MALAT1 level in the TG+sh-MA-LAT1+TGXTC group was increased compared with the TG+TGXTC group. Western blot results showed that compared with the model group, protein expressions of ABCA1, ApoA1, LXRß, CHOP, and caspase-3 in the TGXTC group were significantly decreased, after lncRNA MALAT1 knockdown, the regulation and apoptosis of ABCA1, ApoA1, LXRß, CHOP, and caspase-3 in TG-induced mouse chondrocytes were weakened by TGXTC. TGXTC can improve the disorder of cholesterol metabolism in OA chondrocytes and delay OA degeneration, which is closely related to the regulation of lncRNA MALAT1.

The Role of the Tissue Perfusion Index in Predicting Disease Severity and Prognosis in Patients with Severe and Critical COVID-19.

OBJECTIVES: The study investigated whether percutaneous partial pressure of oxygen (PtcO2), percutaneous partial pressure of carbon dioxide (PtcCO2), and the derived tissue perfusion index (TPI) can predict the severity and short-term outcomes of severe and critical COVID-19. DESIGN: Prospective observational study conducted from January 1, 2023 to February 10, 2023. SETTING: A teaching hospital specializing in tertiary care in Nanjing City, Jiangsu Province, China. PARTICIPANTS: Adults (≥18 years) with severe and critical COVID-19. INTERVENTIONS: Not applicable. MAIN OUTCOME MEASURES: The general information and vital signs of the patients were collected. The PtcO2 and PtcCO2 were monitored in the left dorsal volar. The ratio of TPI was defined as the ratio of PtcO2/fraction of inspired oxygen (FiO2) to PtcCO2. Mortality at 28 was recorded. The ability of the TPI to assess disease severity and predict prognosis was determined. ENDPOINT: Severity of the disease on the enrollment and mortality at 28. RESULTS: A total of 71 patients with severe and critical COVID-19, including 40 severe and 31 critical cases, according to the COVID-19 treatment guidelines published by WHO, were recruited. Their median age was 70 years, with 56 (79%) males. The median SpO2/FiO2, PtcO2, PtcCO2, PtcO2/ FiO2, and TPI values were 237, 61, 42, 143, and 3.6 mm Hg, respectively. Compared with those for severe COVID-19, the TPI, PtcO2/ FiO2, SpO2/FiO2, and PtcO2 were significantly lower in critical COVID-19, while the PtcCO2 was significantly higher. After 28 days, 26 (37%) patients had died. TPI values < 3.5 were correlated with more severe disease status (AUC 0.914; 95% CI: 0.847-0.981, P < 0.001), and TPI < 3.3 was associated with poor outcomes (AUC 0.937; 95% CI 0.880-0.994, P < 0.001). CONCLUSIONS: The tissue perfusion index (TPI), PtcCO2, and PtcO2/ FiO2 can predict the severity and outcome of severe and critical COVID-19.

A nursing note-aware deep neural network for predicting mortality risk after hospital discharge.

BACKGROUND: ICU readmissions and post-discharge mortality pose significant challenges. Previous studies used EHRs and machine learning models, but mostly focused on structured data. Nursing records contain crucial unstructured information, but their utilization is challenging. Natural language processing (NLP) can extract structured features from clinical text. This study proposes the Crucial Nursing Description Extractor (CNDE) to predict post-ICU discharge mortality rates and identify high-risk patients for unplanned readmission by analyzing electronic nursing records. OBJECTIVE: Developed a deep neural network (NurnaNet) with the ability to perceive nursing records, combined with a bio-clinical medicine pre-trained language model (BioClinicalBERT) to analyze the electronic health records (EHRs) in the MIMIC III dataset to predict the death of patients within six month and two year risk. DESIGN: A cohort and system development design was used. SETTING(S): Based on data extracted from MIMIC-III, a database of critically ill in the US between 2001 and 2012, the results were analyzed. PARTICIPANTS: We calculated patients' age using admission time and date of birth information from the MIMIC dataset. Patients under 18 or over 89 years old, or who died in the hospital, were excluded. We analyzed 16,973 nursing records from patients' ICU stays. METHODS: We have developed a technology called the Crucial Nursing Description Extractor (CNDE), which extracts key content from text. We use the logarithmic likelihood ratio to extract keywords and combine BioClinicalBERT. We predict the survival of discharged patients after six months and two years and evaluate the performance of the model using precision, recall, the F1-score, the receiver operating characteristic curve (ROC curve), the area under the curve (AUC), and the precision-recall curve (PR curve). RESULTS: The research findings indicate that NurnaNet achieved good F1-scores (0.67030, 0.70874) within six months and two years. Compared to using BioClinicalBERT alone, there was an improvement in performance of 2.05 % and 1.08 % for predictions within six months and two years, respectively. CONCLUSIONS: CNDE can effectively reduce long-form records and extract key content. NurnaNet has a good F1-score in analyzing the data of nursing records, which helps to identify the risk of death of patients after leaving the hospital and adjust the regular follow-up and treatment plan of relevant medical care as soon as possible.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.