RESUMO
Bee bread is a product of honeybees, which collect and ferment pollen, that contains highly nutritious and easily digestible active substances. However, its nutritional composition varies significantly with fermentation strains and seasonal changes. To unveil the patterns of microbial community and nutritional component changes in bee bread across seasons, we employed high-throughput techniques to assess the diversity of bacteria and fungi in bee bread. The results indicated that the compositions of bacteria and fungi in bee bread undergo significant seasonal variation, with noticeable changes in the microbial diversity of bee bread from different bee species. Subsequently, metabolomic analysis revealed high activity of glycerophospholipid metabolism in bee bread. Furthermore, our analysis identifaied noteworthy differences in nutritional components, including pH values, sugar content, and free amino acid levels, in bee bread across different seasons.
Assuntos
Bactérias , Microbiota , Valor Nutritivo , Estações do Ano , Abelhas/microbiologia , Animais , Bactérias/classificação , Fermentação , Aminoácidos/análise , Fungos/classificação , Pólen/química , Pão/análise , Pão/microbiologia , Concentração de Íons de Hidrogênio , MetabolômicaRESUMO
The tetraspanin gene family encodes cell-surface proteins that span the membrane 4 times and play critical roles in a wide range of biological processes across numerous organisms. Recent findings highlight the involvement of a tetraspanin of the lepidopteran pest Helicoverpa armigera in resistance to Bacillus thuringiensis Cry insecticidal proteins, which are extensively used in transgenic crops. Thus, a better understanding of lepidopteran tetraspanins is urgently needed. In the current study, genome scanning in 10 lepidopteran species identified a total of 283 sequences encoding potential tetraspanins. Based on conserved cysteine patterns in the large extracellular loop and their phylogenetic relationships, these tetraspanins were classified into 8 subfamilies (TspA to TspH). Six ancestral introns were identified within lepidopteran tetraspanin genes. Tetraspanins in TspA, TspB, TspC, and TspD subfamilies exhibit highly similar gene organization, while tetraspanins in the remaining 4 subfamilies exhibited variation in intron loss and/or gain during evolution. Analysis of chromosomal distribution revealed a lepidopteran-specific cluster of 10 to 11 tetraspanins, likely formed by tandem duplication events. Selective pressure analysis indicated negative selection across all orthologous groups, with ω values ranging between 0.004 and 0.362. However, positive selection was identified at 18 sites within TspB5, TspC5, TspE3, and TspF10. Furthermore, spatiotemporal expression analysis of H. armigera tetraspanins demonstrated variable expression levels across different developmental stages and tissues, suggesting diverse functions of tetraspanin members in this globally important insect pest. Our findings establish a solid foundation for subsequent functional investigations of tetraspanins in lepidopteran species.
RESUMO
Intervertebral disc is a highly rhythmical tissue. As a key factor linking biorhythm and inflammatory response, the shielding effect of NR1D1 in the process of intervertebral disc degeneration remains unclear. Here, we first confirmed that NR1D1 in the nucleus pulposus tissue presents periodic rhythmic changes and decreases in expression with intervertebral disc degeneration. Second, when NR1D1 was activated by SR9009 in vitro, NLRP3 inflammasome assembly and IL-1ß production were inhibited, while ECM synthesis was increased. Finally, the vivo experiments further confirmed that the activation of NR1D1 can delay the process of disc degeneration to a certain extent. Mechanistically, we demonstrate that NR1D1 can bind to IL-1ß and NLRP3 promoters, and that the NR1D1/NLRP3/IL-1ß pathway is involved in this process. Our results demonstrate that the activation of NR1D1 can effectively reduce IL-1ß secretion, alleviate LPS-induced NPMSC pyroptosis, and protect ECM degeneration.
RESUMO
Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.
RESUMO
Precise and selective modification of carbohydrates is a critical strategy in producing diverse carbohydrate derivatives for exploiting their functions. We disclosed a simple, efficient, and highly regioselective and stereoselective protocol to controllable amination of 2-nitroglycals under mild conditions in 5 min. A range of 3-amino-carbohydrates including 3-arylamino-2-nitro-glycals and 1,3-di-amino-carbohydrate derivatives were obtained in good to excellent yield with excellent stereoselectivity. The produced 3-amino-2-nitro-glycals can be used as a precursor for further transformation.
Assuntos
Nitrocompostos , Aminação , Estereoisomerismo , Estrutura Molecular , Nitrocompostos/química , Nitrocompostos/síntese química , Carboidratos/química , Carboidratos/síntese químicaRESUMO
The selective modification of carbohydrates is significant for producing their unnatural analogues for drug discovery. C1-functionalization (glycosylation) and C1,C2-difunctionalization of carbohydrates have been well developed. In contrast, C3-functionalization or C1,C3-difunctionalization of carbohydrates remains rare. Herein, we report such processes that efficiently and stereoselectively modify carbohydrates. Specifically, we found that trifluoroethanol (TFE) could promote 1,3-bis-indolylation/pyrrolylation of 2-nitroglycals generated carbohydrate derivatives in up to 93% yield at room temperature; slightly reducing the temperature could install two different indoles at the C1- and C3-positions. Switching TFE to a bifunctional amino thiourea catalyst leads to the generation of C3 monosubstituted carbohydrates, which could also be used to construct 1,3-di-C-functionalized carbohydrates. This approach produced a range of challenging sugar derivatives (over 80 examples) with controllable and high stereoselectivity (single isomer for over 90% of the examples). The potential applications of the reaction were demonstrated by a set of transformations including the synthesis of bridged large-ring molecules and gram scale reactions. Biological activities evaluation demonstrated that three compounds exhibit a potent inhibitory effect on human cancer cells T24, HCT116, AGS, and MKN-45 with IC50 ranged from 0.695 to 3.548 µM.
RESUMO
BACKGROUND: The MYH3-associated myosinopathies comprise a spectrum of rare neuromuscular disorders mainly characterized by distal arthrogryposis with or without other features like pterygia and vertebrae fusion. CPSKF1B (contractures, pterygia, and spondylocarpotarsal fusion syndrome1B) is the only known autosomal recessiveMYH3-associated myosinopathy so far, with no more than two dozen cases being reported. MATERIALS AND METHODS: A boy with CPSKF1B was recruited and subjected to a comprehensive clinical and imaging evaluation. Genetic detection with whole-exome sequencing (WES) was performed on the patient and extended family members to identify the causative variation. A series of in silico and in vitro investigations were carried out to verify the pathogenicity of the two variants of the identified compound heterozygous variation. RESULTS: The patient exhibited moderate CPSKF1B symptoms including multiarticular contractures, webbed neck, and spondylocarpotarsal fusion. WES detected a compound heterozygous MYH3 variation consisting of two variants, namely NM_002470.4: c.3377A>G; p. (E1126G) and NM_002470.4: c.5161-2A>C. It was indicated that the NM_002470.4: c.3377A>G; p. (E1126G) variant mainly impaired the local hydrogen bond formation and impacted the TGF-B pathway, while the NM_002470.4: c.5161-2A>C variant could affect the normal splicing of pre-mRNA, resulting in the appearance of multiple abnormal transcripts. CONCLUSIONS: The findings of this study expanded the mutation spectrum of CPSKF1B, provided an important basis for the counseling of the affected family, and also laid a foundation for the functional study of MYH3 mutations.
Assuntos
Artrogripose , Túnica Conjuntiva , Contratura , Pterígio , Humanos , Masculino , Artrogripose/genética , Túnica Conjuntiva/anormalidades , Contratura/genética , FamíliaRESUMO
RNAs play crucial roles in various essential biological functions, including catalysis and gene regulation. Despite the widespread use of coarse-grained (CG) models/simulations to study RNA 3D structures and dynamics, their direct application is challenging due to the lack of atomic detail. Therefore, the reconstruction of full atomic structures is desirable. In this study, we introduced a straightforward method called ABC2A for reconstructing all-atom structures from RNA CG models. ABC2A utilizes diverse nucleotide fragments from known structures to assemble full atomic structures based on the CG atoms. The diversification of assembly fragments beyond standard A-form ones, commonly used in other programs, combined with a highly simplified structure refinement process, ensures that ABC2A achieves both high accuracy and rapid speed. Tests on a recent large dataset of 361 RNA experimental structures (30-692 nt) indicate that ABC2A can reconstruct full atomic structures from three-bead CG models with a mean RMSD of ~0.34 Å from experimental structures and an average runtime of ~0.5 s (maximum runtime < 2.5 s). Compared to the state-of-the-art Arena, ABC2A achieves a ~25% improvement in accuracy and is five times faster in speed.
Assuntos
Simulação de Dinâmica Molecular , RNA , RNA/química , NucleotídeosRESUMO
The immune infiltration profiles of the tumor microenvironment have effects on the prognosis of head and neck squamous cell carcinoma (HNSCC). Whereas, HNSCC is a heterogeneous group of tumors, but past work has not taken this into consideration. Herein, we investigate the associations between survival and the function of immune cells in different tumorigenic sites of HNSCC. 1149 samples of HNSCC were collected from publicly accessible databases. Based on gene expression data, CIBERSORTx was applied to determine the proportion of 22 immune cell subpopulations. In the Cox regression model, the associations between overall survival, disease-free survival, and immune cells were examined, modeling gene expression and immune cell proportion as quartiles. Consensus cluster analysis was utilized to uncover immune infiltration profiles. Regardless of tumor sites, CD8+ T cells and activated CD4 memory T cells were associated with favorable survival, while eosinophils were the opposite. The survival of the hypopharynx, oral cavity, and larynx subsites was somewhat affected by immune cells, while the survival of the oropharynx subsite potentially was the most impacted. High expression of TIGIT, CIITA, and CXCR6 was linked to better survival, mainly in the oropharynx subsite. Immune cell clusters with four distinct survival profiles were discovered, of which the cluster with a high CD8+ T cell content had a better prognosis. The immune-infiltration pattern is related to the survival of HNSCC to varying degrees depending on the tumor sites; forthcoming studies into immune-mediated infiltration profiles will lay the groundwork for treating HNSCC with precision therapy.
Assuntos
Neoplasias de Cabeça e Pescoço , Humanos , Carcinoma de Células Escamosas de Cabeça e Pescoço , Estudos Retrospectivos , Prognóstico , Linfócitos T CD8-Positivos , Microambiente TumoralRESUMO
OBJECTIVE: To study the relationship between umbilical cord blood vitamin A (VA) and neonatal lung diseases and explore the impact of umbilical cord blood VA on neonatal lung diseases. METHOD: Umbilical vein blood was collected at birth, and its VA content was measured. According to the VA levels in umbilical cord blood, a VA deficiency (VAD) group, a marginal deficiency group and a normal group were created and followed up until 28 days after birth. RESULTS: The umbilical cord blood VA level in the neonatal group with lung disease was 0.13 ± 0.05 mg/L, while the result for the VA level in the non-lung disease group was 0.15 ± 0.05 mg/L. The umbilical cord blood VA levels in the neonatal lung disease group were significantly lower than those in the non-lung disease group. The incidence of neonatal pulmonary diseases was highest in the VAD group, and the incidence decreased as the level of VA in umbilical cord blood increased. Umbilical cord blood VAD and premature birth were found to be independent risk factors for neonatal respiratory disease. CONCLUSION: Umbilical cord blood VAD and premature birth are independent risk factors for neonatal pulmonary diseases. The lower the level of VA in umbilical cord blood, the more susceptible infants will be to neonatal respiratory infections in the neonatal period.
RESUMO
BACKGROUND: The research on the relationship between the Braf Proto-oncogene (BRAF) mutation and lung cancer has generated conflicting findings. Nevertheless, there is an argument suggesting that assessing the BRAF status could offer benefits in terms of managing and prognosing individuals with non-small cell lung cancer (NSCLC). To present a comprehensive overview of this subject, we undertook an up-to-date meta-analysis of pertinent publications. METHODS: We conducted an extensive literature search utilizing Medical Subject Headings keywords, namely "BRAF", "mutation", "lung", "tumor", "NSCLC", and "neoplasm", across multiple databases, including PubMed, EMBASE, ISI Science Citation Index, and CNKI. For each study, we calculated and evaluated the odds ratio and confidence interval, focusing on the consistency of the eligible research. RESULTS: The meta-analysis unveiled a noteworthy correlation between BRAF mutation and lung cancer. No significant evidence was found regarding the connection between smoking and staging among individuals with BRAF mutations. Furthermore, a substantial disparity in the rate of BRAF mutations was observed between males and females. CONCLUSION: Our meta-analysis revealed a significant correlation between BRAF mutations and NSCLC. Moreover, we observed a higher incidence of BRAF lung mutations in females compared to males. Additionally, the BRAFV600E mutation was found to be more prevalent among female patients and nonsmokers.
Assuntos
Carcinoma Pulmonar de Células não Pequenas , Neoplasias Pulmonares , Masculino , Humanos , Feminino , Carcinoma Pulmonar de Células não Pequenas/genética , Neoplasias Pulmonares/genética , Proteínas Proto-Oncogênicas B-raf/genética , Mutação , Fumar/epidemiologia , Fumar/genéticaRESUMO
BACKGROUND: The incidence of chronic kidney disease among patients with diabetes mellitus (DM) remains a global concern. Long-term obesity is known to possibly influence the development of type 2 diabetes mellitus. However, no previous meta-analysis has assessed the effects of body mass index (BMI) on adverse kidney events in patients with DM. AIM: To determine the impact of BMI on adverse kidney events in patients with DM. METHODS: A systematic literature search was performed on the PubMed, ISI Web of Science, Scopus, Ovid, Google Scholar, EMBASE, and BMJ databases. We included trials with the following characteristics: (1) Type of study: Prospective, retrospective, randomized, and non-randomized in design; (2) participants: Restricted to patients with DM aged ≥ 18 years; (3) intervention: No intervention; and (4) kidney adverse events: Onset of diabetic kidney disease [estimated glomerular filtration rate (eGFR) of < 60 mL/min/1.73 m2 and/or microalbuminuria value of ≥ 30 mg/g Cr], serum creatinine increase of more than double the baseline or end-stage renal disease (eGFR < 15 mL/min/1.73 m2 or dialysis), or death. RESULTS: Overall, 11 studies involving 801 patients with DM were included. High BMI (≥ 25 kg/m2) was significantly associated with higher blood pressure (BP) [systolic BP by 0.20, 95% confidence interval (CI): 0.15-0.25, P < 0.00001; diastolic BP by 0.21 mmHg, 95%CI: 0.04-0.37, P = 0.010], serum albumin, triglycerides [standard mean difference (SMD) = 0.35, 95%CI: 0.29-0.41, P < 0.00001], low-density lipoprotein (SMD = 0.12, 95%CI: 0.04-0.20, P = 0.030), and lower high-density lipoprotein (SMD = -0.36, 95%CI: -0.51 to -0.21, P < 0.00001) in patients with DM compared with those with low BMIs (< 25 kg/m2). Our analysis showed that high BMI was associated with a higher risk ratio of adverse kidney events than low BMI (RR: 1.22, 95%CI: 1.01-1.43, P = 0.036). CONCLUSION: The present analysis suggested that high BMI was a risk factor for adverse kidney events in patients with DM.
RESUMO
Genome-wide association studies (GWAS) have identified multiple risk variants for Parkinson's disease (PD). Nevertheless, how the risk variants confer the risk of PD remains largely unknown. We conducted a proteome-wide association study (PWAS) and summary-data-based mendelian randomization (SMR) analysis by integrating PD GWAS with proteome and protein quantitative trait loci (pQTL) data from human brain, plasma and CSF. We also performed a large transcriptome-wide association study (TWAS) and Fine-mapping of causal gene sets (FOCUS), leveraging joint-tissue imputation (JTI) prediction models of 22 tissues to identify and prioritize putatively causal genes. We further conducted PWAS, SMR, TWAS, and FOCUS using a multi-trait analysis of GWAS (MTAG) to identify additional PD risk genes to boost statistical power. In this large-scale study, we identified 16 genes whose genetically regulated protein abundance levels were associated with Parkinson's disease risk. We undertook a large-scale analysis of PD and correlated traits, through TWAS and FOCUS studies, and discovered 26 casual genes related to PD that had not been reported in previous TWAS. 5 genes (CD38, GPNMB, RAB29, TMEM175, TTC19) showed significant associations with PD at both the proteome-wide and transcriptome-wide levels. Our study provides new insights into the etiology and underlying genetic architecture of PD.
Assuntos
Doença de Parkinson , Transcriptoma , Humanos , Estudo de Associação Genômica Ampla , Proteoma/genética , Predisposição Genética para Doença , Doença de Parkinson/genética , Polimorfismo de Nucleotídeo Único , Glicoproteínas de Membrana/genéticaRESUMO
Despite the initial promise of epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs) in effectively combating tumor growth, the majority of patients with advanced non-small cell lung cancers (NSCLCs) inevitably develop resistance to these treatments. An infrequent genetic mutation known as BRAFV600E has been identified as a contributing factor to the emergence of acquired resistance to EGFR-TKIs. Genetic alterations in BRAF, particularly V600E, contribute to resistance to osimertinib. However, a combination therapy involving osimertinib, dabrafenib (a BRAF inhibitor), and trametinib has shown effectiveness in overcoming BRAF V600E-mediated resistance in advanced lung adenocarcinoma. This treatment regimen holds promise for similar cases. In our case report, the combination of osimertinib, dabrafenib, and trametinib effectively overcame osimertinib resistance and resulted in sustained partial remission.
Assuntos
Neoplasias Pulmonares , Humanos , Neoplasias Pulmonares/tratamento farmacológico , Neoplasias Pulmonares/genética , Neoplasias Pulmonares/patologia , Proteínas Proto-Oncogênicas B-raf/genética , Compostos de Anilina , Inibidores de Proteínas Quinases/farmacologia , Inibidores de Proteínas Quinases/uso terapêutico , Mutação , Receptores ErbB/genética , Resistencia a Medicamentos AntineoplásicosRESUMO
Background: The changes in the microenvironment of degenerative intervertebral discs cause oxidative stress injury and excessive apoptosis of intervertebral disc endogenous stem cells. The purpose of this study was to explore the possible mechanism of the protective effect of melatonin on oxidative stress injury in NPMSCs induced by H2O2. Methods: The Cell Counting Kit-8 assay was used to evaluate the cytotoxicity of hydrogen peroxide and the protective effects of melatonin. ROS content was detected by 2'7'-dichlorofluorescin diacetate (DCFH-DA). Mitochondrial membrane potential (MMP) was detected by the JC-1assay. Transferase mediated d-UTP Nick end labeling (TUNEL) and Annexin V/PI double staining were used to determine the apoptosis rate. Additionally, apoptosis-associated proteins and PI3K/Akt signaling pathway-related proteins were evaluated by immunofluorescence, immunoblotting and PCR. ECMs were evaluated by RTâPCR and immunofluorescence. In vivo, X-ray, Magnetic resonance imaging (MRI) and Histological analyses were used to evaluate the protective effect of melatonin. Results: Melatonin had an obvious protective effect on NPMSCs treated with 0-10 µM melatonin for 24 h. In addition, melatonin also had obvious protective effects on mitochondrial dysfunction, decreased membrane potential and cell senescence induced by H2O2. More importantly, melatonin could significantly reduce the apoptosis of nucleus pulposus mesenchymal stem cells induced by H2O2 by regulating the expression of apoptosis-related proteins and decreasing the rate of apoptosis. After treatment with melatonin, the PI3K/Akt pathway was significantly activated in nucleus pulposus mesenchymal stem cells, while the protective effect was significantly weakened after PI3K-IN-1 treatment. In vivo, the results of X-ray, MRI and histological analyses showed that therapy with melatonin could partially reduce the degree of intervertebral disc degeneration. Conclusion: Our research demonstrated that melatonin can effectively alleviate the excessive apoptosis and mitochondrial dysfunction of nucleus pulposus mesenchymal stem cells induced by oxidative stress via the PI3K/Akt pathway, which provides a novel idea for the therapy of intervertebral disc degeneration. The translational potential of this article: This study indicates that melatonin can effectively alleviate the excessive apoptosis and mitochondrial dysfunction of NPMSCs through activating the PI3K/Akt pathway. Melatonin might serve as a promising candidate for the prevention and treatment of Intervertebral disc degeneration disease (IVDD) in the future.
RESUMO
Pancreatic cancer is highly lethal, of which 90% is pancreatic ductal adenocarcinoma (PDAC), with a 5-year survival rate of less than 12%, lacking effective treatment options and late diagnosis. Furthermore, the tumors show an intense resistance to cytotoxic chemotherapies. As autophagy is elevated in PDAC, targeting the autophagic pathway is regarded as a promising strategy for cancer treatment. Immunofluorescence and transmission electron microscopy were utilized to assess the autophagic flux. Label-free quantitative phosphoproteomics was used to figure out critically altered tyrosine phosphorylation of the proteins. Tumor-bearing mice were used to validate that SH2 TrM-(Arg)9 restrained the growth of tumor cells. SH2 TrM-(Arg)9 inhibited collagen-induced autophagy via blocking the DDR1/PYK2/ERK signaling cascades. SH2 TrM-(Arg)9 improved the sensitivity of PANC-1/GEM cells to gemcitabine (GEM). Inhibition of autophagy by SH2 TrM-(Arg)9 may synergized with chemotherapy and robusted tumor suppression in pancreatic cancer xenografts. SH2 TrM-(Arg)9 could enter into PDAC cells and blockade autophagy through inhibiting DDR1/PYK2/ERK signaling and may be a new treatment strategy for targeted therapy of PDAC.
Assuntos
Carcinoma Ductal Pancreático , Neoplasias Pancreáticas , Humanos , Animais , Camundongos , Quinase 2 de Adesão Focal/metabolismo , Neoplasias Pancreáticas/patologia , Carcinoma Ductal Pancreático/patologia , Transdução de Sinais , Autofagia , Linhagem Celular Tumoral , Receptor com Domínio Discoidina 1/metabolismoRESUMO
Cutaneous squamous cell carcinoma (cSCC) is the second most frequent of the keratinocyte-derived malignancies with actinic keratosis (AK) as a precancerous lesion. To comprehensively delineate the underlying mechanisms for the whole progression from normal skin to AK to invasive cSCC, we performed single-cell RNA sequencing (scRNA-seq) to acquire the transcriptomes of 138,982 cells from 13 samples of six patients including AK, squamous cell carcinoma in situ (SCCIS), cSCC, and their matched normal tissues, covering comprehensive clinical courses of cSCC. We identified diverse cell types, including important subtypes with different gene expression profiles and functions in major keratinocytes. In SCCIS, we discovered the malignant subtypes of basal cells with differential proliferative and migration potential. Differentially expressed genes (DEGs) analysis screened out multiple key driver genes including transcription factors along AK to cSCC progression. Immunohistochemistry (IHC)/immunofluorescence (IF) experiments and single-cell ATAC sequencing (scATAC-seq) data verified the expression changes of these genes. The functional experiments confirmed the important roles of these genes in regulating cell proliferation, apoptosis, migration, and invasion in cSCC tumor. Furthermore, we comprehensively described the tumor microenvironment (TME) landscape and potential keratinocyte-TME crosstalk in cSCC providing theoretical basis for immunotherapy. Together, our findings provide a valuable resource for deciphering the progression from AK to cSCC and identifying potential targets for anticancer treatment of cSCC.
Assuntos
Carcinoma de Células Escamosas , Ceratose Actínica , Neoplasias Cutâneas , Humanos , Carcinoma de Células Escamosas/metabolismo , Ceratose Actínica/genética , Ceratose Actínica/metabolismo , Ceratose Actínica/patologia , Neoplasias Cutâneas/patologia , Queratinócitos/metabolismo , Transcriptoma , Microambiente Tumoral/genéticaRESUMO
During the survey on freshwater hyphomycetes in Guangxi, Guizhou and Hainan Provinces, China, five fresh collections were encountered. Based on their morphology, these five isolates were identified as belonging to Hermatomyces, Kirschsteiniothelia, Paramonodictys, Pleopunctum and Sparticola. Multi-gene phylogenetic analyses were performed for each genus, which resulted in the identification of five new species, namely Hermatomyces hainanensis, Kirschsteiniothelia ramus, Paramonodictys globosa, Pleopunctum guizhouense, and Sparticola irregularis. Detailed descriptions and illustrations of the morphological characteristics of these new taxa were provided. This research enriches the biodiversity of freshwater dematiaceous hyphomycetes.
RESUMO
Astragalus membranaceus is a traditional Chinese medicine derived from the roots of Astragalus membranaceus (Fisch.) Bge., which has the same medicinal and edible uses in China. It is also widely used in daily food, and its pharmacological effects mainly include antioxidant effects, vascular softening effects, etc. Currently, it is increasingly widely used in the prevention of hypertension, cerebral ischemia, and stroke in China. Formononetin and its glucopyranoside (ononin) are both important components of Astragalus membranaceuss and may play important roles in the treatment of cardiovascular diseases (CVDs). This study conducted metabolic studies using formononectin and its glucopyranoside (ononin), including a combination of the in vitro metabolism of Formonetin using rat liver S9 and the in vivo metabolism of ononin administered orally to rats. Five metabolites (Sm2, 7, 9, 10, and 12) were obtained from the solution incubated with formononetin and rat hepatic S9 fraction using chromatographic methods. The structures of the five metabolites were elucidated as (Sm2)6,7,4'-trihydroxy-isoflavonoid; (Sm7)7,4'-dihydroxy-isoflavonoid; (Sm9)7,8,4'-trihydroxy-isoflavonoid; (Sm10)7,8,-dihydroxy-4'-methoxy-isoflavonoid; and (Sm12)6,7-dihydroxy-4'-methoxy- isoflavonoid on the basis of UV, NMR, and MS data. Totally, 14 metabolites were identified via HPLC-DAD-ESI-IT-TOF-MSn analysis, from which the formononetin was incubated with rat hepatic S9 fraction, and the main metabolic pathways were hydroxylation, demethylation, and glycosylation. Then, 21 metabolites were identified via HPLC-DAD-ESI-IT-TOF-MSn analysis from the urine samples from SD rats to which ononin was orally administered, and the main metabolic pathways were glucuronidation, hydroxylation, demethylation, and sulfonation. The main difference between the in vitro metabolism of formononetin and the in vivo metabolism of ononin is that ononin undergoes deglycemic transformation into Formonetin in the rat intestine, while Formonetin is absorbed into the bloodstream for metabolism, and the metabolic products also produce combined metabolites during in vivo metabolism. The six metabolites obtained from the aforementioned separation indicate the primary forms of formononetin metabolism, and due to their higher contents of similar isoflavone metabolites, they are considered the main active compounds that are responsible for pharmacological effects. To investigate the metabolites of the active ingredients of formononetin in the rat liver S9 system, network pharmacology was used to evaluate the cardiovascular disease (CVD) activities of the six primary metabolites that were structurally identified. Additionally, the macromolecular docking results of six main components and two core targets (HSP90AA1 and SRC) related to CVD showed that formononetin and its main metabolites, Sm10 and Sm12, may have roles in CVD treatment due to their strong binding activities with the HSP90AA1 receptor, while the Sm7 metabolite may have a role in CVD treatment due to its strong binding activity with the SRC receptor.
Assuntos
Doenças Cardiovasculares , Medicamentos de Ervas Chinesas , Isoflavonas , Ratos , Animais , Ratos Sprague-Dawley , Medicamentos de Ervas Chinesas/química , Farmacologia em Rede , Isoflavonas/química , Cromatografia Líquida de Alta Pressão/métodos , Fígado/metabolismoRESUMO
A sulfoxide directed C-H metalation/boration/B2Pin2 mediated reduction/Suzuki coupling process to synthesize 4-substituted dibenzothiophene (DBT) in one-pot from dibenzothiophene-5-oxide (DBTO) was developed. A variety of DBT-based heterobiaryls were prepared in satisfactory to good yields. A mechanism was proposed. The application of this methodology was demonstrated by synthesizing a luminescent material.