A mouse model of galactose-1-phosphate uridyl transferase deficiency.

Galactose-1-phosphate uridyl transferase (GALT) deficiency causes classical galactosemia in humans. Mice deficient in this enzyme were created by gene targeting. GALT-deficient mice develop biochemical features similar to those seen in humans with GALT deficiency, but fail to develop the pattern of acute toxicity seen in newborns with classical galactosemia. This study suggests that alternative routes of galactose metabolism are important in the pathogenesis of galactosemia.

Dominant mutation of the murine Hox-2.2 gene results in developmental abnormalities.

Genes carrying the homeobox were originally identified in Drosophila, in which they are now known to play key roles in establishing segmentation patterns and in determining segment identities. A number of genes with striking homology to the Drosophila homeobox genes have now been found in the mouse genome, and mutational analysis is beginning to shed light on their function in mammalian development. To understand better the developmental significance of the murine Hox-2.2 gene, we have generated gain of function mutants by using the chicken beta-actin promoter to drive ubiquitous expression in transgenic mice. The resulting Hox-2.2 misexpression produces early postnatal lethality as well as craniofacial and axial skeletal perturbations that include open eyes at birth, cleft palate, micrognathia, microtia, skull bone deficiencies, and structural and positional alterations in the vertebral column. We repeatedly observe complete or partial absence of the supraoccipital bone and malformations of the exoccipital and the basioccipital bones. These results suggests a role for the Hox-2.2 gene in specifying positional identity along the anterior-posterior axis.

Ectopic expression of Hox-2.3 induces craniofacial and skeletal malformations in transgenic mice.

To better understand the role of the Hox-2.3 murine homeobox gene during development, a dominant gain-of-function mutation was generated. The developmental malformations that resulted when the chicken beta-actin promoter was used to direct widespread expression of the Hox-2.3 gene in transgenic mice included early postnatal death as well as craniofacial abnormalities, including open eyes and cleft palate. Ventricular septal defects were also observed in the hearts of three transgenic mice. Skeletal malformations were seen in the bones of the craniocervical transition, with the occipital, basisphenoid, and atlas bones deficient or misshapen. Interestingly, one mutant exhibited an extra pair of ribs as well as alterations in cervical vertebrae identities. Some of the malformations observed in Hox-2.3 gain-of-function mutants overlap with those seen in Hox-1.1 and Hox-2.2 misexpression mutants which suggests functional similarities between paralogous homeobox genes. The results of these experiments are consistent with a role for Hox-2.3 in specifying positional information during development.

Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate position-independent transgene expression.

We previously observed that human ADA gene expression, required for the intrathymic maturation of T cells, is controlled by first-intron sequences. Used as a cis activator, the intron generates copy-dependent reporter expression in transgenic thymocytes, and we here dissect its critical determinants. Of six DNase I-hypersensitive sites (HS sites) in the intron, only HS III was a transfection-active classic enhancer in T cells. The enhancer contains a critical core region, ACATGGCAGTTGGTGGTGGAGGGGAACA, that interacts with at least two factors, ADA-NF1 and ADA-NF2. Activity of the core is strongly augmented by adjacent elements contained within a 200-bp domain corresponding to the limits of HS III hypersensitivity. These core-adjacent sequences include consensus matches for recognition by the AP-1, TCF-1 alpha, mu E, and Ets transcription factor families. In contrast, considerably more extensive sequences flanking the enhancer domain were required for position-independent and copy-proportional expression in transgenic mouse thymocytes. The additionally required upstream segment encompassed the nonenhancer HS II site. The required downstream segment, composed largely of Alu-repetitive DNA, was non-DNase I hypersensitive. Transgenes that lacked either segment were subject to strong positional effects. Among these variably expressing lines, the expression level correlated with the degree of hypersensitivity at HS III. This finding suggests that formation of hypersensitivity is normally facilitated by the flanking segments. These results delineate a complex thymic regulatory region within the intron and indicate that a series of interactions is necessary for the enhancer domain to function consistently within chromatin.