Benzo[g]quinoxaline-Based Complexes [Ir(pbt)2(dppn)]Cl and [Ir(pt)2(dppn)]Cl: Modulation of Photo-Oxidation Activity and Light-Controlled Luminescence.

Based on benzo[i]dipyrido[3,2-a:2',3'-c]phenazine (dppn) with photo-oxidation activity, complexes [Ir(pbt)2(dppn)]Cl (1) and [Ir(pt)2(dppn)]Cl (2) have been synthesized (pbtH = 2-phenylbenzothiazole, and ptH = 2-phenylthiazole), with two aims, including studying the influence of the cyclometalating ligands (pbt- in 1, pt- in 2) on the photo-oxidation activity of these complexes and exploring their photo-oxidation-induced luminescence. Both 1H nuclear magnetic resonance (NMR) and electrospray (ES) mass spectrometry indicate that the benzo[g]quinoxaline moiety in complex 1 can be oxidized at room temperature upon irradiation with 415 nm light. Thus, this complex in CH2Cl2 shows photo-oxidation-induced turn-on yellow luminescence. In contrast, complex 2 reveals significant structural decomposition during the process of photo-oxidation due to incorporating a cyclometalating ligand pt- instead of pbt- in complex 1. In this paper, we report the photo-oxidation behaviors and the related luminescence modulation in 1 and 2 and discuss the relationship between structure and photo-oxidation activity in these complexes.

Quantum dynamics simulation of intramolecular singlet fission in covalently linked tetracene dimer.

In this work, we study singlet fission in tetracene para-dimers, covalently linked by a phenyl group. In contrast to most previous studies, we account for the full quantum dynamics of the combined excitonic and vibrational system. For our simulations, we choose a numerically unbiased representation of the molecule's wave function, enabling us to compare with experiments, exhibiting good agreement. Having access to the full wave function allows us to study in detail the post-quench dynamics of the excitons. Here, one of our main findings is the identification of a time scale t0 ≈ 35 fs dominated by coherent dynamics. It is within this time scale that the larger fraction of the singlet fission yield is generated. We also report on a reduced number of phononic modes that play a crucial role in the energy transfer between excitonic and vibrational systems. Notably, the oscillation frequency of these modes coincides with the observed electronic coherence time t0. We extend our investigations by also studying the dependency of the dynamics on the excitonic energy levels that, for instance, can be experimentally tuned by means of the solvent polarity. Here, our findings indicate that the singlet fission yield can be doubled, while the electronic coherence time t0 is mainly unaffected.

Two Anthracene-Based Ir(III) Complexes [Ir(pbt)2(aip)]Cl and [Ir(pbt)2(aipm)]Cl: Relationship between Substituent Group and Photo-oxidation Activity as Well as Photo-oxidation-Induced Luminescence.

Two anthracene-based complexes [Ir(pbt)2(aip)]Cl (1) and [Ir(pbt)2(aipm)]Cl (2) have been synthesized based on the ligands aip = 2-(9-anthryl)-1H-imidazo[4,5-f][1,10]phenanthroline, aipm = 2-(9-anthryl)-1-methyl-imidazo[4,5-f][1,10]phenanthroline, and pbtH = 2-phenylbenzothiazole in order to explore both the influence of the substituent group R1 (R1 = H in 1 and CH3 in 2) on photo-oxidation activity and photo-oxidation-induced luminescence. Both 1H NMR spectra and ES mass spectra indicate that the anthracene moiety in complex 1 can be oxidized at room temperature upon irradiation with 365 nm light. Thus, this complex shows photo-oxidation-induced turn-on yellow luminescence. Compared to 1, complex 2 incorporates an R1 = CH3 group, resulting in very weak photo-oxidation activity. On the basis of experimental results and quantum chemical calculation, we report the differences between 1 and 2 in both photo-oxidation behavior and the related luminescence modulation and discuss the relationship between photo-oxidation activity and substituent group R1 in these complexes.

Single-Molecule MicroRNA Electrochemiluminescence Detection Using Cyclometalated Dinuclear Ir(III) Complex with Synergistic Effect.

The realization of electrochemiluminescence (ECL) detection at the single-molecule level is a longstanding goal of ECL assay that requires a novel ECL probe with significantly enhanced luminescence. Here, the synergistic effect of electrochemiluminescence (ECL) is observed unprecedentedly in a new cyclometalated dinuclear Ir(III) complex [Ir2(dfppy)4(imiphenH)]PF6 (1·PF6, PF6- = hexafluorophosphate) in which two {Ir(dfppy)2}+ units are bridged by an imiphenH- ligand. The ECL intensity from complex 1·PF6 is 4.4 and 28.7 times as high as that of its reference mononuclear complexes 2 and 3·PF6, respectively. Theoretical calculation reveals that the S0 to S1 excitation is a local excitation in 1·PF6 with two electron-coupled Ir(III) centers, which contributes to the enhanced ECL. The synergistic effect of ECL in 1·PF6 can be used to detect microRNA 21 at the single-molecule level (microRNA 21: UAGCUUAUCAGACUGAUGUUGA), with detectable ECL emission from this complex intercalated in DNA/microRNA 21 duplex as low as 90 helix molecules. The finding of the synergistic effect of ECL will not only provide a novel strategy for the modulation of ECL intensity but also enable the detection of microRNA at the single-molecule level.