Drought stress-inducible synthetic promoters designed for poplar are functional in rice.

KEY MESSAGE: Water deficit-inducible synthetic promoters, SD9-2 and SD18-1, designed for use in the dicot poplar, are functional in the monocot crop, rice.

Novel synthetic inducible promoters controlling gene expression during water-deficit stress with green tissue specificity in transgenic poplar.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

JGI Plant Gene Atlas: an updateable transcriptome resource to improve functional gene descriptions across the plant kingdom.

Gene functional descriptions offer a crucial line of evidence for candidate genes underlying trait variation. Conversely, plant responses to environmental cues represent important resources to decipher gene function and subsequently provide molecular targets for plant improvement through gene editing. However, biological roles of large proportions of genes across the plant phylogeny are poorly annotated. Here we describe the Joint Genome Institute (JGI) Plant Gene Atlas, an updateable data resource consisting of transcript abundance assays spanning 18 diverse species. To integrate across these diverse genotypes, we analyzed expression profiles, built gene clusters that exhibited tissue/condition specific expression, and tested for transcriptional response to environmental queues. We discovered extensive phylogenetically constrained and condition-specific expression profiles for genes without any previously documented functional annotation. Such conserved expression patterns and tightly co-expressed gene clusters let us assign expression derived additional biological information to 64 495 genes with otherwise unknown functions. The ever-expanding Gene Atlas resource is available at JGI Plant Gene Atlas (https://plantgeneatlas.jgi.doe.gov) and Phytozome (https://phytozome.jgi.doe.gov/), providing bulk access to data and user-specified queries of gene sets. Combined, these web interfaces let users access differentially expressed genes, track orthologs across the Gene Atlas plants, graphically represent co-expressed genes, and visualize gene ontology and pathway enrichments.

Engineered gamma radiation phytosensors for environmental monitoring.

Nuclear energy, already a practical solution for supplying energy on a scale similar to fossil fuels, will likely increase its footprint over the next several decades to meet current climate goals. Gamma radiation is produced during fission in existing nuclear reactors and thus the need to detect leakage from nuclear plants, and effects of such leakage on ecosystems will likely also increase. At present, gamma radiation is detected using mechanical sensors that have several drawbacks, including: (i) limited availability; (ii) reliance on power supply; and (iii) requirement of human presence in dangerous areas. To overcome these limitations, we have developed a plant biosensor (phytosensor) to detect low-dose ionizing radiation. The system utilizes synthetic biology to engineer a dosimetric switch into potato utilizing the plant's native DNA damage response (DDR) machinery to produce a fluorescent output. In this work, the radiation phytosensor was shown to respond to a wide range of gamma radiation exposure (10-80 Grey) producing a reporter signal that was detectable at >3 m. Further, a pressure test of the top radiation phytosensor in a complex mesocosm demonstrated full function of the system in a 'real world' scenario.

Genome-Editing of FtsZ1 for Alteration of Starch Granule Size in Potato Tubers.

Genome-editing has enabled rapid improvement for staple food crops, such as potato, a key beneficiary of the technology. In potato, starch contained within tubers represents the primary product for use in food and non-food industries. Starch granules are produced in the plastids of tubers with plastid size correlated with the size of starch grana. The division of plastids is controlled by proteins, including the tubulin-like GTPase FtsZ1. The altered expression of FtsZ1 has been shown to disrupt plastid division, leading to the production of "macro-plastid"-containing plants. These macro-chloroplast plants are characterized by cells containing fewer and enlarged plastids. In this work, we utilize CRISPR/Cas9 to generate FtsZ1 edited potato lines to demonstrate that genome-editing can be used to increase the size of starch granules in tubers. Altered plastid morphology was comparable to the overexpression of FtsZ1 in previous work in potato and other crops. Several lines were generated with up to a 1.98-fold increase in starch granule size that was otherwise phenotypically indistinguishable from wild-type plants. Further, starch paste from one of the most promising lines showed a 2.07-fold increase in final viscosity. The advantages of enlarged starch granules and the potential of CRISPR/Cas9-based technologies for food crop improvement are further discussed.

Synthetic Promoter Screening Using Poplar Mesophyll Protoplast Transformation.

Plant protoplasts are useful to study both transcriptional regulation and protein subcellular localization in rapid screens. Protoplast transformation can be used in automated platforms for design-build-test cycles of plant promoters, including synthetic promoters. A notable application of protoplasts comes from recent successes in dissecting synthetic promoter activity with poplar mesophyll protoplasts. For this purpose, we constructed plasmids with TurboGFP driven by a synthetic promoter together with TurboRFP constitutively controlled by a 35S promoter, to monitor transformation efficiency, allowing versatile screening of high numbers of cells by monitoring green fluorescent protein expression in transformed protoplasts. Herein, we introduce a protocol for poplar mesophyll protoplast isolation followed by protoplast transformation and image analysis for the selection of valuable synthetic promoters. Graphical overview.

Performance of abiotic stress-inducible synthetic promoters in genetically engineered hybrid poplar (Populus tremula × Populus alba).

Abiotic stresses can cause significant damage to plants. For sustainable bioenergy crop production, it is critical to generate resistant crops to such stress. Engineering promoters to control the precise expression of stress resistance genes is a very effective way to address the problem. Here we developed stably transformed Populus tremula × Populus alba hybrid poplar (INRA 717-1B4) containing one-of-six synthetic drought stress-inducible promoters (SDs; SD9-1, SD9-2, SD9-3, SD13-1, SD18-1, and SD18-3) identified previously by transient transformation assays. We screened green fluorescent protein (GFP) induction in poplar under osmotic stress conditions. Of six transgenic lines containing synthetic promoter, three lines (SD18-1, 9-2, and 9-3) had significant GFP expression in both salt and osmotic stress treatments. Each synthetic promoter employed heptamerized repeats of specific and short cis-regulatory elements (7 repeats of 7-8 bases). To verify whether the repeats of longer sequences can improve osmotic stress responsiveness, a transgenic poplar containing the synthetic promoter of the heptamerized entire SD9 motif (20 bases, containing all partial SD9 motifs) was generated and measured for GFP induction under osmotic stress. The heptamerized entire SD9 motif did not result in higher GFP expression than the shorter promoters consisting of heptamerized SD9-1, 9-2, and 9-3 (partial SD9) motifs. This result indicates that shorter synthetic promoters (~50 bp) can be used for versatile control of gene expression in transgenic poplar. These synthetic promoters will be useful tools to engineer stress-resilient bioenergy tree crops in the future.

Plant synthetic biology innovations for biofuels and bioproducts.

Plant-based biosynthesis of fuels, chemicals, and materials promotes environmental sustainability, which includes decreases in greenhouse gas emissions, water pollution, and loss of biodiversity. Advances in plant synthetic biology (synbio) should improve precision and efficacy of genetic engineering for sustainability. Applicable synbio innovations include genome editing, gene circuit design, synthetic promoter development, gene stacking technologies, and the design of environmental sensors. Moreover, recent advancements in developing spatially resolved and single-cell omics contribute to the discovery and characterization of cell-type-specific mechanisms and spatiotemporal gene regulations in distinct plant tissues for the expression of cell- and tissue-specific genes, resulting in improved bioproduction. This review highlights recent plant synbio progress and new single-cell molecular profiling towards sustainable biofuel and biomaterial production.

Novel Candidate Genes Differentially Expressed in Glyphosate-Treated Horseweed (Conyza canadensis).

The evolution of herbicide-resistant weed species is a serious threat for weed control. Therefore, we need an improved understanding of how gene regulation confers herbicide resistance in order to slow the evolution of resistance. The present study analyzed differentially expressed genes after glyphosate treatment on a glyphosate-resistant Tennessee ecotype (TNR) of horseweed (Conyza canadensis), compared to a susceptible biotype (TNS). A read size of 100.2 M was sequenced on the Illumina platform and subjected to de novo assembly, resulting in 77,072 gene-level contigs, of which 32,493 were uniquely annotated by a BlastX alignment of protein sequence similarity. The most differentially expressed genes were enriched in the gene ontology (GO) term of the transmembrane transport protein. In addition, fifteen upregulated genes were identified in TNR after glyphosate treatment but were not detected in TNS. Ten of these upregulated genes were transmembrane transporter or kinase receptor proteins. Therefore, a combination of changes in gene expression among transmembrane receptor and kinase receptor proteins may be important for endowing non-target-site glyphosate-resistant C. canadensis.

Rational design and testing of abiotic stress-inducible synthetic promoters from poplar cis-regulatory elements.

Abiotic stress resistance traits may be especially crucial for sustainable production of bioenergy tree crops. Here, we show the performance of a set of rationally designed osmotic-related and salt stress-inducible synthetic promoters for use in hybrid poplar. De novo motif-detecting algorithms yielded 30 water-deficit (SD) and 34 salt stress (SS) candidate DNA motifs from relevant poplar transcriptomes. We selected three conserved water-deficit stress motifs (SD18, SD13 and SD9) found in 16 co-expressed gene promoters, and we discovered a well-conserved motif for salt response (SS16). We characterized several native poplar stress-inducible promoters to enable comparisons with our synthetic promoters. Fifteen synthetic promoters were designed using various SD and SS subdomains, in which heptameric repeats of five-to-eight subdomain bases were fused to a common core promoter downstream, which, in turn, drove a green fluorescent protein (GFP) gene for reporter assays. These 15 synthetic promoters were screened by transient expression assays in poplar leaf mesophyll protoplasts and agroinfiltrated Nicotiana benthamiana leaves under osmotic stress conditions. Twelve synthetic promoters were induced in transient expression assays with a GFP readout. Of these, five promoters (SD18-1, SD9-2, SS16-1, SS16-2 and SS16-3) endowed higher inducibility under osmotic stress conditions than native promoters. These five synthetic promoters were stably transformed into Arabidopsis thaliana to study inducibility in whole plants. Herein, SD18-1 and SD9-2 were induced by water-deficit stress, whereas SS16-1, SS16-2 and SS16-3 were induced by salt stress. The synthetic biology design pipeline resulted in five synthetic promoters that outperformed endogenous promoters in transgenic plants.

PdWND3A, a wood-associated NAC domain-containing protein, affects lignin biosynthesis and composition in Populus.

BACKGROUND: Plant secondary cell wall is a renewable feedstock for biofuels and biomaterials production. Arabidopsis VASCULAR-RELATED NAC DOMAIN (VND) has been demonstrated to be a key transcription factor regulating secondary cell wall biosynthesis. However, less is known about its role in the woody species. RESULTS: Here we report the functional characterization of Populus deltoides WOOD-ASSOCIATED NAC DOMAIN protein 3 (PdWND3A), a sequence homolog of Arabidopsis VND4 and VND5 that are members of transcription factor networks regulating secondary cell wall biosynthesis. PdWND3A was expressed at higher level in the xylem than in other tissues. The stem tissues of transgenic P. deltoides overexpressing PdWND3A (OXPdWND3A) contained more vessel cells than that of wild-type plants. Furthermore, lignin content and lignin monomer syringyl and guaiacyl (S/G) ratio were higher in OXPdWND3A transgenic plants than in wild-type plants. Consistent with these observations, the expression of FERULATE 5-HYDROXYLASE1 (F5H1), encoding an enzyme involved in the biosynthesis of sinapyl alcohol (S unit monolignol), was elevated in OXPdWND3A transgenic plants. Saccharification analysis indicated that the rate of sugar release was reduced in the transgenic plants. In addition, OXPdWND3A transgenic plants produced lower amounts of biomass than wild-type plants. CONCLUSIONS: PdWND3A affects lignin biosynthesis and composition and negatively impacts sugar release and biomass production.

Mediation of plant-mycorrhizal interaction by a lectin receptor-like kinase.

The molecular mechanisms underlying mycorrhizal symbioses, the most ubiquitous and impactful mutualistic plant-microbial interaction in nature, are largely unknown. Through genetic mapping, resequencing and molecular validation, we demonstrate that a G-type lectin receptor-like kinase (lecRLK) mediates the symbiotic interaction between Populus and the ectomycorrhizal fungus Laccaria bicolor. This finding uncovers an important molecular step in the establishment of symbiotic plant-fungal associations and provides a molecular target for engineering beneficial mycorrhizal relationships.

Transcriptomic Analysis Identifies New Non-Target Site Glyphosate-Resistance Genes in Conyza bonariensis.

Conyza bonariensis (hairy fleabane) is one of the most problematic and widespread glyphosate-resistant weeds in the world. This highly competitive weed species significantly interferes with crop growth and substantially decreases crop yield. Despite its agricultural importance, the molecular mechanisms of glyphosate resistance are still unknown. The present RNA-Seq study was performed with the goal of identifying differentially expressed candidate transcripts (genes) related to metabolism-based non-target site glyphosate resistance in C. bonariensis. The whole-transcriptome was de novo assembled from glyphosate-resistant and -sensitive biotypes of C. bonariensis from Southern Brazil. The RNA was extracted from untreated and glyphosate-treated plants at several timepoints up to 288 h after treatment in both biotypes. The transcriptome assembly produced 90,124 contigs with an average length of 777 bp and N50 of 1118 bp. In response to glyphosate treatment, differential gene expression analysis was performed on glyphosate-resistant and -sensitive biotypes. A total of 9622 genes were differentially expressed as a response to glyphosate treatment in both biotypes, 4297 (44.6%) being up- and 5325 (55.4%) down-regulated. The resistant biotype presented 1770 up- and 2333 down-regulated genes while the sensitive biotype had 2335 and 2800 up- and down-regulated genes, respectively. Among them, 974 up- and 1290 down-regulated genes were co-expressed in both biotypes. In the present work, we identified 41 new candidate target genes from five families related to herbicide transport and metabolism: 19 ABC transporters, 10 CYP450s, one glutathione S-transferase (GST), five glycosyltransferases (GT), and six genes related to antioxidant enzyme catalase (CAT), peroxidase (POD), and superoxide dismutase (SOD). The candidate genes may participate in metabolic-based glyphosate resistance via oxidation, conjugation, transport, and degradation, plus antioxidation. One or more of these genes might 'rescue' resistant plants from irreversible damage after glyphosate treatment. The 41 target genes we report in the present study may inform further functional genomics studies, including gene editing approaches to elucidate glyphosate-resistance mechanisms in C. bonariensis.

Association mapping, transcriptomics, and transient expression identify candidate genes mediating plant-pathogen interactions in a tree.

Invasive microbes causing diseases such as sudden oak death negatively affect ecosystems and economies around the world. The deployment of resistant genotypes for combating introduced diseases typically relies on breeding programs that can take decades to complete. To demonstrate how this process can be accelerated, we employed a genome-wide association mapping of ca 1,000 resequenced Populus trichocarpa trees individually challenged with Sphaerulina musiva, an invasive fungal pathogen. Among significant associations, three loci associated with resistance were identified and predicted to encode one putative membrane-bound L-type receptor-like kinase and two receptor-like proteins. A susceptibility-associated locus was predicted to encode a putative G-type D-mannose-binding receptor-like kinase. Multiple lines of evidence, including allele analysis, transcriptomics, binding assays, and overexpression, support the hypothesized function of these candidate genes in the P. trichocarpa response to S. musiva.

Selective sets of mRNAs localize to extracellular paramural bodies in a rice glup6 mutant.

The transport of rice glutelin storage proteins to the storage vacuoles requires the Rab5 GTPase and its related guanine nucleotide exchange factor (Rab5-GEF). Loss of function of these membrane vesicular trafficking factors results in the initial secretion of storage proteins and later their partial engulfment by the plasma membrane to form an extracellular paramural body (PMB), an aborted endosome complex. Here, we show that in the rice Rab5-GEF mutant glup6, glutelin RNAs are specifically mislocalized from their normal location on the cisternal endoplasmic reticulum (ER) to the protein body-ER, and are also apparently translocated to the PMBs. We substantiated the association of mRNAs with this aborted endosome complex by RNA-seq of PMBs purified by flow cytometry. Two PMB-associated groups of RNA were readily resolved: those that were specifically enriched in this aborted complex and those that were highly expressed in the cytoplasm. Examination of the PMB-enriched RNAs indicated that they were not a random sampling of the glup6 transcriptome but, instead, encompassed only a few functional mRNA classes. Although specific autophagy is also an alternative mechanism, our results support the view that RNA localization may co-opt membrane vesicular trafficking, and that many RNAs that share function or intracellular location are co-transported in developing rice seeds.

Defining the genetic components of callus formation: A GWAS approach.

A characteristic feature of plant cells is the ability to form callus from parenchyma cells in response to biotic and abiotic stimuli. Tissue culture propagation of recalcitrant plant species and genetic engineering for desired phenotypes typically depends on efficient in vitro callus generation. Callus formation is under genetic regulation, and consequently, a molecular understanding of this process underlies successful generation for propagation materials and/or introduction of genetic elements in experimental or industrial applications. Herein, we identified 11 genetic loci significantly associated with callus formation in Populus trichocarpa using a genome-wide association study (GWAS) approach. Eight of the 11 significant gene associations were consistent across biological replications, exceeding a chromosome-wide-log10 (p) = 4.46 [p = 3.47E-05] Bonferroni-adjusted significance threshold. These eight genes were used as hub genes in a high-resolution co-expression network analysis to gain insight into the genome-wide basis of callus formation. A network of positively and negatively co-expressed genes, including several transcription factors, was identified. As proof-of-principle, a transient protoplast assay confirmed the negative regulation of a Chloroplast Nucleoid DNA-binding-related gene (Potri.018G014800) by the LEC2 transcription factor. Many of the candidate genes and co-expressed genes were 1) linked to cell division and cell cycling in plants and 2) showed homology to tumor and cancer-related genes in humans. The GWAS approach based on a high-resolution marker set, and the ability to manipulate targets genes in vitro, provided a catalog of high-confidence genes linked to callus formation that can serve as an important resource for successful manipulation of model and non-model plant species, and likewise, suggests a robust method of discovering common homologous functions across organisms.

Genome-wide association studies and expression-based quantitative trait loci analyses reveal roles of HCT2 in caffeoylquinic acid biosynthesis and its regulation by defense-responsive transcription factors in Populus.

3-O-caffeoylquinic acid, also known as chlorogenic acid (CGA), functions as an intermediate in lignin biosynthesis in the phenylpropanoid pathway. It is widely distributed among numerous plant species and acts as an antioxidant in both plants and animals. Using GC-MS, we discovered consistent and extreme variation in CGA content across a population of 739 4-yr-old Populus trichocarpa accessions. We performed genome-wide association studies (GWAS) from 917 P. trichocarpa accessions and expression-based quantitative trait loci (eQTL) analyses to identify key regulators. The GWAS and eQTL analyses resolved an overlapped interval encompassing a hydroxycinnamoyl-CoA:shikimate hydroxycinnamoyl transferase 2 (PtHCT2) that was significantly associated with CGA and partially characterized metabolite abundances. PtHCT2 leaf expression was significantly correlated with CGA abundance and it was regulated by cis-eQTLs containing W-box for WRKY binding. Among all nine PtHCT homologs, PtHCT2 is the only one that responds to infection by the fungal pathogen Sphaerulina musiva (a Populus pathogen). Validation using protoplast-based transient expression system suggests that PtHCT2 is regulated by the defense-responsive WRKY. These results are consistent with reports of CGA functioning as an antioxidant in response to biotic stress. This study provides insights into data-driven and omics-based inference of gene function in woody species.

Agronomic performance of Populus deltoides trees engineered for biofuel production.

BACKGROUND: One of the major barriers to the development of lignocellulosic feedstocks is the recalcitrance of plant cell walls to deconstruction and saccharification. Recalcitrance can be reduced by targeting genes involved in cell wall biosynthesis, but this can have unintended consequences that compromise the agronomic performance of the trees under field conditions. Here we report the results of a field trial of fourteen distinct transgenic Populus deltoides lines that had previously demonstrated reduced recalcitrance without yield penalties under greenhouse conditions. RESULTS: Survival and productivity of the trial were excellent in the first year, and there was little evidence for reduced performance of the transgenic lines with modified target gene expression. Surprisingly, the most striking phenotypic effects in this trial were for two empty-vector control lines that had modified bud set and bud flush. This is most likely due to somaclonal variation or insertional mutagenesis. Traits related to yield, crown architecture, herbivory, pathogen response, and frost damage showed few significant differences between target gene transgenics and empty vector controls. However, there were a few interesting exceptions. Lines overexpressing the DUF231 gene, a putative O-acetyltransferase, showed early bud flush and marginally increased height growth. Lines overexpressing the DUF266 gene, a putative glycosyltransferase, had significantly decreased stem internode length and slightly higher volume index. Finally, lines overexpressing the PFD2 gene, a putative member of the prefoldin complex, had a slightly reduced volume index. CONCLUSIONS: This field trial demonstrates that these cell wall modifications, which decreased cell wall recalcitrance under laboratory conditions, did not seriously compromise first-year performance in the field, despite substantial challenges, including an outbreak of a stem boring insect (Gypsonoma haimbachiana), attack by a leaf rust pathogen (Melampsora spp.), and a late frost event. This bodes well for the potential utility of these lines as advanced biofuels feedstocks.

Overexpression of a Domain of Unknown Function 266-containing protein results in high cellulose content, reduced recalcitrance, and enhanced plant growth in the bioenergy crop Populus.

BACKGROUND: Domain of Unknown Function 266 (DUF266) is a plant-specific domain. DUF266-containing proteins (DUF266 proteins) have been categorized as 'not classified glycosyltransferases (GTnc)' due to amino acid similarity with GTs. However, little is known about the function of DUF266 proteins. RESULTS: Phylogenetic analysis revealed that DUF266 proteins are only present in the land plants including moss and lycophyte. We report the functional characterization of one member of DUF266 proteins in Populus, PdDUF266A. PdDUF266A was ubiquitously expressed with high abundance in the xylem. In Populus transgenic plants overexpressing PdDUF266A (OXPdDUF266A), the glucose and cellulose contents were significantly higher, while the lignin content was lower than that in the wild type. Degree of polymerization of cellulose in OXPdDUF266A transgenic plants was also higher, whereas cellulose crystallinity index remained unchanged. Gene expression analysis indicated that cellulose biosynthesis-related genes such as CESA and SUSY were upregulated in mature leaf and xylem of OXPdDUF266A transgenic plants. Moreover, PdDUF266A overexpression resulted in an increase of biomass production. Their glucose contents and biomass phenotypes were further validated via heterologous expression of PdDUF266A in Arabidopsis. Results from saccharification treatment demonstrated that the rate of sugar release was increased by approximately 38% in the OXPdDUF266A transgenic plants. CONCLUSIONS: These results suggest that the overexpression of PdDUF266A can increase cellulose content, reduce recalcitrance, and enhance biomass production, and that PdDUF266A is a promising target for genetic manipulation for biofuel production.

Overexpression of a Domain of Unknown Function 231-containing protein increases O-xylan acetylation and cellulose biosynthesis in Populus.

BACKGROUND: Domain of Unknown Function 231-containing proteins (DUF231) are plant specific and their function is largely unknown. Studies in the model plants Arabidopsis and rice suggested that some DUF231 proteins act in the process of O-acetyl substitution of hemicellulose and esterification of pectin. However, little is known about the function of DUF231 proteins in woody plant species. RESULTS: This study provides evidence supporting that one member of DUF231 family proteins in the woody perennial plant Populus deltoides (genotype WV94), PdDUF231A, has a role in the acetylation of xylan and affects cellulose biosynthesis. A total of 52 DUF231-containing proteins were identified in the Populus genome. In P. deltoides transgenic lines overexpressing PdDUF231A (OXPdDUF231A), glucose and cellulose contents were increased. Consistent with these results, the transcript levels of cellulose biosynthesis-related genes were increased in the OXPdDUF231A transgenic lines. Furthermore, the relative content of total acetylated xylan was increased in the OXPdDUF231A transgenic lines. Enzymatic saccharification assays revealed that the rate of glucose release increased in OXPdDUF231A transgenic lines. Plant biomass productivity was also increased in OXPdDUF231A transgenic lines. CONCLUSIONS: These results suggest that PdDUF231A affects cellulose biosynthesis and plays a role in the acetylation of xylan. PdDUF231A is a promising target for genetic modification for biofuel production because biomass productivity and compositional quality can be simultaneously improved through overexpression.