Managing immune checkpoint inhibitor-associated gastritis: Insights and strategies.

Immune checkpoint inhibitors (ICIs) are widely used due to their effectiveness in treating various tumors. Immune-related adverse events (irAEs) are defined as adverse effects resulting from ICI treatment. Gastrointestinal irAEs are a common type of irAEs characterized by intestinal side effects, such as diarrhea and colitis, which may lead to the discontinuation of ICIs.

Liver X receptor inverse agonist SR9243 attenuates rheumatoid arthritis via modulating glycolytic metabolism of macrophages.

Liver X receptors (LXRs) which link lipid metabolism and inflammation, were overexpressed in experimental rheumatoid arthritis (RA) rats as observed in our previous studies, while suppression of LXRα by silybin ameliorates arthritis and abnormal lipid metabolism. However, the role of LXRs in RA remains undefined. In this study, we investigated the inhibition role of LXRs in the polarization and activation of M1 macrophage by using a special LXRs inverse agonist SR9243, which led to ameliorating the progression of adjuvant-induced arthritis (AIA) in rats. Mechanistically, SR9243 disrupted the LPS/IFN-γ-induced Warburg effect in M1 macrophages, while glycolysis inhibitor 2-DG attenuated the inhibition effect of SR9243 on M1 polarization and the cytokines expression of M1 macrophages including iNOS, TNF-α, and IL-6 in vitro. Furthermore, SR9243 downregulated key glycolytic enzymes, including LDH-A, HK2, G6PD, GLUT1, and HIF-1α in M1 macrophages, which is mediated by increased phosphorylation of AMPK (Thr172) and reduced downstream phosphorylation of mTOR (Ser2448). Importantly, gene silencing of LXRs compromises the inhibition effect of SR9243 on M1 macrophage polarization and activation. Collectively, for the first time, our findings suggest that the LXR inverse agonist SR9243 mitigates adjuvant-induced rheumatoid arthritis and protects against bone erosion by inhibiting M1 macrophage polarization and activation through modulation of glycolytic metabolism via the AMPK/mTOR/HIF-1α pathway.

Aspirin suppresses hepatocellular carcinoma progression by inhibiting platelet activity.

BACKGROUND: Hepatocellular carcinoma (HCC) is the most common malignant liver disease in the world. Platelets (PLTs) are known to play a key role in the maintenance of liver homeostasis and the pathophysiological processes of a variety of liver diseases. Aspirin is the most classic antiplatelet agent. However, the molecular mechanism of platelet action and whether aspirin can affect HCC progression by inhibiting platelet activity need further study. AIM: To explore the impact of the antiplatelet effect of aspirin on the development of HCC. METHODS: Platelet-rich plasma, platelet plasma, pure platelet, and platelet lysate were prepared, and a coculture model of PLTs and HCC cells was established. CCK-8 analysis, apoptosis analysis, Transwell analysis, and real-time polymerase chain reaction (RT-PCR) were used to analyze the effects of PLTs on the growth, metastasis, and inflammatory microenvironment of HCC. RT-PCR and Western blot were used to detect the effects of platelet activation on tumor-related signaling pathways. Aspirin was used to block the activation and aggregation of PLTs both in vitro and in vivo, and the effect of PLTs on the progression of HCC was detected. RESULTS: PLTs significantly promoted the growth, invasion, epithelial-mesenchymal transition, and formation of an inflammatory microenvironment in HCC cells. Activated PLTs promoted HCC progression by activating the mitogen-activated protein kinase/protein kinase B/signal transducer and activator of transcription three (MAPK/ AKT/STAT3) signaling axis. Additionally, aspirin inhibited HCC progression in vitro and in vivo by inhibiting platelet activation. CONCLUSION: PLTs play an important role in the pathogenesis of HCC, and aspirin can affect HCC progression by inhibiting platelet activity. These results suggest that antiplatelet therapy has promising application prospects in the treatment and combined treatment of HCC.

Clinical Efficacy of Percutaneous Osteoplasty Under Fluoroscopy and Cone-Beam CT Guidance for Painful Sternal Metastases: A Case Series.

Background: Although percutaneous osteoplasty (POP) has been widely accepted and is now being performed for the treatment of painful bone metastases outside the spine. It is emerging as one of the most promising procedures for patients with painful bone metastasis who are unsuitable for surgery or who show resistance to radiotherapy and/or analgesic therapies. However, there are only scarce reports regarding osteoplasty in painful sternal metastases. Subjects and Method: We report four patients with sternal metastases suffered with severe pain of anterior chest wall. The original tumors included lung cancer and thyroid cancer. For the initially pain medication failing, all the four patients received POP procedure under fluoroscopic and cone-beam CT (CBCT) guidance, and obtained satisfying resolution of painful symptoms at 6-month postop follow-up. Conclusion: POP is a safe and effective treatment for pain caused by metastatic bone tumors in the sternum. In practice, however, percutaneous puncture of pathologic sternal fractures can be a challenge because of the long flat contour and the defacement by lytic tumor of bony landmarks. We find that the use of fluoroscopic and CBCT can facilitate POP for flat bone fractures with displacing the trajectory planning, needle advancement, and cement delivery in time.

Dihydroartemisinin-driven selective anti-lung cancer proliferation by binding to EGFR and inhibition of NRAS signaling pathway-induced DNA damage.

Chemotherapeutic agents can inhibit the proliferation of malignant cells due to their cytotoxicity, which is limited by collateral damage. Dihydroartemisinin (DHA), has a selective anti-cancer effect, whose target and mechanism remain uncovered. The present work aims to examine the selective inhibitory effect of DHA as well as the mechanisms involved. The findings revealed that the Lewis cell line (LLC) and A549 cell line (A549) had an extremely rapid proliferation rate compared with the 16HBE cell line (16HBE). LLC and A549 showed an increased expression of NRAS compared with 16HBE. Interestingly, DHA was found to inhibit the proliferation and facilitate the apoptosis of LLC and A549 with significant anti-cancer efficacy and down-regulation of NRAS. Results from molecular docking and cellular thermal shift assay revealed that DHA could bind to epidermal growth factor receptor (EGFR) molecules, attenuating the EGF binding and thus driving the suppressive effect. LLC and A549 also exhibited obvious DNA damage in response to DHA. Further results demonstrated that over-expression of NRAS abated DHA-induced blockage of NRAS. Moreover, not only the DNA damage was impaired, but the proliferation of lung cancer cells was also revitalized while NRAS was over-expression. Taken together, DHA could induce selective anti-lung cancer efficacy through binding to EGFR and thereby abolishing the NRAS signaling pathway, thus leading to DNA damage, which provides a novel theoretical basis for phytomedicine molecular therapy of malignant tumors.

TyG-GGT is a Reliable Non-Invasive Predictor of Advanced Liver Fibrosis in Overweight or Obese Individuals.

BACKGROUND: Liver fibrosis is a predisposing factor for liver cancer. This study will investigate the predictive role of the Triglyceride-glucose and Gamma-glutamyl transferase index (TyG-GGT) as a non-invasive indicator of advanced liver fibrosis in individuals with obesity or overweight. METHOD: We enrolled patients who underwent metabolic and bariatric surgery as well as intraoperative liver biopsies at Zhejiang provincial people's hospital from August 2020 to March 2023. Clinical characteristics, comorbidities, laboratory data, and pathological variables of patients were collected and analysed. Then, we conducted logistics regression model to compare the performance of the TyG-GGT index with other 4 non-invasive models. RESULTS: A total of 65 patients were included in this study. 43(66.2%) of them were female, with the mean body mass index (BMI) of 39.0 ± 7.3 kg/m2. Meanwhile, 24(36.9%) patients were diagnosed with diabetes. Advanced liver fibrosis were observed in 16.9% of patients, while liver cirrhosis was found in 4.6% of patients. The multivariable logistics regression showed that TyG-GGT was an independent risk factor of advanced liver fibrosis (OR = 6.989, P = 0.049). Additionally, compared to another 4 non-invasive liver fibrosis models (NFS = 0.66, FIB4 = 0.65, METS-IR = 0.68, APRI = 0.65), TyG-GGT exhibits the highest AUC value of 0.75. CONCLUSIONS: More than one-third of patients undergoing metabolic and bariatric surgery are afflicted with nonalcoholic steatohepatitis (NASH), and a significant proportion exhibit advanced fibrosis. TyG-GGT was a potentially reliable predictor for screening individuals with overweight or obesity at high risk of advanced liver fibrosis, thus providing clinical guidance for early intervention in this targeted group.

Objective Assessment of Visual Field Defects Caused by Optic Chiasm and Its Posterior Visual Pathway Injury.

OBJECTIVES: To investigate the characteristics and objective assessment method of visual field defects caused by optic chiasm and its posterior visual pathway injury. METHODS: Typical cases of visual field defects caused by injuries to the optic chiasm, optic tracts, optic radiations, and visual cortex were selected. Visual field examinations, visual evoked potential (VEP) and multifocal visual evolved potential (mfVEP) measurements, craniocerebral CT/MRI, and retinal optical coherence tomography (OCT) were performed, respectively, and the aforementioned visual electrophysiological and neuroimaging indicators were analyzed comprehensively. RESULTS: The electrophysiological manifestations of visual field defects caused by optic chiasm injuries were bitemporal hemianopsia mfVEP abnormalities. The visual field defects caused by optic tract, optic radiation, and visual cortex injuries were all manifested homonymous hemianopsia mfVEP abnormalities contralateral to the lesion. Mild relative afferent pupil disorder (RAPD) and characteristic optic nerve atrophy were observed in hemianopsia patients with optic tract injuries, but not in patients with optic radiation or visual cortex injuries. Neuroimaging could provide morphological evidence of damages to the optic chiasm and its posterior visual pathway. CONCLUSIONS: Visual field defects caused by optic chiasm, optic tract, optic radiation, and visual cortex injuries have their respective characteristics. The combined application of mfVEP and static visual field measurements, in combination with neuroimaging, can maximize the assessment of the location and degree of visual pathway damage, providing an effective scheme for the identification of such injuries.

Targeting abnormal lipid metabolism of T cells for systemic lupus erythematosus treatment.

Systemic lupus erythematosus (SLE) is an autoimmune disease in which the immune system attacks its own tissues and organs. However, the causes of SLE remain unknown. Dyslipidemia is a common symptom observed in SLE patients and animal models and is closely correlated to disease activity. Lipid metabolic reprogramming has been considered as a hallmark of the dysfunction of T cells in patients with SLE, therefore, manipulating lipid metabolism provides a potential therapeutic target for treating SLE. A better understanding of the underlying mechanisms for the metabolic events of immune cells under pathological conditions is crucial for tuning immunometabolism to manage autoimmune diseases such as SLE. In this review, we aim to summarize the cross-link between lipid metabolism and the function of T cells as well as the underlying mechanisms, and provide light on the novel therapeutic strategies of active compounds from herbals for the treatment of SLE by targeting lipid metabolism in immune cells.

ß-Elemene enhances erlotinib sensitivity through induction of ferroptosis by upregulating lncRNA H19 in EGFR-mutant non-small cell lung cancer.

Nearly half of all Asian non-small cell lung cancer (NSCLC) patients harbour epidermal growth factor receptor (EGFR) mutations, and first-generation EGFR tyrosine kinase inhibitors (TKIs) are one of the first-line treatments that have improved the outcomes of these patients. Unfortunately, 20% of these patients can not benefit from the treatment. The basis of this primary resistance is poorly understood. Therefore, overcoming EGFR-TKI primary resistance and maintaining the efficacy of TKIs has become a key issue. ß-Elemene, a sesquiterpene compound extracted from Curcuma aromatica Salisb. (wenyujing), has shown potent antitumor effects. In this research, we found that ß-elemene combined with erlotinib enhanced the cytotoxicity of erlotinib to primary EGFR-TKI-resistant NSCLC cells with EGFR mutations and that ferroptosis was involved in the antitumor effect of the combination treatment. We found that lncRNA H19 was significantly downregulated in primary EGFR-TKI-resistant NSCLC cell lines and was upregulated by the combination treatment. Overexpression or knockdown of H19 conferred sensitivity or resistance to erlotinib, respectively, in both in vitro and in vivo studies. The high level of H19 enhanced the cytotoxicity of erlotinib by inducing ferroptosis. In conclusion, our data showed that ß-elemene combined with erlotinib could enhance sensitivity to EGFR-TKIs through induction of ferroptosis via H19 in primary EGFR-TKI-resistant lung cancer, providing a promising strategy to overcome EGFR-TKI resistance in NSCLC patients.

Traditional Herbal Medicine: A Potential Therapeutic Approach for Adjuvant Treatment of Non-small Cell Lung Cancer in the Future.

Lung carcinoma is the primary reason for cancer-associated mortality, and it exhibits the highest mortality and incidence in developed and developing countries. Non-small cell lung cancer (NSCLC) and SCLC are the 2 main types of lung cancer, with NSCLC contributing to 85% of all lung carcinoma cases. Conventional treatment mainly involves surgery, chemoradiotherapy, and immunotherapy, but has a dismal prognosis for many patients. Therefore, identifying an effective adjuvant therapy is urgent. Historically, traditional herbal medicine has been an essential part of complementary and alternative medicine, due to its numerous targets, few side effects and substantial therapeutic benefits. In China and other East Asian countries, traditional herbal medicine is increasingly popular, and is highly accepted by patients as a clinical adjuvant therapy. Numerous studies have reported that herbal extracts and prescription medications are effective at combating tumors. It emphasizes that, by mainly regulating the P13K/AKT signaling pathway, the Wnt signaling pathway, and the NF-κB signaling pathway, herbal medicine induces apoptosis and inhibits the proliferation and migration of tumor cells. The present review discusses the anti-NSCLC mechanisms of herbal medicines and provides options for future adjuvant therapy in patients with NSCLC.

Identification of genetic polymorphisms in unexplained recurrent spontaneous abortion based on whole exome sequencing.

Background: The precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA. Methods: Genomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA. Results: In 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup). Conclusions: These pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Kuwanon G protects HT22 cells from advanced glycation end product-induced damage.

The incidence of diabetic encephalopathy is increasing as the population ages. Evidence suggests that formation and accumulation of advanced glycation end products (AGEs) plays a pivotal role in disease progression, but limited research has been carried out in this area. A previous study demonstrated that Kuwanon G (KWG) had significant anti-oxidative stress and anti-inflammatory properties. As AGEs are oxidative products and inflammation is involved in their generation it is hypothesized that KWG may have effects against AGE-induced neuronal damage. In the present study, mouse hippocampal neuronal cell line HT22 was used. KWG was shown to significantly inhibit AGE-induced cell apoptosis in comparison with a control treatment, as determined by both MTT and flow cytometry. Compared with the AGEs group, expression of pro-apoptotic protein Bax was reduced and expression of anti-apoptotic protein Bcl-2 was increased in the AGEs + KWG group. Both intracellular and extracellular levels of acetylcholine and choline acetyltransferase were significantly elevated after KWG administration in comparison with controls whilethe level of acetylcholinesterase decreased. These changes in protein expression were accompanied by increased levels of superoxide dismutase and glutathione peroxidase synthesis and reduced production of malondialdehyde and reactive oxygen species. Intracellular signaling pathway protein levels were determined by western blot and immunocytochemistry. KWG administration was found to prevent AGE-induced changes to the phosphorylation levels of Akt, IκB-α, glycogen synthase kinase 3 (GSK3)-α and ß, p38 MAPK and NF-κB p65 suggesting a potential neuroprotective effect of KWG against AGE-induced damage was via the PI3K/Akt/GSK3αß signaling pathway. The findings of the present study suggest that KWG may be a potential treatment for diabetic encephalopathy.

Spectrum of ß-Thalassemia Mutations in Some Areas of Guangxi Zhuang Autonomous Region of Southern China: A Study on a Pediatric Population Aged 0-15 Years.

ß-Thalassemia (ß-thal), one of the most common form of single-gene inheritable blood diseases in the world, is highly prevalent in southern China, especially in the Guangxi Zhuang Autonomous Region. To update the ß-thal mutation spectrum in this region, we performed hematological and genetic analyses on 888 ß-thal major (ß-TM), ß-thal intermedia (ß-TI) and ß-thal carrier patients, aged 0-15 years old, from different parts of Guangxi Province. We identified 55 genotypes and 18 ß-thal mutations. The codons 41/42 (-TTCT) (HBB: c.126_129delCTTT) (43.97%), codon 17 (A>T) (HBB: c.52A>T) (25.43%), -28(A>G) (HBB: c.-78A>G) (8.18%), IVS-II-654 (C>T) (HBB: c.316-197C>T) (7.85%) and codon 26 (G>A) (HBB: c.79G>A) (5.02%) were the five most common, accounting for more than 90.0%. The results of our study are providing an up-to-date ß-thal mutation spectrum in the 0-15-year-old pediatric population, which will help genetic counseling and prevention of ß-TM in mainland China's most endemic region, Guangxi Zhuang Autonomous Region.

Vagus nerve plays a pivotal role in CD4+ T cell differentiation during CVB3-induced murine acute myocarditis.

Abnormalities in CD4+ T cell (Th cell) differentiation play an important role in the pathogenesis of viral myocarditis (VMC). Our previous studies demonstrated that activation of the cholinergic anti-inflammatory pathway (CAP) alleviated the inflammatory response. In addition, we observed that right cervical vagotomy aggravates VMC by inhibiting CAP. However, the vagus nerve's effect on differentiation of CD4+ T cells has not been studied in VMC mice to date. In this study, we investigated the effects of cervical vagotomy and the α7nAChR agonist pnu282987 on CD4+ T cell differentiation in a murine myocarditis model (BALB/c) infected with coxsackievirus B3 (CVB3). Splenic CD4+ T cells from CVB3-induced mice obtained and cultured to investigate the potential mechanism of CD4+ T cell differentiation. Each Th cell subset was analyzed by flow cytometry. Our results showed that right cervical vagotomy increased proportions of Th1 and Th17 cells and decreased proportions of Th2 and Treg cells in the spleen. Vagotomy-induced upregulation of T-bet, Ror-γ, IFN-γ, and IL-17 expression while downregulating the expression of Gata3, Foxp3, and IL-4 in the heart. In addition, we observed upregulated levels of proinflammatory cytokines, aggravated myocardial lesions and cellular infiltration, and worsened cardiac function in VMC mice. Pnu282987 administration reversed these outcomes. Furthermore, vagotomy inhibited JAK2-STAT3 activation and enhanced NF-κB activation in splenic CD4+ T cells. The CD4+ T cell differentiation was related to JAK2-STAT3 and NF-κB signal pathways. In conclusion, vagus nerve modulates the inflammatory response by regulating CD4+ T cell differentiation in response to VMC.

Influencing factors of work-related musculoskeletal disorders among civil aviation flight attendants / 中国职业医学

OBJECTIVE: To analyze the prevalence and influencing factors of work-related musculoskeletal disorders(WMSDs) in civil aviation flight attendants. METHODS: A total of 810 flight attendants from three civil aviation airlines in China were selected as research subjects using the convenient sampling method. The revised Musculoskeletal Disorders Investigating Questionnaire was used to investigate the prevalence of WMSDs in various parts of the body in the past year. RESULTS: The total prevalence of WMSDs in flight attendants in this survey was 64.4%(522/810). The prevalence of WMSDs in various parts of the body from high to low was: neck(48.0%), shoulder(38.6%), lower back/waist(26.0%), upper back(19.8%), feet(15.1%), knee(14.0%), hip and leg(11.0%), hand and wrist(9.0%) and elbow(5.1%). The results of multivariate logistic regression analysis showed that working with an uncomfortable posture and the shortage of staff in the work sector were risk factors for neck WMSDs(all P<0.05). The protective factors were sufficient rest time and voluntary decision when to take a break during work(all P<0.05). Carrying heavy objects >20 kg, working in uncomfortable posture and shortage of staff were risk factors for shoulder WMSDs(all P<0.05). Working in uncomfortable posture and repeated an operation every minute were risk factors for lower back/waist WMSDs(all P<0.05), and sufficient rest time was its protective factor(P<0.05). CONCLUSION: The prevalence of WMSDs in civil aviation flight attendants is high, and the neck, shoulder and ower back/waist are the most commonly affected part of the body. The main influencing factors are poor ergonomics and work organization.

Textual Research on Ancient Literature of Classical Prescription Kaixinsan and Its Associated Prescription / 中国实验方剂学杂志

The classical prescription Kaixinsan，which is recorded in an ancient medical book named Beiji Qianjin Yaofang，is one of the famous prescriptions used by ancient physicians to treat amnesia. Research on classical prescriptions has attracted more and more attention from scientific research institutions and related enterprises. Based on ancient books，textual research on origins and development of prescriptions，combing the evolution of prescriptions，preparations，oral ways，taboos and others are the important contents of the study on classical prescriptions. The research results show that the creation of Kaixinsan in Beiji Qianjin Yaofang can be traced back to Kaixinsan recorded in Jiyanfang and Dingzhiwan recorded in Gujinluyanfang. Later generations of physicians created many associated prescriptions in the process of applying Kaixinsan，and the efficacy of these prescriptions was constantly expanded with the development of the times. In the Tang and Song dynasties，Kaixinsan and its associated prescriptions were mainly used to treat amnesia，sorrow，fear，and other diseases. In the Jin and Yuan dynasties，these prescriptions were also used to treat convulsions and yawning. In the Ming dynasty， they were mainly for the treatment of hyperopia， myopia， sprematorrhea，and constipation. In the Qing dynasty，these herbs could be used to treat auricular deafness， aging and sweating. The dosage of Ginseng Radix et Rhizoma and Poria should be increased in the treatment of farsightedness，spermatorrhea and blurred urine，and in the treatment of nearsightedness，the dosage of Polygalae Radix and Haliotidis Concha should be increased. The main pathogenesis of the disease that Kaixinsan and its associated prescriptions treated could be summarized as the deficiency of heart and spleen，imbalance between heart-Yang and kidney-Yin，and the internal resistance of phlegm stagnation. By summarizing the contents of the preparation of tradition Chinese medicine products for Kaixinsan and its associated prescriptions，it is suggested that the dosage form of Kaixinsan can be pills，with the specification size confroming to the most record of ancient generations of physicians，as big as Firmiana platanifolia's fruit.The volume of a single pill is about 0.25 mL and the weight is about 0.3 g. The initial dosage is fifteen pills，which can be modified according to the severity of the illness，with no more than forty pills for each time，three times a day. Also，some excitant food like the sour food，sweet food and mutton should be avoided during the medication. The above research results can provide literature basis for the development of compound tradition Chinese Medicine preparation of Kaixinsan.

Textual Research on Ancient and Modern Literature Analysis and Research of Classical Prescriptions for Shentong Zhuyutang / 中国实验方剂学杂志

The Shentong Zhuyutang is recorded in an ancient medical book named Yilin Gaicuo， and it is one of the classical prescriptions. Based on the literature reviewed，it is generally found that the Shentong Zhuyutang is evolved from the prescription named Chentongsan that recorded by Danxi Xinfa. Statistics on the dosage of clinical research on this prescription in recent years， reference to the textbook and pharmacopoeia dose， at the same time to respect the original dosage， verify historical changes， and ensure the safety of prescriptions， at the same time consider the pharmacy's dispenses， the author recommends that the clinical dosage of Shentong Zhuyutang could be 3 gram of Gentianae Macrophyllae Radix， 6 gram of Chuanxiong Rhizoma， 10 gram of Persicae Semen， 10 gram of Carthami Flos， 6 gram of Glycyrrhizae Radix Et Rhizoma， 3 gram of Notopterygii Rhizoma Et Radix， 5 gram of Myrrha， 12 gram of Angelicae Sinensis Radix， 5 gram of Cyperi Rhizoma，12 gram of Cyathulae Radix， and 6 gram of Pheretima used as a reference. The efficacy of the compound preparation can be marked as promoting blood circulation， removing blood stasis， removing wind and dampness， and relieving pain. At present， most of its research is focused on clinical research and experimental research， and there are few literature on the research of Shentong Zhuyutang from the level of key information verification. The diseases it treats include more than 10， such as Gubi， Pibi， Xuebi， shechuanchuan， headache， postpartum pain and dysmenorrhea， especially in the study of Gubi， which means that it has a huge market demand and broad development prospects in orthopedic diseases， the core point of "blood stasis and cold dampness evil" should be closely held in the course of treatment. Some scholars deem that Shentong Zhuyutang should not be used the method of Force Sweat in the treatment of Bizheng，while others believe that this prescription should be used with caution in menstruation， pregnancy and blood deficiency. Modern pharmacological studies have shown that Shentong Zhuyutang has obvious anti-inflammatory， relieve pain， anticoagulan， nerve and bone protection. In view of the fact that there are less researches on Shentong Zhuyutang except for Gubi， this suggests that the mechanism of this prescription treat other diseases has a relatively broad research space.

Correlation Between Intestinal Flora and Traditional Chinese Medicine Syndromes of Diarrhea： A Review / 中国实验方剂学杂志

Diarrhea is characterized by increased bowel movements and loose and even watery stools. Its occurrence and development have been proved by modern research to be closely related to the imbalance of intestinal flora. Traditional Chinese medicine （TCM） pays a special attention to syndrome differentiation in treating diarrhea. Exploring the TCM syndromes of diarrhea is of great significance to the formulation of TCM diagnosis and treatment scheme of diarrhea and the improvement of clinical curative effects. There exist many similarities between TCM theory and micro-ecological theory concerning diarrhea. With the deepening of intestinal flora research， the significance of intestinal flora in TCM syndrome research has been increasingly highlighted. The close correlation of intestinal flora with the occurrence and development of diarrhea has provided new ideas of deducing syndrome and selecting prescription based on intestinal flora. This paper summarized the relationship between TCM syndromes of diarrhea and microscopic indexes such as immune response， neurotransmitters， brain-gut peptide， and proteins and analyzed the intestinal flora characteristics related to six common TCM syndromes of diarrhea. Meanwhile， based on the theory of deducing syndrome by prescription， namely deducing the syndrome by the efficacy of prescription or its medicinal components， the correlation between TCM syndromes of diarrhea and intestinal flora was indirectly verified， so as to identify the research direction of correlation between intestinal flora and TCM syndromes in the future. Numerous studies have shown that the TCM syndromes of diarrhea were highly correlated with the microscopic indexes such as inflammatory cytokines， neurotransmitters， and proteins. Syndromes and dysbacteriosis both resulted from pathogenic factors acting on the body， which were summarized from different angles. Different TCM syndromes corresponded to specific objective indicators of intestinal flora. Intestinal flora has the potential of being an internal material basis for powerfully revealing the TCM syndromes of diarrhea in the future.

Relation Textual Research Between Effect Variation and Dosage of Famous Classical Formula Kaixinsan / 中国实验方剂学杂志

Kaixinsan recorded in an ancient medical book named Beiji Qianjin Yaofang is one of the famous classical formula，which is one of the common prescriptions used by ancient physicians to treat amnesia. In the process of using this prescription，later generations of physicians derived many kinds of associated prescriptions. The effect and indications of these prescription have been inherited and expanded from those in the Beiji Qianjin Yaofang because of the changes in dosages. Therefore，it is necessary to verify the effect and indications of the formulas and the rules of dosage changes. The research results showed that its basic effects included to nourish the mind，induce resuscitation，strengthen the spleen and calm the mind，and keep balance between heart-Yang and kidney-Yin. The main indications included amnesia，sorrow and sadness，fright and fear，and so on，which may differ slightly in different dynasties. In Song，Jin and Yuan dynasties，it also demonstrated the effect of warming the heart and Yang，clearing away heat and relieving wind besides the basic effects， with basically the same indications （slightly different from those in previous dynasties）. In Ming dynasty，it demonstrated the effect of nourishing Yin，clearing away heat and nourishing blood besides the basic effects，and the indications expanded to farsightedness，nearsightedness，spermatorrhea and blurred urine. In the Qing dynasty，its effect also included to nourish the heart and kidney on the basis of the Ming dynasty，and the indications were basically the same with those in the previous dynasties. The compatibility ratio of ancient physicians in the application of this prescription and its associated prescriptions showed some remarkable features，for example，Ginseng Radix et Rhizoma and Poria should be increased and their ratio was≈1∶1 in the treatment of amnesia，sorrow，sadness，fright，fear，farsightedness，spermatorrhea and blurred urine，with ratio of Polygalae Radix to Acori Tatarinowii Rhizoma≈1∶1； the dosage of Polygalae Radix and Acori Tatarinowii Rhizoma should be increased in the treatment of nearsightedness，and their ratio was≈1∶1. The compatibility ratio of Polygalae Radix-Ginseng Radix et Rhizoma-Poria-Acori Tatarinowii Rhizoma=2∶3∶3∶2 was the most frequent，which basically included the indications of this prescription and its associated prescriptions. According to statistics，the average dosages that ancient physicians used were significantly higher than those in the modern times，Polygalae Radix 57 g，Ginseng Radix et Rhizoma 62 g，Poria 70 g，and Acori Tatarinowii Rhizoma 54 g，respectively in ancient times，while Polygalae Radix 11 g，Ginseng Radix et Rhizoma 15 g，Poria 17 g，and Acori Tatarinowii Rhizoma 9.5 g，respectively in modern times. The above textual research results can provide some reference for preparation of tradition Chinese medicine products of Kaixinsan.

Literature Research on Origin and Application of Classical Prescription Xiebaisan / 中国实验方剂学杂志

Xiebaisan is one of the 100 classical prescriptions published by the state， and the research and development of its compound preparation has gradually become an upsurge. The research and development of classical prescriptions should start from the theory of traditional Chinese medicine and clinical practice， laying a solid foundation for research and development. Based on the above thinking， this study adopts the methods of traceability and bibliometrics to analyze the source， pathogenesis， efficacy， Fangyi and clinical application of Xiebaisan in order to further promote its literature research work. The results show that the origin of Xiebaisan can be traced back to the prescription of Xiefeitang in Yinhai Jingwei（Volume 1）. Although there are more than 20 prescriptions with the same name of Xiebaisan developed in later generations， they either reflect the inheritance and development of Qian Yi's thought of composing prescriptions， or only the meaning of "Xiebai" in the name of the prescription. The main pathogenesis of Xiebaisan is adverse lung Qi of heat. Mori Cortex and Lycii Cortex are sweet and cold， which can clear away lung heat and reduce adverse Qi， and then cough and asthma can stop. Supplemented with Glycyrrhizae Radix et Rhizoma and japonica rice， which are endowed with the meaning of nourishing earth and generating gold， to invigorate spleen and replenish Qi. The compatibility of Xiebaisan can clear away lung heat， relieve cough and asthma， and norish erath and generate gold to treat lung heat， asthma and cough. Although the main treatment of Xiebaisan recorded in ancient books involves various diseases and syndromes of internal， external， gynecology and pediatrics， the pathogenesis of Xiebaisan is "adverse lung Qi of heat". Modern clinical application of Xiebaisan focuses on the respiratory system， skin and subcutaneous tissue system， ear， nose and throat system， digestive system， ophthalmic system， etc.， and it has more advantages in the treatment of pneumonia， cough， bronchitis， epistaxis， acne， bronchiectasis， postinfectious cough， constipation and other diseases. The syndrome differentiation of the above diseases is in accordance with the relevant syndrome types with lung heat as the main pathological factor， so we can modify and apply the prescription appropriately.