RESUMO
Piezo-photocatalysis combines photocatalysis and piezoelectric effects to enhance catalytic efficiency by creating an internal electric field in the photocatalyst, improving carrier separation and overall performance. This study presents a high-performance piezo-photocatalyst for efficient dye degradation using a synergistic barium titanate (BTO)-MXene composite. The composite was synthesized via a facile method, combining the unique properties of BTO nanoparticles with the high conductivity of MXene. The structural and morphological analysis confirmed the successful formation of the composite, with well-dispersed BTO nanoparticles on the MXene surface. The piezo-photocatalytic activity of the composite was evaluated using a typical dye solution (Rhodamine B: RhB) under ultraviolet irradiation and mechanical agitation. The results revealed a remarkable enhancement in dye degradation (90 % in 15 min for piezo-photocatalysis) compared to individual stimuli (58.2 % for photocatalysis and 95.8 % in 90 min for piezocatalysis), highlighting the synergistic effects between BTO and MXene. The enhanced catalytic performance was attributed to the efficient charge separation and transfer facilitated by the composite's structure, leading to increased reactive species generation and dye molecule degradation. Furthermore, the composite exhibited excellent stability and reusability, showcasing its potential for practical applications in wastewater treatment. Overall, this work represents a promising strategy for designing high-performance synergistic catalysts, addressing the pressing need for sustainable solutions in environmental remediation.
RESUMO
Full-waveform inversion (FWI) is one of the leading-edge techniques in ultrasound computed tomography (USCT). FWI reconstructs the images of sound speed by iteratively minimizing the difference between the predicted and measured signals. The challenges of FWI are to improve its stability and reduce its computational cost. In this paper, a new USCT algorithm based on cross-correlation adjustment FWI with source encoding (CCAFWI-SE) is proposed. In this algorithm, the gradient is adjusted using the intermediate signals as the inversion target rather than the measured signals during iteration. The intermediate signals are generated using the travel time difference calculated by cross-correlation. In the case of conventional FWI failure, using the proposed algorithm, the estimated sound speed can converge toward the ground truth. To reduce the computational cost, an intermittent update strategy is implemented. This strategy only requires one time for the calculation of the travel time difference per stage, so that the source encoding can be used. Simulation and laboratory experiments are implemented to validate this approach. The experiment results show it has successfully recovered the sound speed model, while conventional FWI failed when the initial model greatly differed from the ground truth. This verifies that our approach improves the stability of the reconstruction in USCT. In practice, additional computational costs can be reduced by combining our approach with existing methods. The proposed approach increases the robustness of the FWI and expands its application.
RESUMO
BACKGROUND AND AIM: Clinical evidence for early identification and diagnosis of liver cirrhosis (LC) caused by different types of liver disease is limited. We investigated this topic through a meta-analysis of quantitative metabolomics. METHODS: Four databases were searched until October 31, 2022 for studies comparing metabolite levels between patients with different types of liver disease and control individuals. A random-effects model was applied for the meta-analysis. RESULTS: This study included 55 studies with 8266 clinical participants, covering 348 metabolites. In LC related to drug-induced liver injury (DILI), hepatitis B virus (HBV) infection, and non-alcoholic fatty liver disease (NAFLD), the primary bile acid biosynthesis (taurocholic acid: SMD, 1.08[0.81, 1.35]; P < 0.00001; glycocholic acid: SMD, 1.35[1.07, 1.62]; P < 0.00001; taurochenodeoxycholic acid: SMD, 1.36[0.94, 1.78]; P < 0.00001; glycochenodeoxycholic acid: SMD, 1.49[0.93, 2.06]; P < 0.00001), proline and arginine (l-proline: SMD, 1.06[0.53, 1.58]; P < 0.0001; hydroxyproline: SMD, 0.81[0.30, 1.33]; P = 0.002), and fatty acid biosynthesis (palmitic acid: SMD, 0.44[0.21, 0.67]; P = 0.0002; oleic acid: SMD, 0.46[0.19, 0.73]; P = 0.0008; stearic acid: SMD, 0.37[0.07, 0.68]; P = 0.02) metabolic pathways were significantly altered. CONCLUSION: We identified key biomarkers and metabolic characteristics for distinguishing and identifying LC related to different types of liver disease, providing a new perspective for early diagnosis, disease monitoring, and precise treatment.
RESUMO
OBJECTIVE: Blood circulation is an important indicator of wound healing. In this study, a tissue oxygen saturation detecting (TOSD) system that is based on multispectral imaging (MSI) is proposed to quantify the degree of tissue oxygen saturation (StO2) in cutaneous tissues. METHODS: A wound segmentation algorithm is used to segment automatically wound and skin areas, eliminating the need for manual labeling and applying adaptive tissue optics. Animal experiments were conducted on six mice in which they were observed seven times, once every two days. The TOSD system illuminated cutaneous tissues with two wavelengths of light - red ([Formula: see text] nm) and near-infrared ([Formula: see text] nm), and StO2 levels were calculated using images that were captured using a monochrome camera. The wound segmentation algorithm using ResNet34-based U-Net was integrated with computer vision techniques to improve its performance. RESULTS: Animal experiments revealed that the wound segmentation algorithm achieved a Dice score of 93.49%. The StO2 levels that were determined using the TOSD system varied significantly among the phases of wound healing. Changes in StO2 levels were detected before laser speckle contrast imaging (LSCI) detected changes in blood flux. Moreover, statistical features that were extracted from the TOSD system and LSCI were utilized in principal component analysis (PCA) to visualize different wound healing phases. The average silhouette coefficients of the TOSD system with segmentation (ResNet34-based U-Net) and LSCI were 0.2890 and 0.0194, respectively. CONCLUSION: By detecting the StO2 levels of cutaneous tissues using the TOSD system with segmentation, the phases of wound healing were accurately distinguished. This method can support medical personnel in conducting precise wound assessments. Clinical and Translational Impact Statement-This study supports efforts in monitoring StO2 levels, wound segmentation, and wound healing phase classification to improve the efficiency and accuracy of preclinical research in the field.
Assuntos
Algoritmos , Saturação de Oxigênio , Pele , Cicatrização , Cicatrização/fisiologia , Animais , Camundongos , Pele/metabolismo , Pele/diagnóstico por imagem , Pele/irrigação sanguínea , Oxigênio/metabolismo , Processamento de Imagem Assistida por Computador/métodos , Masculino , Imageamento Hiperespectral/métodosRESUMO
The diversity and functionality of gut microbiota may play a crucial role in the function of human motor-related systems. In addition to traditional nutritional supplements, there is growing interest in microecologics due to their potential to enhance sports performance and facilitate post-exercise recovery by modulating the gut microecological environment. However, there is a lack of relevant reviews on this topic. This review provides a comprehensive overview of studies investigating the effects of various types of microecologics, such as probiotics, prebiotics, synbiotics, and postbiotics, on enhancing sports performance and facilitating post-exercise recovery by regulating energy metabolism, mitigating oxidative-stress-induced damage, modulating immune responses, and attenuating bone loss. Although further investigations are warranted to elucidate the underlying mechanisms through which microecologics exert their effects. In summary, this study aims to provide scientific evidence for the future development of microecologics in athletics.
Assuntos
Atletas , Desempenho Atlético , Exercício Físico , Microbioma Gastrointestinal , Probióticos , Humanos , Desempenho Atlético/fisiologia , Probióticos/administração & dosagem , Microbioma Gastrointestinal/fisiologia , Exercício Físico/fisiologia , Prebióticos/administração & dosagem , Simbióticos/administração & dosagem , Metabolismo Energético , Estresse Oxidativo , Suplementos Nutricionais , Recuperação após o ExercícioRESUMO
Solid-state batteries (SSBs) have garnered significant attention in the critical field of sustainable energy storage due to their potential benefits in safety, energy density, and cycle life. The large-scale, cost-effective production of SSBs necessitates the development of high-performance solid-state electrolytes. However, the manufacturing of SSBs relies heavily on the advancement of suitable solid-state electrolytes. Composite polymer electrolytes (CPEs), which combine the advantages of ordered microporous materials (OMMs) and polymer electrolytes, meet the requirements for high ionic conductivity/transference number, stability with respect to electrodes, compatibility with established manufacturing processes, and cost-effectiveness, making them particularly well-suited for mass production of SSBs. This review delineates how structural ordering dictates the fundamental physicochemical properties of OMMs, including ion transport, thermal transfer, and mechanical stability. The applications of prominent OMMs are critically examined, such as metal-organic frameworks, covalent organic frameworks, and zeolites, in CPEs, highlighting how structural ordering facilitates the fulfillment of property requirements. Finally, an outlook on the field is provided, exploring how the properties of CPEs can be enhanced through the dimensional design of OMMs, and the importance of uncovering the underlying "feature-function" mechanisms of various CPE types is underscored.
RESUMO
Different from most antiretroviral drugs that act as passive defenders to inhibit HIV-1 replication inside the host cell, virus inactivators can attack and inactivate HIV-1 virions without relying on their replication cycle. Herein, we describe the discovery of a hydrocarbon double-stapled helix peptide, termed D26. D26 is based on the HIV-1 gp41 protein lentiviral lytic peptide-3 motif (LLP3) sequence, which can efficiently inhibit HIV-1 infection and inactivate cell-free HIV-1 virions. It was noted that D26 was highly resistant to proteolytic degradation and exhibited a remarkably extended in vivo elimination half-life. Additionally, relative to its linear, nonstapled version, D26 exhibited much higher exposure in sanctuary sites for HIV-1. Amazingly, this lead compound also demonstrated detectable oral absorption. Thus, it can be concluded that D26 is a promising candidate for further development as a long-acting, orally applicable HIV-1 inactivator for the treatment of HIV-1 infection.
Assuntos
Fármacos Anti-HIV , Disponibilidade Biológica , Proteína gp41 do Envelope de HIV , HIV-1 , Peptídeos , HIV-1/efeitos dos fármacos , Fármacos Anti-HIV/farmacologia , Fármacos Anti-HIV/química , Fármacos Anti-HIV/farmacocinética , Humanos , Animais , Administração Oral , Proteína gp41 do Envelope de HIV/metabolismo , Proteína gp41 do Envelope de HIV/química , Peptídeos/química , Peptídeos/farmacologia , Peptídeos/farmacocinética , Descoberta de Drogas , Infecções por HIV/tratamento farmacológico , Infecções por HIV/virologia , Meia-VidaRESUMO
With recent large-scale applications and validations, the relative binding free energy (RBFE) calculated using alchemical free energy methods has been proven to be an accurate measure to probe the binding of small-molecule drug candidates. On the other hand, given the flexibility of peptides, it is of great interest to find out whether sufficient sampling could be achieved within the typical time scale of such calculation, and a similar level of accuracy could be reached for peptide drugs. However, the systematic evaluation of such calculations on protein-peptide systems has been less reported. Most reported studies of peptides were restricted to a limited number of data points or lacking experimental support. To demonstrate the applicability of the alchemical free energy method for protein-peptide systems in a typical real-world drug discovery project, we report an application of the thermodynamic integration (TI) method to the RBFE calculation of ghrelin receptor and its peptide agonists. Along with the calculation, the synthesis and in vitro EC50 activity of relamorelin and 17 new peptide derivatives were also reported. A cost-effective criterion to determine the data collection time was proposed for peptides in the TI simulation. The average of three TI repeats yielded a mean absolute error of 0.98 kcal/mol and Pearson's correlation coefficient (R) of 0.77 against the experimental free energy derived from the in vitro EC50 activity, showing good repeatability of the proposed method and a slightly better agreement than the results obtained from the arbitrary time frames up to 20 ns. Although it is limited by having one target and a deduced binding pose, we hope that this study can add some insights into alchemical free energy calculation of protein-peptide systems, providing theoretical assistance to the development of peptide drugs.
Assuntos
Desenho de Fármacos , Peptídeos , Receptores de Grelina , Termodinâmica , Receptores de Grelina/agonistas , Receptores de Grelina/metabolismo , Peptídeos/química , Peptídeos/farmacologia , Humanos , Ligação Proteica , Simulação de Dinâmica Molecular , Conformação ProteicaRESUMO
Accurate and rapid evaluation of density is crucial for evaluating the packing and combustion characteristics of high-energy-density fuels (HEDFs). This parameter is pivotal in the selection of high-performance HEDFs. Our study leveraged a polycyclic compound density data set and quantum chemical (QC) descriptors to establish a correlation with the target properties using the XGBoost algorithm. We utilized a recursive feature elimination method to simplify the model and developed a concise and interpretable density prediction model incorporating only six QC descriptors. The model demonstrated robust performance, achieving coefficients of determination (R 2) of 0.967 and 0.971 for internal and external test sets, respectively, and root-mean-square errors (RMSE) of 0.031 and 0.027 g/cm3, respectively. Compared to the other two mainstream methods, the marginal discrepancy between the predicted and actual molecular densities underscores the model's superior predictive ability and more usefulness for energy density calculation. Furthermore, we developed a web server (SesquiterPre, https://sespre.cmdrg.com/#/) that can simultaneously calculate the density, enthalpy of combustion, and energy density of sesquiterpenoid HEDFs, which greatly facilitates the use of researchers and is of great significance for accelerating the design and screening of novel sesquiterpenoid HEDFs.
RESUMO
Objective: Asthma is a chronic heterogeneous airway disease, and imbalanced T-helper type 1 (Th1) and Th2 cell-mediated inflammation contribute to its pathogenesis. Although it has been suggested that androgen and estrogen were involved in development of asthma, the underlying mechanisms remained largely unclear. Studies have demonstrated that Runx3 could promote naive CD4+ T cells to differentiate into Th1 cells. Hence, our study aimed to explore the potential regulatory mechanism of androgen and estrogen on asthma via modulating Runx3. Methods: First, clinical assessments and pulmonary function tests were conducted on 35 asthma patients and 24 healthy controls. The concentrations of androgen, estrogen, and androgen estrogen ratios were assessed in peripheral blood samples of asthma patients and healthy controls. Then, a murine asthma model was established to explore the effects of estrogen and androgen (alone or in combination) on asthma. Third, an in vitro assay was used to explore the mechanism of combination of androgen and estrogen in asthma. Results: We observed decreased androgen and increased estrogen levels in asthma patients compared with healthy controls. In mice with experimental asthma, there were increased serum concentrations of estrogen and decreased serum concentrations of androgen, intervention with combination of androgen and estrogen alleviated airway inflammations, increased Runx3 expressions and elevated Th1 differentiation. In CD4+ T cells co-cultured with bronchial epithelial cells (BECs), treatment with androgen plus estrogen combination promoted Th1 differentiation, which was mitigated by Runx3 knockdown in BECs and enhanced by Runx3 overexpression. Conclusion: These findings suggest that androgen estrogen combination modulate the Th1/Th2 balance via regulating the expression of Runx3 in BECs, thereby providing experimental evidence supporting androgen and estrogen combination as a novel therapy for asthma.
Assuntos
Androgênios , Asma , Subunidade alfa 3 de Fator de Ligação ao Core , Estrogênios , Adulto , Animais , Feminino , Humanos , Masculino , Camundongos , Pessoa de Meia-Idade , Androgênios/sangue , Asma/tratamento farmacológico , Asma/imunologia , Asma/sangue , Estudos de Casos e Controles , Diferenciação Celular/efeitos dos fármacos , Subunidade alfa 3 de Fator de Ligação ao Core/genética , Subunidade alfa 3 de Fator de Ligação ao Core/metabolismo , Modelos Animais de Doenças , Células Th1/imunologia , Células Th1/efeitos dos fármacos , Células Th2/imunologia , Células Th2/efeitos dos fármacosRESUMO
OBJECTIVES: To prospectively investigate the associations of longitudinal changes in sleep score and LTPA and their combination with all-cause mortality. METHODS: Among 12,543 participants (mean age: 66.1 years) from the Dongfeng-Tongji cohort, we calculated sleep score (range, 0-4, integrating bedtime, sleep duration, sleep quality, and midday napping, higher score indicating healthier sleep) and LTPA at baseline (2008-2010) and the first follow-up (2013) surveys and their 5-year changes (defining stable sleep score as no change and stable LTPA as change within 150 min/week). We prospectively documented deaths from the first follow-up survey (2013) through December 31, 2018. RESULTS: During a mean 5.5-year follow-up, 792 deaths occurred. The 5-year changes in sleep score and LTPA were inversely associated with all-cause mortality risk, regardless of their initial values. When assessing 5-year changes in sleep score and LTPA jointly, compared with the stable sleep score-stable LTPA group, the decreased sleep score-decreased LTPA group had a 40 % (5-85 %) higher all-cause mortality risk, whereas the increased sleep score-increased LTPA group had a 34 % (9-52 %) lower risk. The direction of the joint association was mainly driven by sleep score change. Participants maintaining sleep scores ≥ 3 and LTPA ≥ 150 min/week over 5 years had a 44 % (28-56 %) lower all-cause mortality risk. CONCLUSIONS: Promoting sleep hygiene and LTPA together may benefit efforts in reducing mortality risk, with particular attention to monitoring long-term sleep health.
Assuntos
Exercício Físico , Atividades de Lazer , Sono , Humanos , Masculino , Feminino , Idoso , China/epidemiologia , Pessoa de Meia-Idade , Estudos Prospectivos , Sono/fisiologia , Mortalidade , Estudos de Coortes , Qualidade do Sono , Inquéritos e Questionários , Causas de Morte , Estudos Longitudinais , População do Leste AsiáticoRESUMO
BACKGROUND: S100a8/9 (S100 calcium binding protein a8/9) belongs to the S100 family and has gained a lot of interest as a critical regulator of inflammatory response. Our previous study found that S100a8/9 homolog promoted aortic valve sclerosis in mice with chronic kidney disease. However, the role of S100a8/9 in pressure overload-induced cardiac hypertrophy remains unclear. The present study was to explore the role of S100a8/9 in cardiac hypertrophy. METHODS AND RESULTS: Cardiomyocyte-specific S100a9 loss or gain of function was achieved using an adeno-associated virus system, and the model of cardiac hypertrophy was established by aortic banding-induced pressure overload. The results indicate that S100a8/9 expression was increased in response to pressure overload. S100a9 deficiency alleviated pressure overload-induced hypertrophic response, whereas S100a9 overexpression accelerated cardiac hypertrophy. S100a9-overexpressed mice showed increased FGF23 (fibroblast growth factor 23) expression in the hearts after exposure to pressure overload, which activated calcineurin/NFAT (nuclear factor of activated T cells) signaling in cardiac myocytes and thus promoted hypertrophic response. A specific antibody that blocks FGFR4 (FGF receptor 4) largely abolished the prohypertrophic response of S100a9 in mice. CONCLUSIONS: In conclusion, S100a8/9 promoted the development of cardiac hypertrophy in mice. Targeting S100a8/9 may be a promising therapeutic approach to treat cardiac hypertrophy.
Assuntos
Calgranulina A , Calgranulina B , Modelos Animais de Doenças , Fator de Crescimento de Fibroblastos 23 , Fatores de Crescimento de Fibroblastos , Miócitos Cardíacos , Fatores de Transcrição NFATC , Regulação para Cima , Animais , Calgranulina A/metabolismo , Calgranulina A/genética , Fatores de Crescimento de Fibroblastos/metabolismo , Fatores de Crescimento de Fibroblastos/genética , Calgranulina B/metabolismo , Calgranulina B/genética , Fatores de Transcrição NFATC/metabolismo , Fatores de Transcrição NFATC/genética , Fator de Crescimento de Fibroblastos 23/metabolismo , Miócitos Cardíacos/metabolismo , Miócitos Cardíacos/patologia , Transdução de Sinais , Cardiomegalia/metabolismo , Cardiomegalia/patologia , Camundongos Endogâmicos C57BL , Masculino , Camundongos Knockout , Calcineurina/metabolismo , Camundongos , Hipertrofia Ventricular Esquerda/metabolismo , Hipertrofia Ventricular Esquerda/fisiopatologia , Hipertrofia Ventricular Esquerda/genética , Hipertrofia Ventricular Esquerda/patologia , Remodelação VentricularRESUMO
Wall material types influence the efficacy of nanocarriers in oral delivery systems. We utilized three food biomacromolecules (whey protein isolate, oxidized starch, lipids) to prepare three types of nanocarriers. Our aim was to investigate their performance in digestion, cellular absorption, mucus penetration, intestinal retention, and bioavailability of the encapsulated anthocyanins (Ant). The release rate of protein nanocarriers (Pro-NCs) was twice that of starch nanocarriers (Sta-NCs) and four times that of lipid nanocarriers (Lip-NCs) in simulated gastrointestinal fluid. Additionally, Pro-NCs demonstrated superior transmembrane transport capacity and over three times cellular internalization efficiency than Sta-NCs and Lip-NCs. Sta-NCs exhibited the highest mucus-penetrating capacity, while Pro-NCs displayed the strongest mucoadhesion, resulting in extended gastrointestinal retention time for Pro-NCs. Sta-NCs significantly enhanced the in vivo bioavailability of Ant, nearly twice that of free Ant. Our results demonstrate the critical role of wall material types in optimizing nanocarriers for the specific delivery of bioactive compounds.
Assuntos
Antocianinas , Disponibilidade Biológica , Portadores de Fármacos , Nanopartículas , Antocianinas/química , Antocianinas/administração & dosagem , Antocianinas/farmacocinética , Portadores de Fármacos/química , Animais , Humanos , Administração Oral , Nanopartículas/química , Sistemas de Liberação de Medicamentos/instrumentação , Masculino , Proteínas do Soro do Leite/química , Ratos Sprague-Dawley , Lipídeos/química , Ratos , Amido/química , Células CACO-2RESUMO
BACKGROUND: Adenosine deaminase acting on RNA 1 (ADAR1) is an RNA-editing enzyme that significantly impacts cancer progression and various biological processes. The expression of ADAR1 mRNA has been examined in multiple cancer types using The Cancer Genome Atlas (TCGA) dataset, revealing distinct patterns in kidney chromophobe (KICH), kidney renal clear cell carcinoma (KIRC), kidney renal papillary cell carcinoma (KIRP), and liver hepatocellular carcinoma (LIHC) compared to normal controls. However, the reasons for these differential expressions remain unclear. METHODS: In this study, we performed RT-PCR and western blotting (WB) to validate ADAR1 expression patterns in clinical tissue samples. Survival analysis and immune microenvironment analysis (including immune score and stromal score) were conducted using TCGA data to determine the specific cell types associated with ADAR1, as well as the key genes in those cell types. The relationship between ADAR1 and specific cell types' key genes was verified by immunohistochemistry (IHC), using clinical liver and kidney cancer samples. RESULTS: Our validation analysis revealed that ADAR1 expression was downregulated in KICH, KIRC, and KIRP, while upregulated in LIHC compared to normal tissues. Notably, a significant correlation was found between ADAR1 mRNA expression and patient prognosis, particularly in KIRC, KIRP, and LIHC. Interestingly, we observed a positive correlation between ADAR1 expression and stromal scores in KIRC, whereas a negative correlation was observed in LIHC. Cell type analysis highlighted distinct relationships between ADAR1 expression and the two stromal cell types, blood endothelial cells (BECs) and lymphatic endothelial cells (LECs), and further determined the signature gene claudin-5 (CLDN5), in KIRC and LIHC. Moreover, ADAR1 was inversely related with CLDN5 in KIRC (n = 26) and LIHC (n = 30) samples, verified via IHC. CONCLUSIONS: ADAR1 plays contrasting roles in LIHC and KIRC, associated with the enrichment of BECs and LECs within tumors. This study sheds light on the significant roles of stromal cells within the complex tumor microenvironment (TME) and provides new insights for future research in tumor immunotherapy and precision medicine.
Assuntos
Adenosina Desaminase , Carcinoma Hepatocelular , Carcinoma de Células Renais , Regulação Neoplásica da Expressão Gênica , Neoplasias Renais , Neoplasias Hepáticas , Proteínas de Ligação a RNA , Microambiente Tumoral , Adenosina Desaminase/genética , Adenosina Desaminase/metabolismo , Humanos , Neoplasias Hepáticas/genética , Neoplasias Hepáticas/patologia , Neoplasias Hepáticas/metabolismo , Carcinoma Hepatocelular/genética , Carcinoma Hepatocelular/metabolismo , Carcinoma Hepatocelular/patologia , Carcinoma Hepatocelular/mortalidade , Neoplasias Renais/genética , Neoplasias Renais/patologia , Neoplasias Renais/metabolismo , Neoplasias Renais/mortalidade , Carcinoma de Células Renais/genética , Carcinoma de Células Renais/metabolismo , Carcinoma de Células Renais/patologia , Proteínas de Ligação a RNA/metabolismo , Proteínas de Ligação a RNA/genética , Prognóstico , Feminino , Masculino , Biomarcadores Tumorais/metabolismo , Biomarcadores Tumorais/genética , Pessoa de Meia-IdadeRESUMO
One of the primary concerns for the survival of the human species is the growing demand for food brought on by an increasing global population. New developments in genome-editing technology present promising opportunities for the growth of wholesome and prolific farm animals. Genome editing in large animals is used for a variety of purposes, including biotechnology to improve food production, animal health, and pest management, as well as the development of animal models for fundamental research and biomedicine. Genome editing entails modifying genetic material by removing, adding, or manipulating particular DNA sequences from a particular locus in a way that does not happen naturally. The three primary genome editors are CRISPR/Cas 9, TALENs, and ZFNs. Each of these enzymes is capable of precisely severing nuclear DNA at a predetermined location. One of the most effective inventions is base editing, which enables single base conversions without the requirement for a DNA double-strand break (DSB). As reliable methods for precise genome editing in studies involving animals, cytosine and adenine base editing are now well-established. Effective zygote editing with both cytosine and adenine base editors (ABE) has resulted in the production of animal models. Both base editors produced comparable outcomes for the precise editing of point mutations in somatic cells, advancing the field of gene therapy. This review focused on the principles, methods, recent developments, outstanding applications, the advantages and disadvantages of ZFNs, TALENs, and CRISPR/Cas9 base editors, and prime editing in diverse lab and farm animals. Additionally, we address the methodologies that can be used for gene regulation, base editing, and epigenetic alterations, as well as the significance of genome editing in animal models to better reflect real disease. We also look at methods designed to increase the effectiveness and precision of gene editing tools. Genome editing in large animals is used for a variety of purposes, including biotechnology to improve food production, animal health, and pest management, as well as the development of animal models for fundamental research and biomedicine. This review is an overview of the existing knowledge of the principles, methods, recent developments, outstanding applications, the advantages and disadvantages of zinc finger nucleases (ZFNs), transcription-activator-like endonucleases (TALENs), and clustered regularly interspaced short palindromic repeats associated protein 9 (CRISPR/Cas 9), base editors and prime editing in diverse lab and farm animals, which will offer better and healthier products for the entire human race.
Assuntos
Sistemas CRISPR-Cas , Edição de Genes , Gado , Edição de Genes/métodos , Animais , Gado/genética , Resistência à Doença/genéticaRESUMO
Although dearomative functionalizations enable the direct conversion of flat aromatics into precious three-dimensional architectures, the case for simple arenes remains largely underdeveloped owing to the high aromatic stabilization energy. We herein report a dearomative sequential addition of two nucleophiles to arene π-bonds through umpolung of chromium-arene complexes. This mode enables divergent dearomative carbonylation reactions of benzene derivatives by tolerating various nucleophiles in combination with alcohols or amines under CO-gas-free conditions, thus providing modular access to functionalized esters or amides. The tunable synthesis of 1,3- or 1,4-cyclohexadienes as well as the construction of carbon quaternary centers further highlight the versatility of this dearomatization. Diverse late-stage modifications and derivatizations towards synthetically challenging and bioactive molecules reveal the synthetic utility. A possible mechanism was proposed based on control experiments and intermediate tracking.
RESUMO
BACKGROUND: Gastric cancer (GC) has a high mortality rate worldwide. Despite significant progress in GC diagnosis and treatment, the prognosis for affected patients still remains unfavorable. AIM: To identify important candidate genes related to the development of GC and identify potential pathogenic mechanisms through comprehensive bioinformatics analysis. METHODS: The Gene Expression Omnibus database was used to obtain the GSE183136 dataset, which includes a total of 135 GC samples. The limma package in R software was employed to identify differentially expressed genes (DEGs). Thereafter, enrichment analyses of Gene Ontology (GO) terms and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways were performed for the gene modules using the clusterProfile package in R software. The protein-protein interaction (PPI) networks of target genes were constructed using STRING and visualized by Cytoscape software. The common hub genes that emerged in the cohort of DEGs that was retrieved from the GEPIA database were then screened using a Venn Diagram. The expression levels of these overlapping genes in stomach adenocarcinoma samples and non-tumor samples and their association with prognosis in GC patients were also obtained from the GEPIA database and Kaplan-Meier curves. Moreover, real-time quantitative polymerase chain reaction (RT-qPCR) and western blotting were performed to determine the mRNA and protein levels of glutamic-pyruvic transaminase (GPT) in GC and normal immortalized cell lines. In addition, cell viability, cell cycle distribution, migration and invasion were evaluated by cell counting kit-8, flow cytometry and transwell assays. Furthermore, we also conducted a retrospective analysis on 70 GC patients diagnosed and surgically treated in Wenzhou Central Hospital, Dingli Clinical College of Wenzhou Medical University, The Second Affiliated Hospital of Shanghai University between January 2017 to December 2020. The tumor and adjacent normal samples were collected from the patients to determine the potential association between the expression level of GPT and the clinical as well as pathological features of GC patients. RESULTS: We selected 19214 genes from the GSE183136 dataset, among which there were 250 downregulated genes and 401 upregulated genes in the tumor samples of stage III-IV in comparison to those in tumor samples of stage I-II with a P-value < 0.05. In addition, GO and KEGG results revealed that the various upregulated DEGs were mainly enriched in plasma membrane and neuroactive ligand-receptor interaction, whereas the downregulated DEGs were primarily enriched in cytosol and pancreatic secretion, vascular smooth muscle contraction and biosynthesis of the different cofactors. Furthermore, PPI networks were constructed based on the various upregulated and downregulated genes, and there were a total 15 upregulated and 10 downregulated hub genes. After a comprehensive analysis, several hub genes, including runt-related transcription factor 2 (RUNX2), salmonella pathogenicity island 1 (SPI1), lysyl oxidase (LOX), fibrillin 1 (FBN1) and GPT, displayed prognostic values. Interestingly, it was observed that GPT was downregulated in GC cells and its upregulation could suppress the malignant phenotypes of GC cells. Furthermore, the expression level of GPT was found to be associated with age, lymph node metastasis, pathological staging and distant metastasis (P < 0.05). CONCLUSION: RUNX2, SPI1, LOX, FBN1 and GPT were identified key hub genes in GC by bioinformatics analysis. GPT was significantly associated with the prognosis of GC, and its upregulation can effectively inhibit the proliferative, migrative and invasive capabilities of GC cells.
RESUMO
Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.