Antibiotic resistance in patients with urinary tract infections in Pakistan.

BACKGROUND: The level of antibiotic resistance of pathogens causing uncomplicated urinary tract infections (UTIs) is increasing. The 2017-2018 GLASS (Global Antimicrobial Resistance and Use Surveillance System) report indicated >70% resistance to ceftriaxone and ciprofloxacin in Escherichia coli in Pakistan. METHODS: A prospective study was conducted in the Médecins Sans Frontières (MSF) supported Timurgara District Hospital, Timurgara, Pakistan, from September 2017 to December 2018. Women aged 18-65 years presenting to the Emergency Department with symptoms of uncomplicated UTI (cystitis/pyelonephritis) were invited to participate. We conducted microbiological culture and sensitivity testing for samples with positive dipstick or nitrite test. RESULTS: Of the 200 patients who participated, 109 (54.5%) were diagnosed with pyelonephritis and 91 (45.5%) with cystitis. Forty-three samples (21.5%) were culture-positive: E. coli was isolated in 27 samples, Enterococcus spp. in 7 and Klebsiella pneumoniae in 6. Overall resistance to ciprofloxacin was observed in 51.8% of E. coli isolates, and ceftriaxone resistance in 66.7% of E. coli isolates and in 33.3% of K. pneumoniae. Resistance to fosfomycin was low (one E. coli isolate). CONCLUSIONS: This study found resistance to first- and second-line antibiotics for treating UTIs as per the MSF protocol. Heightened awareness and potential changes to local prescription practices are necessary to curb the spread of antimicrobial resistance pathogens causing UTIs.

OBJECTIF: Le taux de résistance aux antibiotiques des pathogènes responsables d'infections urinaires non compliquées (UTI) est en hausse. Le rapport GLASS (Global Antimicrobial Resistance and Use Surveillance System) 2017­2018 a indiqué un taux de résistance >70% à la ceftriaxone et à la ciprofloxacine chez Escherichia coli (Pakistan). MÉTHODES: Une étude prospective a été réalisée dans l'hôpital du district de Timurgara géré par Médecins Sans Frontières (MSF), de septembre 2017 à décembre 2018. Les femmes de 18­65 ans consultant aux Urgences avec des symptômes d'UTI non compliquée (cystite/pyélonéphrite) ont été invitées à participer. Nous avons réalisé une culture microbiologique et un test de sensibilité pour les échantillons positifs à la bandelette urinaire et au test de détection des nitrites. RÉSULTATS: Deux cents patients ont participé, dont 109 (54,5%) avaient un diagnostic de pyélonéphrite et 91 (45,5%) un diagnostic de cystite. Quarante-trois échantillons (21,5%) étaient positifs à la culture ; E. coli a été isolé de 27 échantillons, Enterococcus spp. de sept échantillons et Klebsiella pneumoniae de six échantillons. Une résistance à la ciprofloxacine a été observée chez 51,8% des isolats de E. coli, et une résistance à la ceftriaxone chez 66,7% des isolats de E. coli et chez 33,3% des isolats de K. pneumoniae. La résistance à la fosfomycine était faible (un isolat de E. coli). CONCLUSIONS: Cette étude a rapporté une résistance aux antibiotiques de première et deuxième intention utilisés dans le traitement des UTI, conformément au protocole de MSF. Une sensibilisation accrue et un éventuel changement des pratiques locales de prescription sont nécessaires pour freiner la propagation des pathogènes responsables d'UTI résistants aux antimicrobiens.

Diel rhythm of volatile emissions of males and females of the peach fruit fly Bactrocera zonata.

Fruit flies in the genus Bactrocera are among the most destructive insect pests of fruits and vegetables throughout the world. A number of studies have identified volatiles from fruit flies, but few reports have demonstrated behavioral effects or sensitivities of fly antennae to these compounds. We applied a recently developed method of automated headspace analysis using SPME (Solid Phase Microextraction) fibers and GC-MS (gas chromatography mass spectrometry), termed SSGA, to reveal volatiles specific to each sex of B. zonata that are emitted in a diel periodicity. The volatiles released primarily at dusk were identified by GC-MS and chemical syntheses as several spiroacetals, pyrazines, and ethyl esters. Solvent extraction of male rectal glands or airborne collections from each sex, followed by GC-MS, showed that certain of the volatiles increase or decrease in quantity sex-specifically with age of the flies. Electroantennographic (EAG) analysis of dose-response indicates differences in sensitivities of male and female antenna to the various volatiles. Our study provides a comprehensive analysis of the volatile chemicals produced and released by B. zonata and their antennal responses. The possible pheromone and semiochemical roles of the various volatiles released by each sex and the difficulties of establishing behavioral functions are discussed.

Monitoring and mass-trapping methodologies using pheromones: the lesser date moth Batrachedra amydraula.

The lesser date moth (LDM) Batrachedra amydraula is a significant pest of date palm fruits. Previously, detection and monitoring of the pest was inaccurate due to high costs of sampling with lifting machines. We report a practical system for detection and monitoring of LDM based on pheromone traps and relevant models. Dose-response experiments with LDM pheromone traps indicated a 1 mg lure is optimal for monitoring. Delta traps with adhesive covering their entire inner surface gave the highest captures while trap colour was unimportant. Sampling pheromone traps throughout the night indicated male flight began at 1:00-2:00 and reached a peak 2 h before sunrise. Monitoring traps exposed all year long in Israel revealed three generations with different abundance. Trapping transects in a date plantation indicated interference from a monitoring trap became minimal at distances >27 m away. Inter-trap distances closer than this may lower efficiency of monitoring and mass trapping in control programs. Our estimate of the circular effective attraction radius (EARc) of a 1 mg delta trap for LDM (3.43 m) shows this bait is among the most attractive compared with baits for other insects. We developed encounter-rate equations with the pheromone trap EARc to model the interplay between population levels, trap density and captures that are useful for detection of invasive LDM and its control by mass trapping. The integrated methodologies are applicable to many pest species.

Cornelia de lange syndrome with thyroid agenesis of an indonesian patient.

Cornelia de Lange syndrome (CdLs), which is also called Brachmann de Lange syndrome, is a congenital disorder characterized by distinctive facial features, prenatal and postnatal growth deficiency, feeding difficulties, psychomotor delay, behavioral problems, and associated malformations that mainly involve the upper extremities. The prevalence ranges from 1:100,000 to as high as 1:10,000. Most cases (50-60%) were carried mutation in NIPBL gene. To our knowledge this is the first CdLs Indonesian case that reported with molecular analysis study. We present an 11 months old female Indonesian patient with classic CdLs with congenital hypothyroid. Genetics studies were performed in intron 1, exon 2, exon 10 and exon 22 of NIPBL gene. Thyroid studies (T3, T4, TSH and thyroid scan) were performed. Low level of T3 and T4, and high level of TSH were observed. Thyroid agenesis was found in thyroid scan examination. We detected thyroid agenesis which has been never reported in CdLs patients. We could not find any mutation in intron 1, exon 2, exon 10 and exon 22 of NIPBL gene. Further genetics examinations were necessary whether there is mutation in other locus.

Meta-analysis of sentinel lymph node biopsy in breast cancer using the magnetic technique.

BACKGROUND: The standard for sentinel lymph node biopsy (SLNB), the dual technique (radiolabelled tracer and blue dye), has several drawbacks. A novel magnetic technique without these drawbacks has been evaluated in a number of clinical trials. It uses a magnetic tracer and a handheld magnetometer to identify and excise sentinel lymph nodes. A systematic review and meta-analysis was performed to assess the performance and utility of the magnetic in comparison to the standard technique. METHODS: MEDLINE, PubMed, Embase and the Cochrane online literature databases were used to identify all original articles evaluating the magnetic technique for SLNB published up to April 2016. Studies were included if they were prospectively conducted clinical trials comparing the magnetic with the standard technique for SLNB in patients with breast cancer. RESULTS: Seven studies were included. The magnetic technique was non-inferior to the standard technique (z = 3·87, P < 0·001), at a 2 per cent non-inferiority margin. The mean identification rates for the standard and magnetic techniques were 96·8 (range 94·2-99·0) and 97·1 (94·4-98·0) per cent respectively (risk difference (RD) 0·00, 95 per cent c.i. -0·01 to 0·01; P = 0·690). The total lymph node retrieval was significantly higher with the magnetic compared with the standard technique: 2113 (1·9 per patient) versus 2000 (1·8 per patient) (RD 0·05, 0·03 to 0·06; P = 0·003). False-negative rates were 10·9 (range 6-22) per cent for the standard technique and 8·4 (2-22) per cent for the magnetic technique (RD 0·03, 0·00 to 0·06; P = 0·551). The mean discordance rate was 3·9 (range 1·7-6·9) per cent. CONCLUSION: The magnetic technique for SLNB is non-inferior to the standard technique, with a high identification rate but with a significantly higher lymph node retrieval rate.

Sexual maturation and aging of adult male mealybug (Hemiptera: Pseudococcidae).

The physiological age of adult males of seven mealybug species was measured in relation to the elongation of the male pair of the waxy caudal filaments. These filaments begin to emerge after eclosion and reached their maximum length from 29.4-46.6 h. The studied males were divided into three age groups, expressed as percentages of the total waxy caudal filaments length. Attraction to a sex pheromone source was significantly higher in the oldest male group (maximum filaments growth) compared with youngest one. Only the oldest male group copulated successfully; few of the younger males tested displayed 'courtship' behavior towards conspecific virgin females. The calculated duration of the sexually active phase of the adult male life cycle varied among species ranging from 34.4 to 46.6 h. There were marked variations in the strength of attraction to a pheromone source according to time of day. There was a continuous decrease in sexual activity from morning to evening. Our findings reveal clear maturation periods for adult males of the seven studied species. The long immature phase of the adult male mealybug is probably also related to several physiological processes that are needed to complete male maturation. The most noticeable change is the elongation of the waxy caudal filaments. However, mating may be performed at any time ambient conditions are suitable. Whereas male mealybug flight towards a pheromone source is restricted to a few hours, the male may continue mating activity throughout its sexually active period.

Elevated PIN1 expression by C/EBPalpha-p30 blocks C/EBPalpha-induced granulocytic differentiation through c-Jun in AML.

The transcription factor CCAAT enhancer-binding protein alpha (C/EBPalpha) has an important role in granulopoiesis. The tumor suppressor function of C/EBPalpha is shown by the findings that loss of expression or function of C/EBPalpha in leukemic blasts contributes to a block in myeloid cell differentiation and to leukemia. C/EBPalpha mutations are found in around 9% of acute myeloid leukemia (AML) patients. The mechanism by which the mutant form of C/EBPalpha (C/EBPalpha-p30) exerts a differentiation block is not well understood. By using a proteomic screen, we have recently reported PIN1 as a target of C/EBPalpha-p30 in AML. In the present study, we show that C/EBPalpha-p30 induces PIN1 expression. We observed elevated PIN1 expression in leukemic patient samples. Induction of C/EBPalpha-p30 results in recruitment of E2F1 in the PIN1 promoter. We show that the inhibition of PIN1 leads to myeloid differentiation in primary AML blasts with C/EBPalpha mutations. Overexpression of PIN1 in myeloid cells leads to block of granulocyte differentiation. We also show that PIN1 increases the stability of the c-Jun protein by inhibiting c-Jun ubiquitination, and c-Jun blocks granulocyte differentiation mediated by C/EBPalpha. Our data suggest that the inhibition of PIN1 could be a potential strategy of treating AML patients with C/EBPalpha mutation.

Proteomic identification of the MYST domain histone acetyltransferase TIP60 (HTATIP) as a co-activator of the myeloid transcription factor C/EBPalpha.

The transcription factor C/EBPalpha (CEBPA) is a key player in granulopoiesis and leukemogenesis. We have previously reported the interaction of C/EBPalpha with other proteins (utilizing mass spectrometry) in transcriptional regulation. In the present study, we characterized the association of the MYST domain histone acetyltransferase Tat-interactive protein (TIP) 60 (HTATIP) with C/EBPalpha. We show in pull-down and co-precipitation experiments that C/EBPalpha and HTATIP interact. A chromatin immunoprecipitation (ChIP) and a confirmatory Re-ChIP assay revealed in vivo occupancy of the C/EBPalpha and GCSF-R promoter by HTATIP. Reporter gene assays showed that HTATIP is a co-activator of C/EBPalpha. The co-activator function of HTATIP is dependent on its intact histone acetyltransferase (HAT) domain and on the C/EBPalpha DNA-binding domain. The resulting balance between histone acetylation and deacetylation at the C/EBPalpha promoter might represent an important mechanism of C/EBPalpha action. We observed a lower expression of HTATIP mRNA in undifferentiated U937 cells compared to retinoic acid-induced differentiated U937 cells, and correlated expression of CEBPA and HTATIP mRNA levels were observed in leukemia samples. These findings point to a functional synergism between C/EBPalpha and HTATIP in myeloid differentiation and suggest that HTATIP might be an important player in leukemogenesis.

Proteomic discovery of Max as a novel interacting partner of C/EBPalpha: a Myc/Max/Mad link.

The transcription factor CCAAT/enhancer binding protein a (C/EBPalpha) is important in the regulation of granulopoiesis and is disrupted in human acute myeloid leukemia. In the present study, we sought to identify novel C/EBPalpha interacting proteins in vivo through immunoprecipitation using mass spectrometry-based proteomic techniques. We identified Max, a heterodimeric partner of Myc, as one of the interacting proteins of C/EBPalpha in our screen. We confirmed the in vivo interaction of C/EBPalpha with Max and showed that this interaction involves the basic region of C/EBPalpha. Endogenous C/EBPalpha and Max, but not Myc and Max, colocalize in intranuclear structures during granulocytic differentiation of myeloid U937 cells. Max enhanced the transactivation capacity of C/EBPalpha on a minimal promoter. A chromatin immunoprecipitation assay revealed occupancy of the human C/EBPalpha promoter in vivo by Max and Myc under cellular settings and by C/EBPalpha and Max under retinoic acid induced granulocytic differentiation. Interestingly, enforced expression of Max and C/EBPalpha results in granulocytic differentiation of the human hematopoietic CD34(+) cells, as evidenced by CD11b, CD15 and granulocyte colony-stimulating factor receptor expression. Silencing of Max by short hairpin RNA in CD34(+) and U937 cells strongly reduced the differentiation-inducing potential of C/EBPalpha, indicating the importance of C/EBPalpha-Max in myeloid progenitor differentiation. Taken together, our data reveal Max as a novel co-activator of C/EBPalpha functions, thereby suggesting a possible link between C/EBPalpha and Myc-Max-Mad network.

Synthesis and biological activity of the four stereoisomers of 4-methyl-3-heptanol: main component of the aggregation pheromone of Scolytus amygdali.

Stereoisomers of 4-methyl-3-heptanol are major components of aggregation pheromones of bark beetles and trail pheromones of ants. Recently, (3S,4S)-4-methyl-3-heptanol (I) has been tentatively identified as the main component of the aggregation pheromone of the almond bark beetle, Scolytus amygdali (Coleoptera: Scolytidae). The four stereoisomers of 4-methyl-3-heptanol were prepared and bioassayed. Key steps included preparation of chiral 4-methyl-3-heptanones using SAMP and RAMP reagents, reduction to the corresponding alcohols, and stereospecific transesterification with vinyl acetate with lipase AK catalysis. In field tests, only (3S,4S)-4-methyl-3-heptanol attracted beetles in combination with the synergist (3S,4S)-4-methyl-3-hexanol, whereas (3R,4S)- and (3R,4R)-4-methyl-3-heptanols were inhibitory.

Sex pheromone of the citrus mealybug Planococcus citri: synthesis and optimization of trap parameters.

A simple synthesis of the pheromone of the citrus mealybug, Planococcus citri (Risso) (Hemiptera: Pseudococcidae), has been developed. Various factors affecting capture of males have been assessed to optimize the trap design and to develop a lure with high efficacy and longevity. Male capture was the same with the racemic and chiral pheromone; technical pheromone (85% purity) was statistically as attractive as pure pheromone (97%). A special formulation was used to determine the actual release rate of the pheromone under field conditions as related to male capture. Generally, plate traps caught more males than delta traps, and large traps caught more than small ones. The effects of aging on the performance of three types of rubber dispensers were evaluated. It was found that the American dispenser displayed the most consistent trapping performance and could be used for monitoring for at least 16 wk with a load of 200 microg of pheromone. The dose-response of the males to sex pheromone was tested within the range of 25-1,600 microg.

Sex pheromone of the vine mealybug, Planococcus ficus in Israel: occurrence of a second component in a mass-reared population.

Two pheromonal components were detected in airborne collections from the vine mealybug Planococcus ficus (Signoret) (Hemiptera: Pseudococcidae) mass-reared on potato sprouts. The compounds were identified as (S)-lavandulyl senecioate (I) and (S)-lavandulyl isovalerate (II) by GC and GC-MS by comparison with synthetic standards. Chiral GC analysis on a cyclodextrin column established their chirality. Compound I was identified recently as the sex pheromone of P. ficus in California. The attraction of vine mealybug males to both components I and II was demonstrated in a Petri dish bioassay and in a flight assay in the rearing chamber. Indoors, both compounds displayed a similar level of attractiveness to the mass-reared males. However, trials in a vineyard indicated that feral males were attracted only to compound I. Reanalysis of the airborne pheromone indicated that laboratory first generation daughters of females that were collected in the vineyard produce only (S)-lavandulyl senecioate (I). The relative amount of (S)-lavandulyl isovalerate (II) increased gradually in each subsequent generation of P. ficus reared on potatoes. These findings indicate that feral P. ficus mealybugs produce and respond only to (S)-lavandulyl senecioate (I), whereas mealybugs that were reared in the laboratory on potato sprouts produce and respond to both (S)-lavandulyl senecioate (I) and (S)-lavandulyl isovalerate (II).

Quantitative GC analysis of secondary alcohol pheromones: determination of release rate of red palm weevil, Rhynchophorus ferrugineus, pheromone from lures.

Aliphatic secondary alcohols are components of several aggregation pheromones of important beetle and weevil pests. Some of these pheromones are used frequently for the monitoring and mass trapping of the relevant insects. We encountered severe difficulties in direct GC quantitative analysis of these compounds. Therefore, we developed a simple GC analysis of secondary alcohols convening them to trifluoroacetyl derivatives and using secondary alcohol acetates as internal standards. This method was applied for the quantitative analysis of several secondary alcohols, including the aggregation pheromone components of the almond bark beetle and the red palm weevil. The release rate of the latter pheromone from commercial lures was also determined.

[Study of the secondary structure of a single-stranded DNA fragment using self-modification reaction]. / Izuchenie vtorichnoi struktury odnotsepochechnogo fragmenta DNK s ispol'zovaniem reaktsii samomodifikatsii.

Electrophoretic analysis of the products of chemical destruction at modified base residues was used to determine the site-directedness of self-alkylation of the 26-mer DNA fragment pTTGCCTTGAATGGGAAGAGGGTCATT (T26). This fragment possesses a 4-[N-methyl-N-(2-chloroethyl)amino]benzylamido group (CIR-), covalently attached to the 5'-terminal phosphate group both in the presence and in the absence of the oligonucleotide effector (Phn-L)pTGACCCTCp(L-Phn), where Phn is an N-(2-hydroxyethyl)phenazinium residue and L is an ethylenediamine linker. Molecular modeling with the method of molecular mechanics/dynamics (MM/D) was used to investigate the secondary structure of the CIR-T26 conjugate and to interpret the change of the alkylation site upon treatment with CIR-T26 in the presence of an effector.

[Cooperative interactions of oligodeoxyribonucleotides upon binding with DNA by chemical modification]. / Izuchenie kooperativnykh vzaimodeistvii proizvodnykh dezoksiribooligonukleotidov pri sviazyvanii s DNK metodom khimicheskoi modifikatsii.

Quantitative characteristics of the modification of deoxyribooligonucleotide TTGCCTTGAATGG-GAAGAGGGTCATT (P) with 4-(N-2-chloroethyl-N-methylamino)benzyl phosphamide derivative of oligonucleotide pTTCCCA (X) were studied. The modification was performed in the presence of derivatives of the oligonucleotides (Phn-L)pTTCAAGGCp(L-Phn) (E1) and (Phn-L)pTGACCCTCp(L-Phn) (E2), where Phn is the residue of N-(2-hydroxyethyl)phenazinium, and L is ethylene diamine spacer. In PXE1, PXE2, and PXE1E2 complexes, E1, E2, and reagent X are bound with target P in tandem, with E1 near the 3'-end and E2 near the 5'-end of the reagent X. From the dependences of the maximum in time modification degree of target P and the shorter targets containing the complementary binding site for the reagent X on its concentration, the association constants of the complexes PX, PE1, and PE2 were determined as Kx = (4.2 +/- 0.6) x 10(4) M-1, Ke1 = (1.25 +/- 0.44) x 10(7) M-1, and Ke2 = (2.56 +/- 1.22) x 10(6) M-1, respectively. The cooperativity coefficients of joint binding the X, E1, and E2 with the target giving rise to the complexes PXE1, PXE2, and PXE1E2 were estimated as alpha 1 = 15.7 +/- 2.1, alpha 2 = 8.7 +/- 1.2, and alpha 12 = 136.5 +/- 2.6, respectively. The data obtained suggest that E2 is not only the effector of modification but it is also an inhibitor due to the formation of the complex PE2* with Ke2* = (1.97 +/- 1.27) x 10(7) M-1 not capable of adding the reagent X.